Le symbole de distance Reiki suffit à lui seul pour envoyer de l’énergie Reiki à distance ; soit à quelqu’un pour un soin, à une situation dans le monde, ou à soi dans le présent, le passé ou dans le futur.

Un cristal de quartz pur, c’est à dire transparent, n’est pas obligatoire mais il va amplifier, et simplifier puisqu’il va se comporter comme un condensateur (absorbe et restitue l’énergie emmagasiné) et continuer d’envoyer durant quelques jours. On le recharge tous les 3/4 jours, pendant 5 à 15 mn selon les cas à traiter.
      Sinon, avec le symbole seul, on a la chance de pouvoir « envoyer » du reiki à distance chaque jours. A soi et à autrui.

Le cristal pour l’envoie de reiki   à distance amplifie la prière écrite – formulation affirmative positive. Et du fond de votre cœur, bien entendu, vous allez créer la pureté de votre intention. Mais n’oublions pas, qu’une fois entraîné, notre Foi solidement installée, le symbole de distance suffit pour envoyer du Reiki à distance.
Pour toutes les situations !

Pour nettoyer le cristal, vu le nombre de recettes proposées selon les diversités humaines, je vous propose cet échange par mail avec M, qui vient de passer Le niveau Reiki 2.

Nuage-reiki-à-distanceLe 30/09/2011 12:38, M…de S. a écrit : Bonjour Dom,
J’ai trouvé à b..x dans un magasin de pierres des cristaux comme les tiens
Question :dois je les faire tremper une nuit ds l’eau salée ou 2 à 3 heures suffisent elles ,puisqu’ils n’ont jamais servi ?
Merci de ta réponse bon après midi ensoleillé
;M…. de S.
From: « Dom Jeambrun » <dom.jeambrun@neuf.fr>
Sent: Monday, September 26, 2011 7:42 PM
To: « M…de…S. »
Subject: Re: Planete reikiContact

bonjour M…

voilà le genre de question qu’on va poser au SHK.!!!!

Mais je suis là aussi, merci Muryel.

Si, en invoquant le SHK, tu « regarde » par la lentille du Ajna chakra -clairvoyance du 3ème œil (pinéale/pituitaire) tu verras : Ils ont servi !

à :

être stockés, déstockés, restockés, manipulés à l’infini par des âmes aux mains agiles vouées aux causes commerciales…

ils ont été regardés par les visiteurs, jugés, enviés, négligés, rejetés, palpés…surestimés…..entrechoqués

ils ont voisiné avec les autres pierres…

ils ont vécu à la lueur des néons….

Moi je les laisserais tremper deux jours deux nuits, et bien rincés sous l’eau claire, et pendant le temps de tes « manipulations de purifications » je les bénirais et je bénirais l’eau aussi, et le sel aussi…

en fait je te recommande de leur faire un sacre de Re Naissance, un sacre de Bienvenue, de Gratitude anticipée sur TOUS les Services qu’ils vont te rendre durant tous les siècles Reiki que tu envisage de vivre.

et je ne crois pas exagérer.
je t’embrasse


Written on septembre 30th, 2011 , Articles Tags: ,

Questions-réponses Reiki

Questions-réponses Reiki en partage


Questions-réponses Reiki en partage…Anonymes

Pour soulager la souffrance et le mal-être 

En ce qui concerne l’éthique du maître Reiki, le suivi après les stages de formation Reiki ainsi que les informations que je transmets lors des ateliers Reiki – ateliers complémentaires au Reiki comme ; le pardon, l’estime de soi, le rapport à l’argent, méditer avec les pierres, analyser les rêves… – le suivi donc, fait partie du code d’honneur de l’enseignant Reiki. Répondre à vos questions au plus près. Soit pour vous aider vous-même lors d’une problématique d’une question personnelle, soit pour aider quelqu’un pour faire un soin Reiki.

Je partage ici nos échanges afin de partager avec tout le monde, dans le seul but que certaines personnes – de toute la france – puissent y trouver des solutions, des idées ou des pistes de réflexion, pour le plus grand bien du Tout.

Février 2019 – Malaise lors d’un soin Reiki à quelqu’un

A – J’ai besoin de ta lumière pour comprendre stp. J’ai eu une sensation de malaise général sans trop savoir pourquoi… là c’était vraiment en début de malaise pendant que ce soin à ma maman.
J’ai fais un soin usui à ma maman à l’instant. Arrivée au plexus j’ai eu très chaud et j’ai ressenti une lourdeur, un truc qui bloque et qui met mal à l’aise. Au second chakra cette sensation s’est amplifiée et mon chakra gorge s’est complétement bloquée er j’ai ressenti un blocage dans mon plexus aussi. J’avais très chaud et c’était vraiment désagréable.
Arrivée au chakra racine j’ai dû enlever mes mains parce que vraiment je pouvais plus et pouf! J’ai fais un malaise..! 
Pour ma mère elle a ressentie des sensations agréables. Ressentir du chaud c’est normal mais faire un malaise pdt un soin c’est dérangeant quand même ! Est-ce que tu saurais d’où c’est venu ??  Merci, A…….

D – il n’y a pas si longtemps que ça j’ai aidé quelqu’un d’autre qui a eu le même symptôme, ça arrive souvent ce genre de malaise, ne t’inquiète donc pas.

En principe ça vient qu’il y a un lien affectif avec la personne ; trop d’affectif et on se met trop souvent à trop vouloir réussir le soin – trois fois le mot trois dans cette phrase, volontairement – car c’est souvent que l’on veut que la personne aimée soit soignée guérie qu’il lui arrive rien de mauvais, du coup les chakras de la personne vont rentrer beaucoup plus en empathie avec les tiens et absorber ton énergie : celle qu’elle n’a pas, qui lui manque… c’est du vampirisme énergétique quantique naturel… lol…
en effet lorsque l’on se trouve en présence d’une personne à ce qui manque certaines qualités certaines ressource certaines énergies, du fait que nos chakra échange perpétuellement entre nous, les personnes en manque vont nous affaiblir. D’où l’intérêt de faire un double même triple rituel de préparation avec triple protection ; DKM plus CKR plus SKSK sur le cœur plus CKS sur la gorge et bien sûr Rama en grand sur le corps.

Et, si tu pratiques les cinq Gokkaïs régulièrement dès que tu sens venir un petit malaise tu actives un symbole de protection que tu visualises sur tes chakra partant du bas et les Gokkaïs : Shin Paï Suna… suivi de «Gyo Wo Ageme ; regarde ce que tu en train de faire pourquoi tu le fais comment tu le fais pour qui tu le fais…». Car en fait c’est simple ; la devise du Reiki c’est : « pose les mains lâches prise vers l’univers et souri »… quand tu fais un soin il faut lâcher prise totalement, laisser couler le Reiki et le laisser-faire sans rien lui demander , chanter les symboles Karuna® et surtout ne pas VOULOIR !

Une autre interprétation possible ; c’est que toi et ta maman vous avez quelque chose à nettoyer au niveau des chakras du bas… je crois que tu n’es jamais venu à un de mes ateliers chakra ?

En espérant que ça puisse t’aider tout ça… je te souhaite une belle journée ensoleillée.

PS : tiens moi au courant de ton évolution.

– A…. Merci pour ta réponse ! Je savais pas que c’était courant. Merci pour tes conseils…+ de protection pour les prochaines fois… ! Je pratique les cinq gokkaï tous les matins… j’y penserai donc à l’avenir pendant les soins…

j’ai jamais eu l’occasion de venir aux ateliers sur les chakras du bas ! ! Mais je compte venir… car je serais dispos et c’est vrai que je voulais désencombrer les chakras du bas… je manque d’ancrage aussi… ! ! Merci en tout cas ta réponse.


J’aurai une question concernant le « bonhomme à lunette » pour couper les liens avec une ou des personnes. Je voulais savoir si cette méthode, même les plus profonds, c’est-à-dire dans cette vie, dans les vies antérieurs et dans les prochaines vies ?


Je suis libre d’etre un Ane !!!! Mrd.

Est-ce également possible de demander aux personnes concernées de le faire vis-à-vis de moi?

Je pensais faire ensuite des soins à distance sur moi-même et aller voir une chamane pour retirer tous les liens karmiques, la colère, la haine …Merci, G…

D – Bonjour G…d’abord c’est « bonhomme allumette »… c’est la méthode de Jacques Martel : regarde ici en ligne : https://www.google.com/search?q=les+bonhommes+allumettes+de+martel&rlz=1C1CHBF_frFR708FR708&oq=Les+bonhommes+allumettes&aqs=chrome.2.69i57j0l5.3152j0j7&sourceid=chrome&ie=UTF-8

On peut pas demander aux autres de changer, selon leur niveau de cheminement tu pourrais obtenir l’effet inverse. Au contraire, au fur et à mesure que tu prends à cœur ton nettoyage des mémoires personnelles, les liens karmique vis-à-vis des autres se coupent automatiquement. Je parle là d’expériences personnelles, et d’expériences des personnes que je guide depuis 20 ans. Le vécu du Reiki pour soigner à distance les mémoires dans cette vie ; ça soigne automatiquement les mémoires des vies passées.

La meilleure méthode c’est la « guérison ponctuelle dans le passé » – celle où tu te visualises face aux personnes, et tu t’envoies les symboles. (voir la technique dans le livret Manuel Reiki deuxième degré – associée avec la méthode « guérison longue durée du passé » tranche d’âge par tranche d’âge. Et ses 2 méthodes sont amplifiées avec la boîte des cristaux Reiki du troisième degré.

De plus, le petit travail au quotidien matin et soir avec les Gokkaïs vont peu à peu te donner beaucoup plus de puissance et de force au présent, et leurs nouveaux réflexes conditionnés te permettront de mieux prendre en main les mémoires du passé pour les transcender – Les dépasser pour qu’elles laissent place à ta véritable lumière. À ma connaissance il n’existe aucuns chamans sur terre capable d’enlever ‘rapidos’ tous les liens karmiques !  À mon sens c’est une illusion avec risque d’enfermement dans des croyances. Cela ne veut pas dire que je n’ai pas confiance dans le chamanisme au contraire. Cela veut dire que si ça existait ce genre de miracle toute la France serait déjà guérie ! 
Il faut faire preuve de beaucoup de patience et de persévérance. Déterminer quelle est la chose la plus importante qui te bloque le plus aujourd’hui et prendre uniquement cette chose en main avec les outils que tu as appris. Une chose après l’autre, c’est une des lois de l’univers.

Car on n’obtient jamais rien de bon en vouloir tout changer d’un coup.

Stage formation à la maîtrise Reiki, suite

L… P…sam. 5 janv. 18:19 (Il y a 17 heures) – À Dom.J

Bonjour Dom, À mon tour de te souhaiter une bonne année 2019, je suis toujours heureuse de recevoir la nouvelle lettre, je fais partie de l’année ‘Maitrise 2014’. Ce fut un grand bonheur, ce quatrième degré. J’ai créé une association dans ma commune, je suis bénévole dans la maison de retraite chaque semaine, des soins énergétiques, et mes mains qui apaisent en fin de vie, je ne savais pas que je pouvait le faire, j ai beaucoup travaillé sur la vie après la vie, le karma et l’âme,  

J’ai pu aider mon papa dont j’avais été éloigné par mère qui est une femme très difficile, mais les anges étaient près de moi, j ai été appelé et su que papa était a l’hôpital ( Bretagne), avec ma sœur nous l’avons accompagné, mais surtout, pour qu’il parte léger et nous lui avons beaucoup parlé, et j’ai beaucoup de signes chez moi et des messages, depuis 2 ans.

Merci à toi, car le quatrième degré à la façon dont tu l’enseignes, ouvre des portes et nous fais découvrir l’univers, les guides, le monde de l invisible, je suis si attentive depuis.

Dans ma vie de tout les jours je commence ma journée avec la prière et la fin de la journée aussi, et ma bte de cristal aussi. C’est merveilleux cette connexion, cette conscience.

Merci pour tout ! Bientôt 5 ans pour ma formation.

Bien amicalement dans les belles énergies.

Opportunité d’un stage de formation à la maîtrise Reiki en deux jours et tarif réduit.Il reste une place !

E – Tu lances une promo spéciale pour le 4e degrés en février, cela me tente et en même temps je pense que cela serait un peu tôt… je dououououte de moi…..A ce jour j’ai le sentiment de travailler sur le renforcement de la confiance en moi face aux personnes dont l’attitude peut me blesser encore : qu’est-ce que cela réveille ne moi, comment le transformer, comment être honnête avec eux et avec moi sans pour autant les blesser eux ? travail sur l’ancrage.. etc… bref j’ai l’impression d’être au degré 1et 2 ; et puis le 3e c’est récent, je me régale avec DKM mais CKS me semble………………. lointain….. mon avis donc est que le 4e degré est prématuré ; Mais je veux bien ton point de vue sur la question ! sachant que J’ai décidé de faire le stage komyo en mai (niveau 1 et 2 donc ; y aura-il le niveau 3 ?).

D -Si tu es tenté ça peux vouloir dire qu’il y a une ouverture, sinon il n’y aurait pas de tentation. Le symbole de la gorge n’est habituellement transmis qu’au quatrième degré. Et si je le transmets au troisième degré c’est aussi, pour certaines personnes, qu’il fasse un petit travail pour accueillir le quatrième degré plus facilement.

Les symboles supplémentaires, trois symboles, du quatrième degré, agissent sur l’ouverture spirituelle avec une guérison spirituelle définitive. Le travail sur soi se fait avec beaucoup plus de recul et de force intuitive car la connexion au divin est grande, tout en restant connecté à la terre – grâce à la vibration et aux graphisme spécifiques du symbole de Grand Maître Tibétain. Et tu me connais je transmets la maîtrise Reiki dans ce sens, la guérison de l’esprit et de l’émotionnel.

Le cheminement pour guérir la confiance en soi et l’affirmation de soi face aux autres est long, et ce travail se continue après le quatrième degré…ad vitam aeternam, mais avec quelque chose de grand en soi ; les outils pour aller vers la maîtrise de soi. Et face aux autres la clé : l’humilité, que je transmets tout au long du stage de maîtrise ; l’éthique du maître Reiki engagé sur la voie de l’élévation.

Le temps que tu intègres un peu la maîtrise lorsque tu arriveras au Reiki Komyo tu recevras un gros nuage de lâcher prise et de lumière !

Et oui le Reiki Komyo se pratique avec un niveau trois, et aussi un niveau quatre. Ces deux niveaux sont absolument merveilleux ! Je les enseigne dans l’esprit shintoïste, comme je les ai reçus de mes maîtres japonais.

Stage de formation au Reiki Karuna®

Stage de formation au Reiki Karuna®

Ateliers annexes au Reiki clic sur l’image !

De : Madame c… <c…@…..fr>
Sujet : Demande de tarif reiki karuna 
Corps du message :
Bonjour je suis initiée au reiki usui deuxième degré puis je suivre l initiation reiki karuna merci.

Cet e-mail a été envoyé via le formulaire de contact de PLANÈTE REIKI  (http://www.planete-reiki.fr)

Dom – Bonjour chère Madame C…Dans l’enseignement Reiki Usui karuna® et Komyo… disons correct, pour éviter le mot sérieux, donc anxieux… le Reiki karuna® est le Reiki de  » l’élévation par acte de compassion » qui fait suite au Reiki Usui qui est lui, le Reiki de l’éveil. 
Il faut savoir qu’au niveau énergétique et quantique, le canal Reiki atteint en plein essor lors des 2 initiations au troisième degré. Ce qui veut dire que la largeur de votre canal sera au maximum de son ouverture une fois initiée aux deux initiations lors d’un stage troisième degré. Toute information qui sont faites après, comme le Reiki karuna, le Reiki Komyo ou le quatrième degré Reiki, tous les niveaux d’initiations après le troisième degré n’agrandissent plus le canal mais augmentent votre taux vibratoire ainsi que la connexion dans la verticalité, avec les énergies de la source, des guides, des archanges, et des anges.

J’enseigne le Reiki karuna professionnellement depuis 20 ans, avec chaque année une progression spirituelle et émotionnelle, puisque les symboles karuna nous permettent des  connexions très subtiles avec les maîtres attentionnés, et dans cet enseignement je mixe avec mes connaissances de l’angéologie traditionnelle de la kabbale à laquelle je me forme depuis plusieurs années. 

Donc malheureusement ça ne se fait pas, ça n’est pas correct du tout d’initier quelqu’un du deuxième degré au Reiki karuna®. Ça peut être risqué ou ne pas fonctionner correctement.

La raison est : le troisième degré Reiki Usui agit sur l’ouverture du troisième œil avec extension de conscience et du chakra de la gorge. Le troisième degré est un stage qui prépare à la spiritualité. Et le Reiki karuna apporte cette connexion spirituelle et il est tout à fait convenable d’avoir un double bon ancrage ; au niveau des chakras du bas et au niveau du chakra de la gorge pour vraiment pratiquer ce merveilleux Reiki karuna®

Je sais qu’il y a des enseignants Reiki qui s’autorisent à le faire car j’ai ré-initié plusieurs personnes qui ont tenté cette aventure, et une fois qu’elles ont fait le troisième degré est refait un vrai stage Reiki karuna® elles se sont rendues compte de l’incroyable différence.

Les grands maîtres qui nous ont enseigné le Reiki sont des sages qui ont énormément travaillé sur eux en profondeur dans l’émotionnel et en hauteur dans la connexion spirituelle. Ils nous ont transmis une façon de pratiquer qui est parfaite, ainsi que dans leur transmission la sagesse de toutes les philosophies du monde ; une étape après l’autre, graduellement, marche par marche, niveau par niveau. C’est le véritable le seul moyen de s’élever spirituellement dans ce monde social absurde. On ne fait jamais rien de bon dans la précipitation.

Juste ceci pour information ; dès que vous avez fait le stage troisième degré Reiki avec deux initiations vous pouvait tout de suite faire le Reiki karuna niveau un et niveau deux et niveaux quatre si vous avez le niveau quatre eu zui sans délai entre les stages, au troisième degré votre canal Reiki a atteint son taux d’indestructible, d’incorruptible.

Comment se déroule un stage Reiki en amenant son compagnon au stage 1er degré en 3 jours ?

C’est à moi de te remercier, il y avait très très longtemps que je ne m’étais pas sentie aussi bien dans ma vie. 

J’ai aimé le groupe, les partages, ton enseignement mais aussi ce moment passé avec mon compagnon et nos amis après ce que nous avions vécu sur ce stage de 3jours 
Merci merci merci 

Le retour au travail le lundi n’a pas été évident !! …lol 


Retrouver l’innocence d’enfance, mais sans la naïveté !

Naïveté-maturité : c’est bon d’entendre des mots sur des petits vécus du quotidiens, vécus dont on ne sait pas d’ou ils viennent, mais ils viennent ; on a du mal à y croire quelque part… bien sûr cela vient du travail Reiki mais cela vient si tranquillement qu’on a du mal à s’en rendre compte, et en même temps si puissamment…, le regard extérieur nous le confirme, merci ! 
Je progresse car j’ai un grand maitre Reiki, inspiré, inspirant donc motivant ! 😉

Fausses croyances

J’ai aussi une petite interrogation : Franck Lopvet dit que pour lui lorsqu’on cherche à évoluer cela veut dire, en sous couche, que l’on ne s’accepte pas tel que l’on est. Et donc cela bloque l’évolution. Je ne suis pas d’accord car il me semble que l’on peut très bien s’accepter et s’aimer tel que l’on est en ayant conscience que l’on peut toujours évoluer… quel est ton avis ?

D – Personnellement je trouve absurde ce raisonnement. 

Et pour cause ; si on s’acceptait tel que l’on est, on ne chercherait pas à évoluer. Plus logique que ça tu meurs ! 

Les masses dirigeantes sont protégées par l’administration la police et l’armée et les vaccins et la bourse et leurs comptes en banque bien garnie, donc ; il s’acceptent comme ça et ne cherche pas à évoluer, sauf financièrement et sexuellement et en lifting pour garder l’esthétique…

l’évolution karmique se fait comme l’indique l’hindouisme ; à l’image de la fleur de lotus qui puise sa naissance sa force sa puissance beauté en parfum… dans la vase.

Donc tout ce qui nous fait souffrir, tout ce qui nous embête, tout ce qui nous bloque, tout ce qui nous fait peur, tout ce qui nous gêne pour être à l’aise partout où l’on va ; c’est de cette boue, de cette base de décomposition, grâce à notre quête d’évolution spirituelle Reiki, notre introspection aide à faire mûrir et fleurir les lotus de nos huit chakras ! ! 

C – Franck Lopvet : je suis contente de n’avoir pas adhéré à ses théories tête baissée comme je le faisais avant, juste parce qu’il a fait une expérience transcendantale ou tout lui a été révélé… Je garde l’image du lotus, c’est beau 😉

D – Ça me semble correspondre ça, la naïveté dominante qui a fait que l’enfant a été blessé, à cause justement de sa naïveté. Grâce à la connexion Reiki l’intensité de la naïveté diminuant, tu passe d’une vue troisième chakra (nombril) basique-primaire-matérialité a une vue médiumnique (troisième œil) qui active les vertus cognitives de décision grâce à un discernement mature permettant de distinguer entre l’ancien comportement infantile régressif et le nouveau comportement « l’enfant intérieur libéré de la naïveté capable de prendre les décisions et de faire ses choix par lui-même ». Félicitations pour ta progression.

Experte-comptable experte Reiki ! !

Je suis parti au Maroc début novembre sur le trek ‘rose trip’ avec mes futurs employeurs et deux associations partenaires de l’évènement. Extra ordinaire ! Des rencontres et des émotions. Là bas, j’étais « l’expert comptable qui fait du reiki » ! lol !

J’ai entendu ta voix me dire « l’univers ne t’envoie que ce que tu es capable de faire » lorsqu’une participante en deuxième traitement de chimio qui se bat contre un cancer du sein m’a demandé un soin Reiki. Le soin a calmé son angoisse et lui a apporté de la sérénité. C’était vraiment sympa. Pour une autre, le soin lui a tellement apporté d’énergie qu’elle n’a pas dormi de la nuit ! mais elle était radieuse le lendemain matin en m’en parlant ! c’était improvisé et improbable mais j’ai kiffé.

Stage de formation Reiki Komyo

A propos du Reiki Komyo, j’ai vu sur ton site que lorsqu’on est initié 4ème degré USUI, on peut passer les 4 degrés Komyo en un Week-end. Mais que me conseilles tu ? Je suis lente en coordination et rituel, tu l’as vu ! J’utilise ce que tu nous a appris du Reiki USUI mais je suis très loin de maîtriser, au sens de pratiquer comme un art. C’est ce chemin que je souhaites suivre, sentir, ressentir les choses en profondeur, quitte à aller plus lentement…mais peut-être est ce ma peur ou mon conditionnement qui parle…M….Mon mari,pense le contraire.

D – Oui je comprends très bien… et maintenant que tu as fait la formation complète Usui, tu as déjà toutes les bases acquises, n’est-ce pas… lorsque tu feras le stage du Reiki Komyo, ton esprit sera beaucoup plus disponible pour d’autres informations à recevoir pendant le stage. le Reiki Komyo se situe davantage sur l’ouverture du cœur et l’ouverture de conscience, donc ce sera plus pour mettre en expansion toutes les choses que tu as déjà apprises et réussies à intégrer dans le Reiki, et une autre façon de voir et d’aborder l’énergie les symboles. 

Lors des stages Komyo, la veille je me prépare très particulièrement à canaliser l’esprit shintoïste et l’esprit japonais.

Le troisième degré Komyo est axé sur l’ouverture de conscience à un haut niveau D’amour et de spiritualité.

Quant à la maîtrise du Reiki Komyo, le principe par rapport au Reiki Usui est : pas de techniques mais de l’amour, ce qui en shintoïsme est un lien spirituel permanent. Mais ce ne sont là que des mots. Cela ne peut être compris dans la profondeur et dans l’exactitude ce que je dis, qu’en pratiquant lorsque je vous guiderais pour initier les autres, chacun à votre tour, pendant la formation à la maîtrise Reiki Komyo.

En deux mots mon amie, le Reiki Komyo c’est la Soupline du Reiki Usui….‘rigoristes du protocole’ certains ‘maitres’ de l’enseignement conservateur ! 

Donc à mon avis te connaissant un peu quand même… c’est que oui tu peux faire la formation complète Komyo sans inquiétude… et même la faire avec les doutes et la lenteur dont tu parles… car je sais, c’est après la formation que les choses vont se mettre en place mais déjà pendant le stage c’est un enrichissement… oui je crois que le mot est juste ; Soupline Reiki.

Blocage du bassin, plus blocage L 4

—- dom jeambrun a écrit —-mail…

Selon le mail que tu m’envoyais après avoir été consulté l’ostéopathe que je te conseillais, en lui demandant quelles vertèbres étaient en jeu dans ta souffrance du ventre et du sacrum…

L 4 peut survenir suite à un rejet de la sexualité.

Il est important d’accepter d’avoir des désirs, des fantasmes, des besoins… car c’est tout à fait normal et humain, mais lorsqu’on est en manque, qu’on refuse ; être en manque aggrave le risque de rejeter l’énergie sexuelle.

L 4 peut démontrer aussi un sentiment d’insécurité financière, la peur de manquer qui génère une préoccupation, de l’impatience à obtenir tes besoins, d’où l’importance de la pratique du deuxième Gokkaï.

L4 peut être aussi lié à la peur de la carrière, la peur de se lancer dans une activité, de ne pas s’en sortir, de ne pas être à la hauteur, de ne pas réussir… etc.… mais aussi de ne pas savoir exactement où se situe les vraies ressources internes pour obtenir le succès dense d’un projet. Ce qui engendre une peur inconsciente du succès.

L4 démontre aussi un sentiment d’impuissance. C’est-à-dire que face à une situation, ou face à une personne, on se sent impuissant.

Les quatre techniques de purification du passé du deuxième degré Reiki, associé au 5 Gokkaïs, et un choix d’une pratique chaque jour d’imposition des mains amène l’esprit à se restructurer, dans un seul but : être soi-même en toutes circonstances indépendamment de ce que les autres voudraient que l’on soit. C’est cela la véritable puissance intérieure. Et qui rend la vie plus facile

en espérant que tout cela peut t’aider F…, en tout cas il y a là toutes les indications pour un travail à distance dans le passé.

– F…..18:06 (Il y a 1 heure) – À dom

– F…..Il ne manque rien à ce diagnostic précis et dont je suis reconnaissante dans sa totale éloquence, merci,….. Ça me reprend, à la lecture de ces mots… Je me cache en effet face cette évidence, mais je reconnais qu’il va me falloir utiliser les bons outils, merci , à bientôt.
Envoyé depuis mon smartphone Sony Xperia™

D – …pour t’aider un petit peu dans ta démarche de guérison je peux te proposer 2 phrases affirmatives positives actives pour  – cristal de quartz avec les symboles : 

– « avec Amour, j’abandonne le passé. Je me chéris, moi et ma merveilleuse sexualité. Je suis en sécurité. Je suis aimé. Merci univers infini. »

et…….. – « Avec Amour j’aime qui je suis. J’ai mon propre pouvoir comme base. Je suis en sécurité à tous les niveaux. Je demande ce que je veux et l’accepte avec joie et plaisir. Merci univers infini. ».

Tu programmes ainsi 2 cristaux de quartz, 15 minutes chacun, tous les quatre jours.

Et tu copies aussi ces phrases sur 1 bout de papier que tu as toujours sur toi, ton portefeuille, avec tes papiers dans ton sac, dans la poche du jean…..ect…chaque fois que tu sens ces inquiétudes Dans ta tête, tu récites les phrases mentalement, avec force, trois fois de suite. Peut-être seras-tu amené à le faire deux à trois fois par jour… répétition… c’est grâce à la répétition que l’acteur peut incarner le personnage.

Et pour incarner la nouvelle pensée positive tu utiliseras bien sûr, S HK. – Exemple : SHK (3 fois) puis « avec Amour, j’abandonne le passé. Je me chéris, moi et ma merveilleuse sexualité. Je suis en sécurité. Je suis aimé. Merci univers infini. » Et à nouveau S HK (3 fois)…… tu comprends… SHK trois fois et la phrase 3 fois, en alternance. 

En tant que Maître Reiki shintoïste et quantique j’appelle ça ‘alchimie de guérison’. Cette formule, avec le Reiki à distance plus la programmation du quartz, va réveiller le potentiel de ton ADN. Et il est possible aussi qu’il y ait des mémoires qui aient besoin de s’exprimer ; alors sois à l’écoute des messages et des ressentis : accueille ! 
Je t’envoie des pensées lumineuses Reiki pour toute la journée.

Mixer le Reiki avec la réflexologie plantaire

Bonsoir Dom ,
Je te suis reconnaissante de m’avoir initiée au 1er et au second degré Reiki .
Je trouve que tes formations sont denses et intéressantes au point de vu énergétique et spirituelle.   L’ambiance de la communié Reiki m’apporte la joie du partage dans le plus profond respect et en toute convivialité.     Le Reiki que tu enseignes me permet de faire un travail en profondeur, au niveau émotionnel et sur tous les plan de mon être physique .
j’apprends à donner des soins en réflexologie plantaire et en shiatsu en y apportant la touche de Reiki telle que tu me l’as conseillé en stage.    Je souhaite continuer une partie de mon chemin avec toi encore jusqu’à la maitrise.    Encore merci pour ton écoute ta patience et ton empathie.…

D – merci pour ce beau retour. Il y a 15 jours pour toi, une révision de temps forts ce stage deuxième degré. Pour moi aussi. Et comme tu le dis, je remercie le Reiki de m’avoir appris une véritable patience tressée de compassion. Je saurais garder cette patience indéfiniment sur ton cheminement, jusqu’à la maîtrise et qui sait… peut-être aussi que le Reiki Karuna® t’apportera une clarté supplémentaire pour mieux comprendre et guérir le passé.

C’est une très bonne idée de mixer le Reiki avec la réflexologie plantaire… puisque de toute évidence le Reiki est bien le complément parfait de toutes pratiques. Mais je dirais l’inverse ; ‘toutes les pratiques’ viennent en complément de la merveilleuse énergie du Reiki.

À bientôt et bonne continuation à toutes et à tous sur le chemin joyeux et surprenant du Reiki.


Blocage du bassin, plus blocage L 4

Le Reiki c’est le printemps des cellules !

Written on février 18th, 2019 , news

La phrase affirmative positive

La phrase affirmative positive comme un mantra matérialise la pensée

 La phrase affirmative positive

Une intention, démarrer l’année nouvelle, s’aligner sur une fréquence d’énergie positive, la plus optimiste possible. En cadeau de vœux, je vous propose un mantra.

Phrase-affirmative-positive   Une intention, une prière utilisable par toutes et par tous – une phrase affirmative positive active est à répéter trois fois de suite – pour devenir un bon acteur, le passage par la répétition est inévitable ! Qui a fait de théâtre peut comprendre ça ; l’acteur devient ce qu’il répète au fil des mois de répétitions ! D’où la recette magique de la phrase affirmative positive lorsqu’on la répète trois fois de suite. Aussi souvent que possible.
Soit mentalement bien sûr, soit à voix haute, ou chantez là cette phrase affirmative positive. Comme les Gokkaïs. Vous pouvez l’écrire sur un papier avec les symboles Reiki et programmer un cristal de quartz, puis la déposer dans votre boîte des cristaux Reiki. Ces effets en seront amplifiés.

En ce qui nous concerne

… nous avons l’habitude depuis quelques années de recevoir, nous n’en doutons pas, de la part de personnes avisées, ce genre de prière où de phrase « les habitants de France vivent en paix, pour le grand bien de tous et en harmonie avec l’univers, merci ». Ce genre de phrase est parfait et je l’encourage sincèrement. Plus nous serons nombreux à utiliser ce genre d’intention, plus nous aurons de chances un jour de voir s’installer la paix ou quelque chose qui y ressemblera déjà un petit peu plus qu’aujourd’hui. Quoi que nous pouvons constater d’énormes progrès depuis une dizaine d’années mais…

Sous l’emprise de la frustration…
Ne nous leurrons pas, on sait que ça ne marche pas très vite ce genre de demande. Pour preuve ; la France est de plus en plus sous l’emprise de la frustration et de la rage–colère.

De par mon expérience de thérapeute psycho-émotionnel ‘libération par la parole’, on gagnerait à ce que la phrase soit orientée dans le sens : guérir la frustration. Ce qui aurait pour effet : guérir la rage et la colère. Et graduellement je précise : guérir la cause de la frustration.
Tout comme l’énergie du Reiki qui va à la cause de la problématique, dans la pratique du Raja yoga de l’esprit, nous faisons un travail de nettoyage en profondeur sur le chakra de la gorge, le langage et l’écoute, la parole. Pour cheminer vers la paix. Je fais donc le lien avec la pratique du Reiki et du Raja yoga de l’esprit, en proposant un mantra prière pour guérir le cœur. Le chakra de la gorge est l’expression du chakra du cœur ! Ne dit-on pas ‘dis ce que tu as sur le cœur’ ‘écoutes ton cœur’ ‘vas où ton cœur te mène’…’ tu dis ça parce que tu en as gros sur la patate’…

Ébauche de la phrase que je propose…

« Avec Amour, ‘les habitants de France ont (ou bien ; nous avons…) maintenant les mots justes que les autorités dirigeantes ont besoin d’entendre pour bien comprendre, et obtiennent (obtenons ) ainsi les changements nécessaires équitables pour tous. En accord avec les lois de l’Univers, merci ».

Paix-amour-joiePaix-amour-joie… À cet égard, vous pourriez aussi utiliser ce mantra-prière-phrase-affirmative-positive-active pour vous même vis-à-vis de votre entourage : « Avec Amour, j’ai maintenant les mots justes que X……… a besoin d’entendre pour bien comprendre, et notre communication (ou ma communication) est de plus en plus équitable (bénéfique dans les deux sens – à la place du seul bénéfice pour soi sans tenir compte des ressentis et des besoins de l’autre)… en accord avec les lois de l’univers, merci » (car il est nécessaire bien entendu d’apprendre les leçons de l’univers que chacun a besoin d’apprendre pour communiquer ce que l’on a sur le cœur, chose difficile à réaliser mais pas impossible).

« Avec Amour, j’ai (j’exprime) maintenant les mots justes que X……… a besoin d’entendre pour bien comprendre, et notre communication est de plus en plus équitable, en accord avec les lois de l’univers, merci »

 Comment votre pratique du Reiki Karuna se passe-t-elle… ?

Nous avons pour habitude, lorsque nous donnons des soins sur place ou à distance, de nous connecter avec les maîtres attentionnés tels que Sai Baba, Maître Saint-Germain et bien sûr les archanges Michael et Gabriel. Ce processus fait naturellement partie de l’enseignement sérieux du Reiki Karuna niveau 1 et niveau 2. Les initiations au troisième degré Reiki Usui quant à elles, agissent sur la conscience, et celles du quatrième degré Reiki agissent sur la spiritualité. À vrai dire en une ouverture de conscience et une connexion par le sixième et le septième chakra à une meilleure intuition. Donc une meilleure guidance – on entend ici le mot guide. Ce qui fait qu’avec l’habitude de la pratique du Reiki Karuna (après être initié aux troisième et quatrième degré Usui), l’augmentation médiumnique peut nous permettre de recevoir, ou au moins de le comprendre, de l’intégrer, le même genre de message que celui que nous donnent depuis longtemps Gandhi, Dalaï-lama, Amma, et bien d’autres encore comme Luther King, Steiner, Montessori, Usui, Tesla… et que ce message n’est un secret pour personne ; « vous ne pourrez jamais arrêter les guerres dans le monde, ni la violence et la corruption dans votre pays tant que vous n’aurez pas guéri les conflits dans votre dualité intérieure, chacun d’entre vous ». Les maîtres s’accordent tous à dire que c’est ainsi que nous changerons le monde. Et non pas l’inverse ; changer un gouvernement et tous les maires et adjoints des maires pour être en paix ! Ça c’est de l’illusion pure et dure. (Mais on peut essayer de le faire quand même… lol)

Omraam Mikael Aïvanhov

Faire ce travail sur soi est difficile, est long, très long, toute la vie. Et même au-delà le travail continuera, n’en doutez pas. Lisez ou relisez Omraam Mikael Aïvanhov ..lien…

A propos de longueur de temps pour prendre soin de soi, j’en profite au passage pour passer un message un peu personnel, puisque c’est le moment des vœux autant profiter.

soirées-partage-dojo-reikisoirées-partage-dojo-reiki… Lors de soirées partage, d’échange sur les stands Planète Reiki des salons bio, quelques amis de Planète Reiki m’ont dit gentiment que des personnes de leur entourage – que j’ai initiées au Reiki – ne revenaient pas me voir parce que justement elle n’avaient pas pratiqué suffisamment (leur impression ! ) l’enseignement appris lors des stages et des ateliers… ça me touche à chaque fois. Je suis un être sensible, et je le resterai toute ma vie. Je comprends très bien ces personnes qui hésitent à revenir au dojo pour des soirées ou pour des ateliers, très sincèrement. Quoiqu’il en soit, ne vous inquiétez pas car je sais très bien faire la différence entre : une technique de changement Reiki enseignée en stage qui permet de la comprendre et d’en entrevoir les effets positifs d’une part. Et d’autre part : de se retrouver seule à la maison avec les activités, le conjoint, la conjointe, les enfants, le ménage, les distractions, la rêverie, la musique les vidéos les repas les courses les amis… et surtout la difficulté de s’y mettre. Et de s’y tenir !

Merci les ancêtres

Toute réflexion faite restons avisés. Tout de même, ce n’est pas dans notre culture – merci les ancêtres ! – de travailler sur soi et de se remettre en question. C’est à notre génération de s’atteler à ce travail de changement de conscience, de changement d’habitudes. Je vous en prie ne vous inquiétez donc pas ! Mais tout bien pesé, en accord avec le cinquième Gokaïs Shin set souni, revenez nous voir car vous savez le bien fou que ça fait un atelier ou une soirée partage ! ! ! Un bain de bols tibétains et de gongs au dojo, une soupe et un verre de rouge, des rires et du chocolat ! Des sourires et des câlins gratuits… et chacun à son tour, quand le temps est venu, quand tout est aligné, le travail intérieur se fait ou se fera… Shin Pai Suna… ça sera un grand plaisir de vous revoir en 2019 !

Ensemble changeons notre monde

Alors apprenez cette phrase par cœur et répétons la nom de stop, tous les jours, tous les mois, tous les ans… toute la vie… ensemble changeons notre monde intérieur à chacun. Et apprenez-la à vos enfants, qu’ils commencent dès maintenant à positiver.

Le travail de l’affirmation de soi est une longue tâche de défrichage, de débroussaillage des limites mises en place depuis des années pour paraître quelqu’un de bien. Ce n’est rien d’autre que du contrôle, une rigidité pour se conformer à l’éducation reçue. L’enfant intérieur blessé, frustré, triste, en colère contenue…déçu, trahi, abandonné….
Alors on comprend que le rigide soit beaucoup plus laborieux à transformer que l’ego ne voudrait nous le faire croire. Mais un jour tout est prêt et les fortifications de protections (pas toutes à la fois) s’écroulent et c’est une véritable renaissance. Délivrance je dirais plutôt.
C’est exactement la même chose lorsque l’éducation est trop molle, trop libre… dans le miroir c’est la même chose.

Guérir l’enfant intérieur

L’enfant n’attend pas qu’on lui dise ce qu’il a à faire ou à ne pas faire, il attend ;

Qu’on lui explique la voie du milieu, soit ;

L’équilibre entre la pensée et l’action.
L’équilibre entre la parole et l’acte.
L’équilibre entre la femme et l’homme.
L’équilibre entre l’adulte non dominant  et l’enfant.



guérir-l’enfant-intérieur… Que ta parole soit juste… là est la question. Pour que la parole soit juste il est nécessaire que les pensées soient juste. Entre autres, la pensée affirmative positive réoriente les pensées. À ce sujet je vous conseille de vous procurer le petit livre merveilleux de Louise Hay ; d’accord avec mon corps.

‘Je pense, donc je suis’.

Amitié Reiki




Instant T

L’instant T rend hommage à l’inconnu.

Et soudain, le monde est bizarre.
Le vrai réveille, devient grave et nous réjoui.
Alors que la vérité tue.

Gasshô & Gokkaïs

L'instant T rend hommage à l'inconnu

cheminer avec le coeur

   Du côté yang, il y a la théorie, la technique, les recettes, la doctrine, le paraitre et le « comme il faut », le controle… cela concerne le mental, et les méta-commentaires de L’ego…Le haut astral…(dans le corps astral se stockent les pensées récurrentes)

Du coté Yin, il y a les besoins instinctuels, besoins de soutien affectif,  combler le manque de soutien affectif dans le quotidien. Il y a aussi le besoin de se protéger des personnes de son entourage, de sa famille, que l’on peut ressentir comme nuisibles, négatifs, ou encombrants, ou antipathiques et souvent qui pompent tout etc. etc. Ce sont les besoins périphériques immédiats. Le bas astral….

Et entre les besoins du bas et les exigences du haut, le centre spirituel du cœur ; les désirs du cœur. Eux, sont voilés et embrouillés par les besoins instinctuels, les besoins viscéraux, et par la mondialisation cérébrale de la logique ; se méfier des autres, ne pas aimer.

La méditation Gasshô, associée avec les cinq Gokkaïs – méditation avec les 5 principes de Mikao Usui, suivre ce lien pour les méditations guidées – , 3 minutes matin et soir, permet petit à petit mais très rapidement (sic…) d’etre centré dans le cœur et d’apprendre à aimer ce qui est difficile à aimer. L’instant T rend hommage à l’inconnu. D’apprendre à comprendre ce qui est difficile à comprendre. D’accueillir et d’accepter ce qui est difficile à accueillir et à accepter.

Aimer est difficile tant qu’on vis dans le mental et dans les besoins.

Aimer devient facile et agréable lorsqu’on vis les désirs depuis le cœur.

Amitiés Reiki. Do.

Oh doux Maître, plus je suis tes enseignements et plus tu agaces mes neurones…. Moi qui croyais avoir compris un peu de la vie (orgueilleuse mais gentille… lol), tu m’emmènes toujours plus loin dans les tréfonds de mon ignorance…! et c’est très bien ainsi ! et si je dois passer du temps en ta compagnie lumineuse pour m’éclairer alors je suis toute consolée J ! Est-ce qu’avant la soirée Reiki de vendredi 25 te conviendrait ?
Bisous !


Questions Réponses au service d’autrui

J’aurais besoin que tu me guides car courant de la semaine prochaine je vais pour la 1ere fois me servir du Reiki pour des soucis émotionnels. Pour un monsieur que le reikïse.
Le monsieur à des soucis, du coup je voudrais savoir si pour l’émotionnel on fait systématiquement un traitement mental ou si un soin complet suffit ? comment puis je savoir lequel choisir ?

Dans le cas d’un traitement mental à autrui est ce que je dois voir la personne plusieurs jours de suite et lui faire lire à chaque fois la phrase que nous aurons écrite ensemble ?

Dans l’idéal le traitement mental c’est minimum  4 jours de suite. Si vraiment ça n’est pas possible, tu fais une séance en restant en soin traitement mental – avec SHK  en mantra non-stop 6 minutes, et la phrase idem – puis une main sur sa nuque et l’autre sur son nombril minimum 10 minutes – avec le mantra SHK le plus longtemps possible, en mode paisible (pour toi ). Puis, à la place des quatre jours minimums  ; tu fais un envoies à distance avec la phrase affirmative que vous aurez composé ensemble, pendant 21 jours, tu recharges le quartz 15 minutes tous les quatre jours.

Est ce que c’est moi qui prépare le papier avec la « prière/demande Reiki » ?

Pour préparer le papier : oui c’est toi qui poses les questions : reprends les notes cours et le Polycops que j’ai donné pendant le stage 2ème degré (c’est répété aussi dans le livret du stage)….Une fois que tu as définie qu’est-ce qu’il ne veut plus / qu’est-ce qu’il veut à place, vous définissez une phrase ensemble. PUIS : tu l’écris sur le papier avec les quatre symboles autour pour charger le cristal de quartz.
— Tu lui donne la phrase à lire pendant que tu lui fais la séance ( citée plus haut). Et tu lui dis après la séance ; chaque jour de répéter trois fois de suite la phrase en la pensant bien fort dans son cœur et dans son esprit.
Puis tu fais l’envoie a à distance.

 Est ce que le cristal que je vais programmé je le confit à la personne ou est ce que je le garde chez moi ?

Non jamais de la vie ! Tu gardes le cristal chez toi après l’avoir chargé pendant 15 minutes avec la phrase et l’envoi à distance (visualisation créatrice) et tu vas le recharger tous les quatre jours 15 minutes de la même façon.
Mais si tu veux, tu peux lui donner un autre quartz, un deuxième : tu le charges avec la phrase et les symboles sans papiers et tu lui donnes, qu’il le place sous son oreiller. Le quartz et le Reiki agiront pendant son sommeil.
Et si tu en as l’occasion, si c’est possible, tu revois le monsieur, lui refais une séance, tu recharges son quartz et il repart dormir avec le quartz guérisseur sous son oreiller.

Comment je fais pour savoir si 4 jours de programmation pour le cristal suffit ou si il faut recommencer ? 

Pour répondre à cette question : Le quatrième ou le cinquième jour tu l’appelles au téléphone, ou tu vas le voir et lui demandes comment il va. Et en fonction de sa réponse tu sauras si tu dois continuer ou arrêter, ou refaire une séance avec une autre phrase…

Enfin dernière question, est ce que le papier qui sera mis avec le cristal je dois le brûler ou est ce que je peux le garder dans le cas ou il faudrait reprogrammer le cristal encore une fois ?

Si la guérison à lieu et qu’il n’y a pas besoin de continuer, tu brûles le papier, ça va amplifier. Si tu dois continuer le soin, ne brûles pas le papier.  Garde le papier (ou une copie comme modèle).

Désolée pour toute ces questions mais pour ma 1ere fois je voudrais ne pas me tromper et vraiment faire les choses le plus correctement possible afin d’avoir un vrai résultat bénéfique pour ce monsieur.

Tu as Parfaitement bien agi en me posant toutes ces questions ! Personnellement je préfère ça qu’à l’inverse tu aurais pu faire le soin dans le stress dans le doute ou ne pas le faire du tout…et comme je vous l’ai répété plusieurs fois en stage ; le Reiki c’est gratuit, vous payez pour apprendre à vous en servir. Ensuite, le suivi c’est gracieusement après les stages. Ça s’appelle l’éthique du Maitre enseignant Reiki.
Et ça fait parti intégrale de mon engagement altruiste au service du Reiki et des personnes qui sont en démarche volontaire de changement, pour soi, et pour aider les autres. Je suis convaincu que telle est ma mission aujourd’hui.
Bon soin et tiens moi au courant !

Merci beaucoup Dom. Ça me rassure sur ce que j’ai compris. 
Pour ce qui est de mon propre traitement mental c’est super je l’ai fait 8 jours d’affilé et je me sens très bien.
J’ai commencé la prière pour l’amour de soi qui est dans ton livret du 1er degré, je vais la réciter durant 21 jours avant de me coucher. Je sens des changements positifs. Bon dimanche. biz


Atelier du pardon

Je te remercie pour tes envois des méditations guidées de l’atelier du Pardon de vendredi. C’est un grand pas pour moi d’avoir osé parler de cet événement douloureux pour moi que je ressasse en silence depuis dix ans maintenant. J’appréhendais de devoir en parler en public alors que seuls mes enfants ont été mis dans la confidence. Cependant, tu m’y a emmenée avec beaucoup de pudeur et je t’en remercie. J’ai enfin à ma disposition un outil simple et efficace pour gommer des souvenirs douloureux.

Tu retrouves ta vraie nature.

« L’humain est fou.
Il adore un Dieu invisible et détruit une nature visible, inconscient que la Nature qu’il détruit est le Dieu qu’il vénère. »

                                                    Hubert Reeves


Archives Lettres reiki

J’ai beaucoup de questions, est ce que tu peux m’envoyer les anciennes lettre de Reiki ? Merci Dom

Tu vas ds ls archives de mon site , comme ça tu liras les lettre de Reiki, que t’as pas lues ! 

ici : 24 articles :https://www.planete-reiki.fr/articles/

là : 15 articles : https://www.planete-reiki.fr/news/ 

et ici<là ! : 21 news d’échanges soins et autres questions réponses : https://www.planete-reiki.fr/soigner-le-corps-avec-le-reiki/ 


La douleur au genou.

 Je souhaitais savoir si c’est normal de ressentir une fraîcheur au lieu de la chaleur lorsque je pratique le soin. J’ai également demandé à ma mère de me le faire et c’est exactement pareil. Je ressens du froid sur la même partie du genou. Et la douleur est toujours présente. Je souhaitais savoir si cela était normal?

 Bonjour…concernant « le corps et le Reiki », tout est toujours normal. Mikao Usui nous a donné le message suivant ; cultivez vous. Élargir l’esprit pour comprendre que tout est symbole, tout est symbolique. Donc symboliquement la fraîcheur représente : quelque chose qui a besoin d’être rafraîchit. Il convient de se poser la question concernant la douleur : « qu’est-ce que je ressens ? Est-ce que c’est de la chaleur, est-ce que ça brûle ? Est-ce que je sens que c’est tendu ? ».  

Pouvez-vous répondre à ces questions, et m’expliquer exactement ce que vous ressentez comme douleur ! ? Quel est votre degré en Reiki ? Et quel est le degré de votre mère ? Lorsque vous faites un soin aux genoux, vous le faites pendant combien de temps ? Et enfin ; de quel genou s’agit-il le droit ou le gauche ? Et à quel endroit exactement avez-vous mal ? Au milieu à droite à gauche à l’intérieur derrière ?
Désolé de vous ennuyer avec tout ça, mais une consultation c’est une consultation ; il faut tout examiner pour savoir quoi faire ! Avec vos précisions, je vous dirai exactement ce qu’il en est ce qu’il convient de faire.

 Au repos, je n’ai pas de douleur. Elle vient lorsque je plie mon genou ( escalier, s’habiller, se chausser)…Degré reiki : 1 pour toutes les 2. Soin : 3 fois 10 min. Genou droit principalement ; le côté gauche avec une petite inflammation et le milieu. jour…

C’est bien le rôle du genou ; de plier. Plier, symboliquement c’est représentatif de flexibilité. L’inverse c’est la rigidité. Il s’agit du genou droit ; c’est donc le genou de l’esprit – la raison, la rationalité. Comme il y a un problème il y a trop d’intelligence, trop de réflexion : donc une rigidité au niveau de l’esprit dans une certaine situation. Cette situation peut-être, par exemple Inconsciemment un refus de plier… peut-être face à quelqu’un… face à une situation… ça peut être aussi un refus de plier face à une peur. Je m’explique ; si je veux faire quelque chose mais que j’ai peur mais et que je ne me l’avoue pas, que je ne le reconnais pas, ou que je renie cette peur, je ne ferai pas cette chose que je veux faire et je n’avouerai pas que j’ai peur. Soit peur des résultats, soit peur des conséquences, soit peur de ne pas être à la hauteur, soit peur de ne pas y arriver, Ou peur d’être jugé ou rejeté… etc. Une douleur est là pour nous permettre de nous poser et, tout en faisant du Reiki de passer au scanner toutes les situations qui sont en rapport avec l’endroit du corps Ou se trouve la douleur.  

Genou droit. Principalement le côté gaucheDonc c’est le genou droit ; le genou de l’esprit, la réflexion et peut-être le vouloir avoir raison. C’est  peut-être là l’occasion d’inviter l’humilité.
Et comme c’est le côté gauche c’est le côté intérieur du genou ; c’est représentatif de l’intérieur de soi : quelque chose d’intime. Peut-être un refus de plier pour ne pas montrer une fragilité, ou un sentiment différent de celui des autres ou de quelqu’un d’autre… ou peut-être un refus de plier pour avoir  l’humilité de reconnaître ou d’avouer ou de dire une peur face à une situation où face à quelqu’un… ou peut-être un refus de plier pour avoir  l’humilité de reconnaître ou d’avouer ou de dire à l’autre qu’il a raison… 

Avec une petite inflammation.  Une Inflammation contient le mot flamme, donc feu.
Dans la douleur tout ce qui est feu, brûlure, donc inflammation, est représentatif d’une colère, voire d’une rage…Quelque chose qui fait bouillir…
Et bien voilà, c’est peut-être le moment de réfléchir à une situation qui vous fait vivre un peu de rigidité et un peu de colère soit envers vous-même soit envers quelqu’un d’autre ou un groupe ou une situation. Ou une peur. 

Ça peut être la peur d’être humble. 

Le système éducationnel veut qu’on soit toujours fort, jeune beau viril en pleine forme, et en pleine possession de notre esprit et de notre raison… a vouloir mettre tout le monde dans le même moule Le système empêche tout le monde d’être particulier, singulier, la normalisation efface les différences, efface les fragilités les sensibilités. Étouffe le cœur. D’où la difficulté à être humble et à accepter de perdre. Parfois c’est une vraie source de bonheur que de savoir le faire. Surtout avec l’aide du Reiki qui a toujours raison ! Voilà ce que l’on appelle le mal au service du bien. Car vous allez trouver et vous avez rectifier Une certaine façon de penser et vous en sortirez différent et grandit, grâce à votre corps et grâce au Reiki.  

Degré reiki : 1 pour toutes les 2. Soin : 3 fois 10 min. Lorsque vous dites 3 × 10 minutes, cela veut dire 3 × 10 minutes par jour ?
Pour suivre l’enseignement de guérison de Mikao Usui, il vaut mieux commencer le soin par 10 minutes au niveau de la tête. Choisissez les positions intuitivement. Ou par exemple 2 positions sur la tête et une position au niveau de la gorge. Ensuite vous vous occupez du corps ; 15 minutes sur le genou. Faites cela tous les jours au moins une fois ou plusieurs fois si vous voulez, jusqu’à ce que ça soit suffisant. Mais il peut etre bon aussi de consulter un médecin ou un ostéopathe ou un chiropracteur, ne serait-ce que pour avoir un diagnostic et le nom précis du symptome. Avec le deuxième degré de Reiki je vous aurais indiqué comment faire un soin avec un cristal de quartz.


2ème degré Reiki 

Concernant le Reiki du niveau 2, est-il possible de le faire en 2 x 2 week-end et une soirée? 

Si je comprends bien vous voulez parler du stage que j’anime pendant quatre jours, et s’il est possible de le diviser en deux. Malheureusement il m’est impossible de procéder ainsi. Le but du stage en quatre jours plus une soirée c’est l’immersion durant quatre jours et demi de pratiques  Reiki. C’est totalement différent que le Reiki enseigné en deux jours habituellement. Qui est très bien bien sûr, mais qui manque de manière trés sens de pratiques, évidemment. Si vous voulez vraiment faire le Reiki Deuxième degré en quatre jours, avoir une bonne immersion de mises en pratiques et de ressentis, Car il y a des méditations guidées pendant ses stages quatre en jours qu’il n’y a pas pendant le stage de deux jours… que vous voulez cette bonne qualité de Reiki ; dites-le au Reiki ! Dites-le à l’essence du Reiki, affirmez lui que c’est ça que vous voulez faire et laissez-le se charger de régler les détails.
Un des aspects merveilleux du Reiki c’est son intelligence infinie.

Le rapport à l’argent dans la nouvelle conscience

Le rapport à l’argent dans la nouvelle conscience et la loi d’attraction

Le rapport à l’argent dans la nouvelle conscience et la loi d’attraction   Les mystérieux effets d’attraction des pierres. Avez-vous essayé l’attraction de l’abondance avec les pierres ?

Le samedi 13 octobre je vais animer un atelier sur une extrème et nationale sensibilité ; Le rapport à l’argent. Pourquoi ? Parce que ça n’est pas facile pour tout le monde de gérer le stress du rapport au budget tout au long de la vie. Qu’il soit petit ou qu’il soit énorme. Ou moyen, ça ne fait pas de différence. Chacun a des comportements internes et externes conscients ou inconscients qui génèrent des attitudes pas toujours franches avec Le rapport à l’argent et la manière de l’utiliser dans la vie au quotidien.

D’ailleurs sur ce sujet, dans le système éducationnel scolaire et parental, à mon souvenir et à ma connaissance, la seule chose que l’on nous a appris c’est compter. Additionner soustraire diviser multiplier gagner mettre de côté en avoir devant soi économiser ne pas gaspiller interdit de prêter emprunter flipper…. À l’école je n’ai jamais eu vent qu’il y avait des cours pour apprendre à accepter de perdre. Encore moins entendu parler de cours pour apprendre à donner sans compter. Ni apprendre à recevoir sans se sentir obligé de redonner.

Dans les écoles on n’apprend rien sur Le rapport à l’argent, par contre on a pu apprendre à ouvrir un rat, un insecte, un poisson, également un peu plus loin dans les écoles pour grands, à ouvrir des corps humains, des crânes, des organes… dans le but de voir et instruire comment fonctionnent ces éléments de matières. Bien entendu ceci c’est essayer de comprendre la matière sans se préoccuper de l’esprit. Aujourd’hui chacun le sait, quand l’esprit dort ou s’en va, la matière ne peut plus faire rien d’autre que de dormir ou se décomposer.

Aucun chercheur, aucun chirurgien n’a aperçu de pensées en ouvrant un crâne, ni aperçu le moindre sentiment ou la moindre vibration d’une émotion en ouvrant un cœur humain. Et pourtant…

                … vous me direz, quel rapport avec Le rapport à l’argent ?

Là-dessus je réponds ; les deux sont composés de mèmes matières ; molécules cellules atomes électrons quartz eau… c’est la même composition pour un billet, pour une pièce que pour un corps. Et tout comme la matière du corps humain, l’argent ne peut pas fonctionner sans l’esprit.

                … À méditer n’est-ce pas…

Le rapport à l’argent dans la nouvelle conscience et la loi d’attraction   Cependant, lorsque vous dormez, lorsque dorment les marchands et les banquiers – c’est les mêmes – que fait votre argent dans votre porte-monnaie, votre portefeuille ? Quand vous dormez comment vivez vous Le rapport à l’argent ?!! 
Étonnante question, et la réponse est dans la question.

Cela faisait plusieurs années que parfois en fin des cours des stages des ateliers ou des soirées partage Reiki, des stagiaires me demandaient quand est-ce que je ferais…, ou plutôt « est-ce que tu ne ferais pas un atelier sur l’argent ! ? ! ». J’entendais cela se répéter. Et puis un jour, j’étais prêt. J’ai relevé le défi. J’ai fixé une date sur le calendrier : « atelier sur le rapport à l’argent dans la nouvelle conscience ».
Je n’avais absolument aucune idée comment j’allais aborder ce sujet pour animer un atelier d’une journée avec des gens qui justement me donnaient de l’argent pour les aider. Sacré défi. Mais j’aime ça. Et à partir du troisième degré Reiki nous sommes en communication avec un guide spirituel très élevé, il savait que je comptais sur lui. Ou Elle. Et dans les trois ou quatre mois qui ont suivi j’ai reçu des messages, en une belle synchronicité de coïncidences, en rêves, des petits passages lors de lecture de livres spiritualistes ou de romans distractifs, des choses entendues à droite à gauche. Un compost. Cela doit faire maintenant la troisième année que j’anime cet atelier plusieurs fois par an. Progression donc.

                La particularité de cet atelier c’est que je vais mixer, tresser et les idées de la physique quantique et des connaissances médiumniques de la nouvelle conscience, avec mes connaissances issues des hauts niveaux de Reiki, y insuffler des données que j’extrais de « l’Angéologie traditionnelle de la kabbale » formation que je suis depuis cinq ou six ans… et le plus fort de tout ça, et qui m’étonnera toujours, c’est l’ouverture du canal avec le symbole de distance Reiki et la réceptivité de ma part féminine – Karuna ® –  ce canal merveilleux et surprenant qui ouvre à la connaissance intuitive. Ça ne s’achète pas, ça se cultive initiations après initiations. Une sorte de chamanisme français contemporain.

Je mentirais si je ne disais pas que ces connaissances m’ont apporté depuis plus de 15 ans une vraie compréhension de ce qu’est l’argent, l’action de la pensée sur l’argent, l’action de la pensée et de l’argent sur mon environnement personnel au quotidien. De ces formations que j’ai faites m’ont aussi vers un angle de vue magistralement impressionnant empreint de tristesse sur le symbolisme du fonctionnement du monde politique et financier, les deux enchaînés à cette chose qu’ils n’ont pas comprise, non pas l’argent ! Mais le rapport à l’argent ailleurs que dans la matière tangible.

Politiciens boursiers financiers banquiers, ce n’est pas qu’ils soient privés de conscience, mais ils font de gros efforts pour y arriver.

Dom JeambrunLe rapport à l’argent dans la nouvelle conscience et la loi d’attraction

La lettre reiki de Mai annonces locales des saisons de l’Ame.

La lettre reiki de Mai reflet de notre météo intérieure

La lettre reiki de Mai reflet de notre météo intérieure


  Le Reiki m’a appelé il y a 20 ans. J’ai eu accès à la guérison grace à au moins 12 personnes. Pour commencer. Et pour suivre, afin de poursuivre la guérison des mémoires une fois guéri mon corps, ça c’est fait grace à au moins….une infinité de personnes. J’appelle cette chaine humaine ; le Partage. En majuscule.
Les employés de l’état appellent ça ‘piratage. Entre barreaux.

Piratage quand ça dérange, partage quand ça arrange.

Alors je partage La lettre Reiki de Mai ce que g partagé avec vous qui m’avaient demandé. Conseils et initiations. Je partage ces pourquoi vous m’avez fait confiance.
Partageons nos mots, soignons nos maux.

Notre météo intérieure

Des explications en partage des échanges du maitre reiki avec ses élèves après les stages. Pour les aider et aider l’humanité à trouver des alternatives à la souffrance.
Questions réponses….partage des mots pour aider les maux…..



Le 3 décembre 2017 à 18:46, v…… <contact@planete-reiki.fr> a écrit :

De : Sujet : reiki à distance/Corps du message :
Bonjour Dom,
 c  est v…., Je voulais te faire un retour sur l initiation reiki komyo du 23 24 et 25 novembre. quand je suis sortie du 1 er , j étais enchantée, j ai trouvé ça merveilleux. le deuxième degré était pour moi plus confu, je ne sais pas si j étais moins réceptive, j étais un peu déconcertée. je pensais que je n y arriverais pas , j ai eu  beaucoup d interrogation sur la pratique . J ai  bien relu mes notes et je me suis documentée sur internet pour me rassurer, et je me suis lancée , car mon petit fils fait ses dents, et il a très mal , se réveille la nuit, donc il fallait me lancer pour le soulager, je n avais pas fait ça pour pas en faire profiter donc j ai fait un soin à distance, un peu comme je le ressentais et avec tes informations , un peu maladroite,avec un petit papier, les symboles pas forcément bien maîtrisés,j ai un peu tâtonné, mais je me suis dit qu au pire, si je ne le faisais pas bien, ça ne ferait rien….ça a valu le coup, car ma fille m a dit que depuis le petit dormait bien, et qu il soufrait bien moins. j ai aussi envoyé du rekin sur l entretien d embauche de mon gendre, il, était enchanté, ça c est bien passé, il a un entretien final la semaine prochaine, donc je continue, de quoi m encourager.
je voulais te demander si je pouvais enchaîner plusieurs soins à distance, ou si il fallait à chaque fois faire le kenyoku après chaque soin. moi je les enchaîne mais je ne sais pas si c est ce qu il faut faire. et je ne sais pas combien de temps je dois envoyer le reiki sur mon papier que je tiens dans ma main.
j étais tellement désemparée que je me suis dit qu il fallait que je refasse mon 2 eme degré pour tout intégrer. je pense qu avec l habitude ça ira mieux.
je te remercie pour tout je te contacterai car j aimerai que tu me fasses un soin, on en reparlera
à bientôt

D – comme tu le sens – si tu sens que tu dois le faire  fais le ….si tu sens l’inverse fais le. Trouve tes marques. 
– combien de temps je dois envoyer du Reiki sur mon papier que je tiens dans ma main ?
D – jusqu’à ce que tu sentes que ça suffit.
Ecouter ses sens, son corps, son cœur, son enfant intérieur, questionner le Reiki, le symbole….lacher prise et sourire.



Le 6 mai 2018 à 17:05, C… <c….@gmail.com> a écrit :

bonjour Dom….j’aurais besoin d un conseil , mon mari a un ulcère variqeux à sa jambe gauche et avec la fatigue il devient de plus en plus gros , j’ai beau lui faire un soin reiki au niveau de son ulcère mais rien ne se passe et pourtant quand j ai la main sur son ulcère je ressens une tension sur la paume de mes mains.Peux tu me conseiller s il te plait.Merci

D –  je te réponds et partage dans la lettre reiki ; les varices sont la résultante d’émotions que l’on a souvent traînées longtemps et qui ont gonflé les veines.

Elles traduisent de la colère, ou de la rage « est-ce que je dois toujours me plier aux exigences des autres ? » 

Le sang représente la circulation de la vie, l’énergie de la vie.

Les jambes représentent l’action pour aller de l’avant dans la vie.

Les varices représentent donc un endroit où la circulation de la vie est ralentie !!!

La jambe droite ; le mental la raison la logique le contrôle.

la jambe gauche ; la réceptivité l’intuition l’affectif.

La jambe gauche : ulcère varice côté jambe gauche : représente donc une difficulté à avancer sans râler sans se plaindre sans rage contenue ni Retenue – d’où le 1er Gokkaï.

Solution : Avancer ; En exprimant les émotions non exprimées sur le plan affectif relationnel avec quelqu’un de proche dont on a le sentiment que cette personne a des exigences envers Soi..

Il convient donc de faire un soin Reiki en mettant la priorité sur : d’abord soigner l’esprit et le cœur.

Et ensuite s’occuper du corps : C’est bien là le message de Mikao Usui… et de tous les vrais grands médecins du monde.

Je procéderai comme suit : tous les jours jusqu’à guérison :

Prise cosmique 15 minutes après un bon scanner.

Ensuite 15 minutes toute la tête et la gorge.

Cinq minutes le front et le chakra du cœur (au centre de la poitrine entre les seins).

puis : Position de l’étoile ; trois minutes par position. (voir Manuel Reiki 1er degré –manuel planète reiki).

Cinq minutes sur les reins.

Cinq minutes une main sur la hanche et l’autre sur ou sous le pied (de la même jambe), puis cinq minutes de l’autre côté (l’autre jambe) …et terminer par l’ulcère variqueux.

Pendant le soin ça serait bien de mettre une bonne grosse tourmaline noire ou obsidienne noire entre les pieds ( posée sur la table de soins.) + Un bout de cristal de quartz posé sur le chakra du cœur, et une pointe d’Apophyllite posée sur la gorge. Et au niveau de l’entrejambe, pour être proche du coccyx, du chakra racines, un grenat = mais pas plus de 10 minutes – en tout ! – lors de chaque soin. 

Et pendant le soin, chaque jour, tu peux combiner avec les huiles essentielles ; cyprès menthe et romarin… 

  • 3 fois 5 gouttes d’huile essentielle de cyprès, menthe et romarin, sur une compresse humide, bien froide
    (vous pouvez mettre, par exemple, un linge humide pendant 10 minutes au réfrigérateur).
    La lettre reiki de Mai reflet de notre météo intérieureAvec ce linge froid imbibé de 5 gouttes d’huile essentielle, faites un petit massage Komyo sur les jambes, pour favoriser la circulation du sang.
    Réalisez-le sur chaque jambe, pendant au moins 10 minutes, puis attendez que l’huile sèche. …avant de prendre une douche relaxante.
  • L’huile de menthe et l’huile de romarin sont d’excellents relaxants musculaires, qui permettent également de stimuler la circulation sanguine.
  • la lettre reiki, on partage les recettes !

Voilà, tu me diras lorsque ce sera terminé ! ? Amicalement


3ème degré Reiki Usui
Cher Dom,        Je tiens à t’exprimer ma reconnaissance et ma joie d’avoir accompli encore une étape importante sur la voie de la Vie Reiki sous ta Guidance bienveillante, confiante et attentive. L’intégration pendant cette première semaine du symbole DKM a opéré des transformations profondes dans ma vie intérieure, mon esprit et ma façon de vivre à chaque instant. Il y a encore bien du chemin à parcourir et du travail à faire mais je me sens rempli de force et de sérénité. Le temps quotidien consacré au rechargement de la grille, est un moment privilégié d’extrême concentration dans ces gestes qui renforcent la puissance des symboles, la profondeur de la méditation et l’ouverture au monde et aux autres… Je vis intensément ces instants qui ont beaucoup de sens pour moi et me relie à l’ensemble de la communauté Reiki. Merci pour ce beau stage, plein de découvertes et de surprises, c’est une nourriture pour les mois à venir et au-delà… J’ai également pris de l’assurance pour proposer des soins Reiki à autrui, ce que je n’osais pas trop faire jusqu’à présent. Est-ce un effet du symbole DKM ? En tout cas, je me sens investi d’une nouvelle responsabilité qui me fait grandir aussi dans la représentation de ce dont je suis capable. Pour tout cela, je te dis Merci, Merci, Merci et t’adresse quotidiennement des Kansha shite plein de reconnaissance. Je remercie la Vie de m’avoir fait rencontrer un Maître plein d’Amour et de Générosité

                                                                           Avec toute mon amitié et mon affection 



La lettre Reiki de Mai

​​Bonjour Dom, tout d’abord, encore merci pour cette formation qui fût très enrichissante, merci d’être autant disponible pour chaque personne que tu rencontres, le cœur grand ouvert. Je suis ravi que mon chemin m’ai permis de te rencontrer..J’aimerais trouver une table pliante, à bas coût et ailleurs que sur internet, car j’ai déjà quelques demandes cette semaine 🙂 As-tu une idée ? Je pourrais demander à mon guide.. mais tu seras encore plus rapide 😉  
Je porte l’aigue marine avec le diamant herkimer, elles m’apportent beaucoup de bien.

D – G une table que je vends 50€ !!!


La lettre reiki de Mai reflet de notre météo intérieure

Cristal de roche

  Depuis que j’ai rencontré le Reiki et donc toi ! J’ai l’impression que la vie m’accueille avec un parvis de fleur comme celui-ci…


Merci beaucoup. 

Et merci beaucoup à toi et à D…. pour tout ce que vous m’avez appris et aidé à comprendre ce weekend. Je ne savais pas pour quelle raison précise je voulais participer au stage. Mais hier en fin de journée j’ai compris. (bon, ça s’est vu un peu … beaucoup…)

Puis j’ai compris aussi que la voix que j’entends de temps en temps depuis quelques semaines est bien mon « guide » et non pas une âme errante ou autre. J’en étais presque sûre déjà mais il restait un petit doute que je n’ai plus depuis samedi.
Et merci beaucoup à toi et à D….


l’enfant intérieur

C’est toujours extrêmement difficile pour moi de commencer un mail qui t’est adressé … Merci Merci Merci… Kansha shite.. Tu as entendu cela des millions de fois et c’est toujours aussi inapproprié et insignifiant au vu des trésors que tu nous as offerts pendant ces 2 jours avec autant de générosité, d’altruisme, d’Amour, mais sans complaisance ni peur de secouer ou de mettre au jour ce qui fait mal !!!

D – Merci Chère V…, je sais qu’il est un temps ou dire merci ne suffit pas. C comme un vide d’incapacité – tellement difficile à ex-primer tant c’est com-primé.
Je sais aussi, qu’un jour la gratitude devient aussi simple qu’un simple sourire. C’est alors qu’on sait que le cœur est guéri, comblé, par soi. Par le Reiki, l’Univers infini.

Je ne m’en étais pas rendue compte, mais ce niveau de Reiki 3 est d’une force incroyable ! Lundi j’étais vraiment sur Mercure, avec les vibrations de ton Gong planétaire Paiste dans la tête, et j’ai eu une migraine infernale toute la journée, tant ma tête était pleine de je ne sais quoi! 

D – Surement des auto critiques, des pensées contradictoires, la dualité entre ; etre, réussir, ne pas y arriver, croire, ne pas croire….ect

V – Ca va être mon travail de démêler et d’assimiler tout ça!

D – c’est ça ! 

V – Une petite anecdote pour les détracteurs du Reiki  : Lundi matin après ma toilette, j’ai ressenti des brûlures sur le devant de mon corps : Je me regarde dans la glace, et là, stupéfaction …. Au niveau de Hara il y avait  1 zone  ronde, rouge et brulante , et exactement la même au niveau du chakra du cœur…. Kansha shite Dom, Ouvreur de chakras …

D – le piercing Reiki !!!! Je le partage dans la lettre reiki !!!

V – Et un merci immense aussi pour m’avoir recommandé de soigner mon enfant intérieur.

D – C’est primordial !

V – Pour moi l’enfant intérieur était seulement un concept, une idée. Mais du coup, hier j’ai commencé à chercher sur le net… Et j’ai compris pourquoi j’ai toujours cette boule de tristesse au bord du cœur et des lèvres, prête à émerger et à me submerger . Je suis pleine d’Amour et de compassion pour la petite Véronique non désirée, battue, niée, humiliée, et je me sens enfin prête à l’écouter, et à la guérir. Et pour cela HSZSN est un outil fabuleux, n’est-ce-pas ? 

Oui ! absolument. Surtout associé avec CKS

As-tu des références bibliographiques, des auteurs  ou des sites à me conseiller pour avancer dans cette voie ?

D – Oui, lis « Vivre ds la lumière » de Shakti Gawain et chaque matin et soir une page de « La petite voix » d’Eleen Cady

également les 2 livres de Jardin « L’ile des gauchers » et « Les coloriés ( c la suite ) https://www.priceminister.com/mfp/7540/l-ile-des-gauchers-alexandre-jardin

et, tout particulièrement de suivre mes ateliers annexes ; Estime de soi, le pardon, l’argent, et les fabuleux trésors ; Les ateliers sur les chakras 1 vendredi par mois.
Tu y trouveras tout l’engrais nécessaire pour retrouver ton authenticité féminine.

V –  j’ai toutes mes vies pour cela et le Reiki et Toi pour m’y aider !

D – Stand by me


Déprime saisonnière

Le 30 avril 2018 à 17:22, C… <c….@orange.fr> a écrit :

Hello Dom !!
Depuis quelques semaines je me trouve sujette à bcp d’émotions que j’appelle les « sans raisons » : soudain j’ai envie de pleurer de joie ou de tristesse, pour quelqu’un ou pour moi, les choses me semblent plus lourdes que d’habitude, mes colères plus prononcées (mais quand même positives, je « prends ma place »), des sentiments de peurs plus forts etc ; et tout cela fluctue bcp sans que l’extérieur y soit pour quelque chose.
Je passe d’une émotion à l’autre très facilement, un peu comme les enfants. C’est comme si je devenais plus sensible (ça c ok pour moi), mais j’ai aussi l’impression de tomber dans la sensiblerie….
Je ne sais trop quoi en penser, est-ce que mes hormones me travaillent dans cette période de pré-pré-ménopause (rien ne l’annonce pour l’instant)? ou est-ce le travail de guérison longue du passé qui me provoque cela ? (je viens de commencer la période 3 à 7 ans) Est-ce un peu des deux ?? SI tu peux aiguiller ma recherche d’une réponse je dis pas non !!!!

Bise C….

D – Aloha C…ça me semble être un peu comme si tu avais ouvert une porte qui était longtemps restée fermée.

Tout à coup ta sensibilité se met en route et tu n’y étais pas habituée.

Ça pourrait être ça. Ça pourrait être aussi du ‘prophète’ de vouloir trop en faire mentalement. Trop en fr pour vouloir tout changer peut rendre hypersensible. 

Certaines personnes ont besoin d’être plus objectives que d’autres dans leur façon de progresser. Etre moins suggestive, moins ds le controle. Voir dans tout ce que tu as appris en Reiki quelles sont les techniques appropriées à ta situation… et apaiser avec les fleurs essentielles ; les HE appropriées. Demande également maton groupe Reiki deux de t’envoyer du Reiki à distance pour apaiser des débordements émotionnels. C’est peut-être lié à une déprime saisonnière aussi, donc huiles essentielles de Aneth, basilic, patchouli. Je te recommande ces trois il essentielles en massages tous les deux jours (fais toi masser-et renforcer patchouli sous les pieds avec du cèdre et du Nard). voilà de quoi méditer…


 X – J’ai une question : le traitement mental est utile pour ; Remplacer une mauvaise habitude par une meilleure.

Est ce qu’on peut s’en servir pour intégrer une nouvelle habitude de bienveillance pour soi ? 

D – oui

Par exemple, se pardonner 

D – se pardonner est une chose 

, s’aimer de manière inconditionnelle ?

D – s’aimer inconditionnellement en est une autre.

-pour le pardon ; il conviendrait de pratiquer la guérison ponctuelle ds le passé, plusieurs fois, + un quartz pour amplifier, avec une demande affirmative sur le papier + les symboles, durant au moins huit jrs. et fr le trt mental après. jusqu’à ce que ça suffise. mais le traitement mental seul je n’y crois pas. Car pour se pardonner il faut atteindre plusieurs couches de l’esprit – des 3 niveaux ; conscience, cœur, besoins (le Ki).  

  X – Guérir une blessure d’injustice ?  

D – idem. ds ce cas aussi, il y a des couches « non mentales » à soigner. et à mon avis :  la guérison ponctuelle ds le passé, plusieurs fois, + un quartz. C’est absolu, ça va agir.

et je préconise l’IPE en plus, plusieurs fois également. 

X – Du moment que la formulation de phrase est positive ( sans l’emploi de négation) on peut mettre ce qu’on souhaite ?

D – viens fr le Reiki Komyo un de cs 4, tu en saura plus sur les méthodes de guérison de Mikao.



J’ai eu la preuve grâce à toi et au Reiki de ce que je savais déjà mais qui restait inintelligible.
Tu as remis de la lumière et de la connaissance où c’était désordre et croyance. 

Merci du fond du cœur 


Interprétation d’un signe comme l’interprétation d’un rève – suite à un stage intensif 2ème degré reiki.

Le 11 avril 2018 à 17:22, e….. <e….@hotmail.fr> a écrit :

Bonsoir Dom , OUI !! un très beau stage reiki 2ème degré et un grand MERCI !! Le retour a été brutal !! Sur la route de ST b….. une voiture sans chauffeur est venue me percuter … Elle était garée dans une rue en pente ??? Le choc a été violent !! je n’ai plus de voiture mais suis en Vie !!  Pour moi tout a un sens … j’ai besoin de toi pour m’éclairer !!

J’ai déjà eu un accident en retour de stage dont le thème était le lâcher prise !! J’avais été blessé impossible d’échapper aux pompiers !! Cette fois oui … les symboles reiki m’ont aidé et m’aident encore !  Si tu peux voir où ça coince …je suis preneuse Dom . Ce que j’ai vécu pendant le stage est indestructible et essentiel pour moi !! encore merci !!

D – Le 11 avr. 2018 à 18:05, dom jeambrun <contact@planete-reiki.fr> a écrit : 

Bonjour É…en effet c’est percutant comme retour ! 

Dans l’accident de voiture on entend le mot auto destruction.

La voiture représente la conduite pour aller vers les autres.

Cet accident te montre que lorsque tu veux aller vers les autres, alors que c’est le moment d’être pleinement soi-même, tu peux avoir des pensées autodestructrices, des pensées ou tu ne te sens pas capable, pas à la hauteur, des pensées ou tu doutes de toi… pose toi les questions ; lorsque tu penses aux autres, lorsque de faire des choses pour les autres, que se passe-t-il ? Dans des pensées conditionnées ?

Est-ce que ton véhicule a été percuté à l’avant sur le côté droit ou gauche, à l’arrière ? Cela t’aidera à réfléchir plus aisément ; à l’avance cest du à des craintes du futur. À l’arrière cela vient de pensées liées au passé côté droit c’est le côté qui rationalise, qui contrôle. Et côté gauche c’est le coté réceptif, sensible, intuitif… le côté droit contrôle de l’intuition…

voilà c’est une première intuition d’interprétation… tu me diras ce que tu en penses.

E – Merci pour ta réponse … percutante elle aussi ! 

Il m’a fallu un certain temps pour digérer tout ça ….tellement juste tes explications !! 

Je n’ai que des pensées auto destructives la plupart du temps !! et lorsque que j’arrive a dépasser ça, les résultats sont fabuleux pour les 2 parties !! car là je me sens entière …malheureusement j’y arrive peu souvent !! Enfant , je ne me suis jamais sentie à ma place et toute ma vie d’adulte je ne cesse de répéter que je ne fais pas partie de ce monde ce qui n’aide pas à prendre ma vraie place !! 

Le choc très violent a écrasé tout le côté gauche avant de ma voiture …tu as encore raison !!! 

Je ne me fais pas confiance  …ni à mon intuition…et le pire de la violence envers moi .. Les larmes m’envahissent … Merci Dom et à bientôt E……..

                  L’autotraitement Reiki 2ème degré, on peut le faire une fois par semaine par exemple? 

D – Il vaut mieux le faire ts ls jrs, court si tu veux, mais il vaut mieux un peu ts ls jrs, régulier, qu’une fois par semaine.
tu peux fr 1/4d’hr chq jour et 3/4 d’hr une fois la s’mn.

Mais installe toi ds un confort régulier de pratique d’auto soin, le Reiki aime ça.
Pense que tu dors chq nuits, non !!? 

Y a t-il une cadence particulière, et peut- il se rajouter au soin du programme de longue durée sans que je sois complètement  » décapée » ?. Cela me fait penser que trop de nettoyage au savon retire la fine couche naturelle protectrice de la peau!

D – il ne peut pas y avoir d’over dose avec les soins reiki !!!!! au 3ème degré on s’envoi du reiki à distance en permanence !!! non stop….

Plus tu nettoies le passé, plus tu deviens celle que tu ne connais pas, celle que tu es amenée à ètre.
Tu dois ètre à 8, p’tr 10% de ton potentiel ADN……le reste est encore sous le controle du mental…..un bô chemin à découvrir….
….ce que veux dire, c que ces 5 à 8 % de potentiel, il s’agit des potentiels des 12 vertus de l’ADN, et le niveau national est entre 3 et 5 %.
En tant qu’initié reiki, pratiquant en spiritualité, le % est plus important mais, il nous reste 90 à cultiver.
c pour ces raisons que les « grands sages » s’isolent du monde, et de préférence en communauté, puis en isolement total, avant de revenir et retransmettre. Et repartir, sinon ils ne supporteraient pas « notre mode Monde social ».
Nous, nous avons la communauté reiki, on se retrouve ensemble, on partage, on échange, on donne, on reçoit. et on gravi des marches, des degrés reiki ; vers le haut, et vers la profondeur.


Chanter les 5 principes reiki

Chanter les 5 principes reiki ? Est- ce « je vais dans l ‘infinité etc jusqu’à la ligne 5..infinie » ?

D – je comprends pas la question !!?
voici un lien vers le chant des 5 principes ; vers le millieu j’explique l’utilité, le but.


Puis je  être simplement dans l ‘intention de faire canal en recevant le reiki pour lui transmettre énergie et amour, ce que je faisais jusqu’ici , est-ce suffisant….? ou dois je rajouter un ou plusieurs symboles ? en les poussant dans le corps de la personne avec chakra de la main( sans le lui dire) la demande est un massage!

D – Dans l’éthique du Reiki on sait par expérience qu’ il est fortement recommandé de ne pas faire de Reiki à quelqu’un qui n’est pas d’accord pour en recevoir, et encore moins faire du Reiki à quelqu’un sans lui dire qu’on lui fait du Reiki. La raison est simple. L’énergie du Reiki, à plus forte raison avec les symboles du deuxième degré, peut faire remonter des émotions chez la personne, voire des douleurs physiques, de la même façon que si elle était d’accord pour recevoir du Reiki. Sauf qu’elle n’est pas au courant.

Ce matin j’ai eu un mail d’une élève qui a fait un soin à un jeune enfant (5,6 ans)… il l’a bien apprécié… mais le lendemain son torse était couvert de boutons. L’enfant et la mère était au courant que c’était du Reiki ils étaient d’accord, et pourtant la mère a demandé à ce que la praticienne arrête de faire du Reiki. Dans ce cas c’est dommage. J’ai répondu à ma stagiaire que le Reiki avait réveillé une colère dans le chakra du cœur chez cet enfant visible par une sensibilité à fleur de peau avec l’irruption de petits volcans. Effectivement quand il était beaucoup plus petit il a été témoin de violences de son père vis-à-vis de sa mère.

Imagine que tu fasses un massage en faisant du Reiki avec les symboles en plus sans le dire à la personne et que ce genre de situation se déclenche… je comprends très bien ton intention, a priori elle est magnifique, mais essaye de clarifier avec SHK s’il n’y a pas une partie de l’ego qui est en quête de pouvoir (pouvoir guérir) en quête de reconnaissance, en quête d’être aimé en retour du soin « en faisant du Reiki mon massage est plus puissant j’aurais plus de succès ».

Mon conseil, ouvre ton cœur avant le massage, et dans ton rituel de préparation demande à être guidée pour savoir si c’est juste que tu fasses du massage et du Reiki à la personne sans la prévenir ou si c’est juste que tu fasses du Reiki à la personne pendant le massage en la prévenant que tu vas lui faire du Reiki.

Le but du deuxième degré et de faire du nettoyage afin d’être de plus en plus en pleine conscience pour chaque acte du quotidien.


Le 9 avril 2018 à 11:58, S…. <z……@yahoo.fr> a écrit :

Bonjour Dom, Un très grand merci pour ton enseignement donné dans le respect de chaque personne avec douceur et subtilité. J ‘ai beaucoup aimé , pour cela merci! L’énergie du groupe était extra…aussi.
Notre fou rire, joie à rire  profondément délicieuse… , j ‘espère n ‘a pas trop dérangé …il était là, nous l ‘avons vécu avec beaucoup de liberté merci à toi, là aussi!

Les spasmes ont disparus avec les chants  aériens que tu enseigne dans tes stages..Si il y avait un lien avec le soin que ce soit par le rire ou le ventre , alors il était question de libération…

J ‘ai merveilleusement dormi aussi cette nuit, et j ‘ai mis tous les symboles dans ma méditation du réveil.

   je vais continuer mon apprentissage chaque jour…. avec bonheur de m ‘offrir tant .

Merci pour tout, ton calme intérieur est aussi communicatif que notre joie et je pense que rien que cela peut déjà apporter pendant 2 jours une vision » d être en paix » très agréable et apaisante à tous les stagiaires. C est avec toi que je passerai le 3ème degré l ‘année prochaine.

Voilà pour mon petit retour de digestion partielle

                                    .Merci aussi à Josiane et Pierre Claude, mes amis qui m ‘ont parlé de toi.

                                     Merci à Myriam qui t ‘a invité sur son site

.Merci aux rencontres et à la vie!

belle et lumineuse journée et Bravo! 


Merci Dom pour tes vœux ! 

Une très bonne fin d’année à toi, 

merci pour tes enseignements et tes lumières partagées avec nous cette année 🙂 ! 

 Merci de m’avoir aidé à trouver l’espoir, merci de nous ouvrir les portes de ta maison si chaleureusement, 

Merci de nous aider à trouver les clefs pour aller à l’intérieur de nous… et les outils pour mieux nous connaître…

Je te souhaite tout le meilleur, Amour, lumière, joie, paix et émerveillement… et tout ce à quoi tu aspires.

Amicalement, J…..


mon meilleur ami a eu un accident de voiture, 

D – auto destruction ds ses pensées en « allant vers les autres »  … et en suivant les symptomes ci dessous on comprend sa tendance à s’auto détruire, 

 et a ete touche a ka rate il y a qqs annees. 

D – ce qui peut affecter la rate ; la nostalgie, les choses inachevées, les regrets….obcédé par quelqu’un ou quelque chose, idées négatives…les inquiétudes !

Auj il a toujours un caillot de.sang 

D – Le sang représente la joie qui circule ds le corps. Le caillot représente comme un bouchon à cette circulation. Il est souvent du à un secret bien gardé, jamais exprimé….un mensonge ou une tricherie qui n’ont jamais été exprimées.

qui se balade et la medecine lui dit que la seule solution c est l operation mais il ne croit qu aux medecines douces. Je vais l’initier prochainement au reiki mais en attendant j aimerais savoir si je peux continuer les soins.

D – oui, fais des soins tte et gorge au moins 15 mn, puis les reins, et enfin tout le corps.

S il y a  qqch en particulier a utiliser avec le reiki car il est vraiment tres receptif a cette energie.

D – oui ; syntonie de guérison, suivie de suite par IPE et soins sur table. Autant de fois que tu le jugeras nécessaire.

Ou le mettre dans ma.grille car  je lui fais aussi des soins a distance.

D – ça c’est incontournable, en bonus ! Des choses vont remonter lors des 1ères initiations, il risque de les « cacher », les retenir….prépare t’y !



Le 1 décembre 2017 à 11:59, Y…. <Y….30…@yahoo.fr> a écrit :

Bonjour Dom, Suite de l ‘atelier « rêves »…je me suis réveillée ce matin très mal à l’aise, limite angoissée, paniquée, j ai passé ma matinée à tourner en rond,physiquement et mentalement, sans parvenir à fixer mon attention sur quoique ce soit, je me sens déstabilisée, je réfléchis et ne parviens pas à comprendre, qu’est ce qui a pu avoir cet effet : l’évocation que je ne ressens pas l’énergie, ma difficulté à utiliser les outils du Reiki 2ieme degré? Avant de m’endormir j’ai tenté de contacter mes guides, en leur disant mon besoin de faire leurs connaissances et en leur priant de m’envoyer un rêve pas trop compliqué a analyser pour que je puisse avancer. Pas de souvenir de rêves à mon réveil…Est ce que tu penses que tu peux  « m’éclairer »

D -Bonjour Y…ce qui t’arrive me semble tout à fait naturel ; tu as dû t’endormir en tournant en rond dans la tête la prise de conscience de ce que tu devais changer et en appliquant les techniques apprises en stage. Peut-être même têtu jugé de ne pas avoir fait de ne pas le faire, as-tu fabriqué de la culpabilité ; augmentant une sous-estiment de tois et augmentant ainsi le manque de confiance en toi-même pour t’affirmer.

Cela m’était déjà arrivé quelquefois, plusieurs fois mêmes, il y a quelques années.

On s’afflige, on s’endort là-dessus, ça fait son chemin toute la nuit et au matin on se réveille engourdi, au bord d’une mini dépression. Initié au Reiki on appelle ça symptôme de guérison ! Pourquoi ? Parce que c’est le signe que ton être intérieur prend conscience qu’il est capable de guérir et de transformer sa vie. Je peux te donner cette recette :  écrit sur une feuille de papier une phrase affirmative positive active : » avec amour au quotidien je pratique les techniques Reiki deuxième degré de changement du passé, ma vie devient riche et joyeuse au quotidien, ça me rend heureuse. » 

– Avec cette phrase fait toi tous les jours un traitement mental, suivi d’un quart d’heure de Reiki au niveau de la tête de la gorge. 

– Et bien sûr tu charges 1 beau cristal de quartz pendant 15 minutes que tu recharges tous les quatre jours (avec le papier les symboles et la phrase bien entendue). N’attends aucun résultat ; faire ça au quotidien avec la notion de plaisir et de respect envers la vie ; et avec beaucoup d’amour et de tendresse envers toi.

– Et enfin : envoi d’un mail à ton groupe Reiki deuxième degré pour leur demander de t’envoyer du Reiki à distance en soutien.

Si tu l’écris c’est que tu le dis !
c’est donc vrai !

Questions ! Pour ma fatigue, présente plus que jamais,  associée à d’autres signes pas très cools. Je connais les réponses car je me suis posée presque toutes ces questions que tu soulèves en stage reiki ….!!! Oui j’en fais trop, je travaille trop, je déménage ds 3 semaines. oui j’ai besoin de lever le pied, de déléguer, de dire stop….! J’ai besoin de vacances, et ça tombe bien car je prends l’avion demain pour le Vietnam……!!! 

Ce qui est très curieux, c’est que j’ai été ds le même état, surtout émotionnel, à Noël, après le reiki 1. Et là c’est un peu pareil, l’émotivité à fleur de peau ! Peur de ne pas revenir de ce voyage et d’abandonner ma fille…..! Je n’ai jamais eu ce genre de peur auparavant !!! Très curieux et déstabilisant tout ça…..!!! Heureusement qu’Olivier est là pour me « rentabiliser » lol…..! 

En tout cas, merci encore pour tes mots qui résonnent. Et ta présence. Et à très bientôt pour une soirée partage ou un atelier…..!!! 

P….Envoyé de mon iPhone 



Le 5 juillet 2017 à 23:33, j…. <j….@gmail.com> a écrit :
Bonjour Dom, Je viens vers toi pour un conseil; comment prodiguer un soin à une personne qui a des difficultés à s’endormir voir même , ne pas arriver à s’endormir. J’ai besoin de tes conseils avisés, quel protocole pour ce genre de soin? Merci , Belle soirée, J….

Le 8 août 2017 à 12:28, dom jeambrun <contact@planete-reiki.fr> a écrit : Bonjour J…je rentre de voyage, je n’ai ^pu te répondre avant….pour ce genre de symptome, il faudrait faire une IPE –technique que tu as apprise au 3ème degré Reiki) et aprés, durant au minimum 4 jrs de suite la prise cosmique  15mn (technique apprise lors du 1er degré)  ! et continuer le soin comme tu le sens aprés la prise cosmique, si possible…le tout accompagné d’un envoi à distance – ds la boite des cristaux Reiki. bons soins !

Le 20 Septembre 2017 à 9h:25, j…. <j….@gmail.com> a écrit : Bonjour Dom, j’espère que tu as passé de bonnes vacances, merci pour ta réponse qui m’a bien aidé . A bientôt. J…. 

Tendinite sur une épaule

Une question, une personne m’a contacté pour recevoir des soins. tendinite sur une épaule. Et à l’autre, capsule bloquée. Elle peut plus soulever le bras. contracturé à fond aux cervicales. ça fait 3 ans que c’est comme ça. Elle fait kiné, est en arret de travail. J’ai déjà fait 2 séances. à une semaine d’intervalle. Demain je la revois. Je lui ai proposé une IPE. Je me demande si les soins doivent être consécutif et surtout rapproché. Une fois par semaine, ça te parait pas un peu espacé ? 

D – oui, vu la densité du besoin, je ferais au minimum 4 jours consécutifs ; IPE puis soins complet et chanté !!!
utilise l’aqua aura pour elle, sur elle  pendant le soin

Elle passera certainement son premier degré, quand elle sera en mesure de conduire, et de pouvoir rester debout. Car en ce moment, elle est souvent allongée. Je crois qu’une IPE peut bien faire bouger ce qu’il faut. Est ce que ça peut se faire plusieurs fois car sur plusieurs séances ? 

D – Aucun souci, au contraire. mm sur le mme sujet !

En parallèle, je lui ai fait un envoi à distance aussi. 

D – c parfait ! Tu peux aussi tenter de définir ce qu’elle s’est/se refuse de dire, d’exprimer, et l’utiliser avec une séance de traitement mental un petit moment aprés ; IPE + Soin (le temps qu’elle atterrisse quoi !)


La Foi, ou la confiance en !?? 

faut que je te raconte Dom…

J’ai longtemps hésité à m’inscrire au stage formation à la maitrise niveau 4 du mois prochain, ça fait des semaines que j’y pense. Et hier matin, ma petit voix m’a dit d’y aller. Je l’ai écoutée, comme tu sais.
Cette nuit, j’ai fait un rêve.  Magnifique. Où j’étais le capitaine d’un navire somptueux, un navire stellaire. J’hésitais à endosser le rôle et la « cape » du capitaine. J’ai écouté mon instinct, et j’ai fini par accepte la tâche et la responsabilité qui l’accompagne. Je me suis même trouvé un adjoint dans ce monde onirique 

Une fois le rôle endossé et une fois au commande du vaisseau, j’ai pris conscience dans le rêve. Et « on » m’a dit que c’était mon tour de devenir le commandant de mon navire Reiki, que la passation était faite. Que j’étais prête à voguer. C’était beau, et fort.

Je me suis réveillé encore plus motivée.
Et là, sur facebook, je tombe sur la page de ton site de sculptures. Curieuse, je vais voir ce site que je ne connaissais pas, la page s’ouvre, et les yeux ronds je vois apparaitre ce superbe navire que tu as sculpté en métal de récupération !!!. 

Et j’ai éclaté de rire


La lettre reiki de Mai reflet de notre météo intérieure

     La lettre reiki de Mai reflet de notre météo intérieure

Méditer avec les pierres

Méditer avec les pierres de la nouvelle conscience.

Méditer avec les pierres de la nouvelle conscience


Je propose 1 atelier – 2 dates au mois d’avril 2019 pour méditer avec les pierres ; Méditations de la nouvelle conscience.


Cet atelier ‘méditer avec les pierres‘ se fera sur deux journées ; le mercredi 10 le jeudi 11 avril.

Même atelier ‘méditer avec les pierres’ se fera également la semaine suivante ; le mercredi 17 et le jeudi 18 avril.

De 10 heures à 17 heures – avec des temps de pauses, et repas partagé le midi.

Maximum huit personnes. Participation 80 € pour deux journées. 100€ pour les 2 ateliers !

Prudent de réserver !

Cet atelier est ouvert à toute personne, même aux personnes qui ne sont pas initiées au Reiki.


Programme de l’atelier méditer avec les pierres

En ce qui concerne la formulation « méditer avec les pierres », il s’agira d’entrer en communion avec l’esprit de la pierre. En effet, certains d’entre vous se rappelle sûrement l’article de presse que j’ai partagée dans un autre poste et aussi sur mon mur Facebook Planète Reiki.
Cet article révélait que l’ensemble des scientifiques et des chercheurs avaient découvert et compris que dans les minéraux il y a des neurones. Donc de l’intelligence. Les minéraux ont donc une volonté propre.
Les anciens, dont les Grecs, les ont appelés ‘les messagers de Dieu’.

De tout temps les chamanes les sorciers les rois les reines des prêtres et les prêtresses ainsi que les personnes qui occupaient un poste prédominant dans la société comme les juges, les grands voyageurs, tous ont toujours porté plusieurs pierres sur eux, ou du moins quelques pierres précieuses. Rubis topazes émeraudes saphirs Tanzanites… Il portait sur eux et minéraux en pleine conscience car il savait que ce sont des alliés. Des messagers.

Je vous guiderai dans plusieurs méditations transcendantales pour entrer en communication avec l’esprit des pierres. Des portes s’ouvrent dans la conscience. Des informations sont échangées dans le secret, mais aussi dans la pleine conscience du moment.
Il ne s’agira pas de vouloir guérir, il s’agira d’en savoir plus sur soi et sur le monde réel. Des changements, perceptibles ou non, conscients et inconscients, opéreront à la suite de ces ateliers dans la vie de tous les jours à la suite au quotidien.

La crypte des minéraux

Vous serez guidés.  Plusieurs méditations transcendantales ‘Méditer avec les pierres’ la première journée.

La crypte des minérauxLa journée du jeudi sera consacrée à faire un voyage à l’intérieur d’une crypte de minéraux.

Afin de compléter et de poursuivre les résultats des méditations transcendantales d’avoir méditer avec les pierres, un voyage apaisant et hypnagogique dans le sein de la cryptée des minéraux fera de cet atelier un moment inoubliable.

La cryptée des minéraux est une onde de forme composée de 72 cristaux de quartz et de quelques pierres semi précieuses. Le concept de la crête des minéraux a été mise au point par un grand chercheur passionné de métaphysique, et passionné par les minéraux ; Patrick Drouot.
J’ai été formé par un de ses disciples.

Le but ; évacuer des énergies indésirables, puis se ré-aligner dans la circulation des énergies yin et yang en accord avec les courants telluriques de la planète. Quant à la troisième phase elle permettra de régénérer l’être tout entier avec les énergies pures canalisées par les 72 cristaux de quartz.
Durée par personne ; environ 45 minutes.
De manière très douce accompagnée par des bols tibétains et des gongs espacés de très longs silences.
Une toute petite musique de fond, à faible volume pour ne pas détourner l’attention du rêveur.
Il arrive fréquemment dans cette situation des plus agréables de faire un petit voyage – de recevoir des messages – de vivre à travers des images Hypnagogiques.

Je fournirais quelques pierres choisies.

Mais vous pourrez également amener quelques pierres avec lesquelles vous aimeriez méditer. Vous aurez ainsi une idée de comment méditer avec vos pierres.

Après chaque expérience un temps de partage des vécus de chacun apportera de la connaissance au groupe.

Je suis maître enseignant de Reiki depuis une vingtaine d’années, depuis presque une dizaine d’années j’anime régulièrement un atelier sur la physique quantique et la symbolique des chakras, un atelier par mois tous les ans. Passionné par les pierres par les couleurs par les symboles, je me suis formé à plusieurs ateliers de Lithothérapie et de radiesthésie.
J’ai plusieurs fois guéries des symptômes personnels avec la réflexion, avec le Reiki, avec les Huiles Essentielles et prenant le temps de méditer avec les pierres.
Depuis quelques années je suis une formation -que je pratique – l’angéologie traditionnelle de la kabbale mixé avec l’interprétation des rêves et des signes, et je sais que pour vous guider lors de ces ateliers je serais moi-même guidé par les anges spécifiques qui ont des affinités avec les pierres.

Soyez curieux ! N’hésitez pas à tenter cette belle expérience !
Venez vivre avec nous cet atelier ‘Méditations avec les pierres’ !

Méditations avec les pierres


Written on septembre 28th, 2017 ,

Pierres et métaux favorisant l’harmonisation.

Pierres et métaux favorisant l’harmonisation propos d’Edgar Cayce.


J’ai écrit cet article sur les pierres et métaux en reprenant des propos d’Edgar Cayce.

Pierres et métaux favorisant l’harmonisation propos d’Edgar Cayce.


En 1956 le maître yogi Yogananda ( Paramahansa Yogananda ) disait que, appliqué sur la peau, les perles, mais aussi les pierres précieuses, ainsi que les métaux tels que l’or l’argent le cuivre l’étain le fer. Pierres et métaux, mais aussi les pierres semi précieuses, qui exercent une influence électromagnétique sur les cellules.

Le corps humain contient du carbone et divers éléments métalliques. Atomes de pierres et métaux dont certains sont également présents dans les pierres précieuses et les cristaux de quartz.

Les découvertes des rishis – sages et médiums indiens d’une haute sainteté – en cette matière seront sans aucun doute confirmés un jour par les physiologistes. Le corps sensible de l’humain, avec ses courants vitaux électriques, est le foyer de nombreux mystères encore inexplorés.

Edgar Cayce fit la lumière sur ce mécanisme de l’influence électromagnétique des pierres sur le corps humain. Les forces vibratoires qui proviennent de certaines pierres et de certains métaux collaborent avec des forces similaires à l’intérieur des humains, pour leur permettre de s’harmoniser aux forces créatrices de l’ univers.

Les humains peuvent de cette façon recevoir et transmettre des vibrations de guérison. Spiritualiser leur désir. Obtenir de la « nourriture » pour le développement de leur âme… pour ne mentionner que quelques possibilités.

Rudolphe Steiner a également apporté des preuves tangibles de l’inter-connectivité des humains avec l’univers. Et Mikao Usui dans la même période – 191/1920  a vu compris et structuré le système du Reiki qui permet cette connexion à l’intelligence planétaire universelle, intelligence de guérison mentale physique et spirituelle, et qui est aujourd’hui la plus enseignée dans le monde entier pour transmettre des vibrations de guérison fiables et durables .

La fusion avec la tradition du Reiki japonais, tressée avec la connaissance des maîtres indiens et des scientifiques occidentaux, abouti à ce miracle prévu par l’univers ; l’envoi du Reiki à distance permanent grace aux vibrations des pierres choisies. Méthode que nous apprenons au deuxième degré de Reiki Usui Komyo Kai – et Reiki Usui Komyo Do, c’est la même chose.

La pierre, précieuse ou semi précieuse, libère tout comme elle attire, par le biais de la vibration positive négative – attraction répulsion. Cela contribue à l’unisson, en tant que liaisons. Il existe une affinité réciproque entre la pierre, dans les vibrations, et un corps humain.
À quelle fin ? En vue d’accroître la réceptivité du corps humain en rapport avec ce qui est recherché par celui-ci dans le but d’aider la conscience a changer quelque chose. D’où l’importance d’utiliser, ou de porter sur soi, les pierres précieuses ou des métaux pour vous aider à vous élever vers les influences de l’univers afin de développer vos pouvoirs psychiques – clairvoyance, claire audience et tout autre chose qui fortifie le mental et le corps.
Les éléments du corps humain, à travers lesquels se manifestent l’esprit et le mental, sont de nature atomique. Il en va donc de même pour les éléments de la pierre dans laquelle on retrouve la plupart des éléments qui ont une influence marquée ou un grand pouvoir sur l’humain, en raison de la même représentation dans le corps.
D’où l’activité radicale de la pierre, de même que les influences fortifiantes de l’or, l’action stabilisatrice de l’argent, qui compte parmi ces éléments qui contribuent à la transmission par le biais de l’activité des forces vibratoires elle-même contenue dans tout l’univers, dans le tout.

Pierres et métaux favorisant l’harmonisation propos d’Edgar Cayce.

       Pendentif en          Améthyste

Mais comme le précise Edgar Cayce, ne vénérez pas l’obtention de quelque chose, mais vénérez plutôt ce vers quoi elle peut vous guider lorsque vous cherchez… a servir. Et ce, qu’il s’agisse des vibrations des métaux, des pierres, du Reiki, celles-ci ne seront simplement que des influences nécessaires pour vous harmoniser avec les forces créatrices de l’univers.
De même que le temps d’un mantra n’est pas le mantra ni son contenu mais un auxiliaire pour ceux qui voudraient être affermis dans le service – l’altruisme, comme le démontre Amma.
Aussi il est préférable de les utiliser pour harmoniser l’esprit, le mental et l’ego, la conscience, pour aller vers. Soi.

Toujours selon Edgar, il est recommandé de toujours porter un lapis-lazuli sur soi car cette pierre contenant du métal agit en permanence sur le maintien de la santé, et un pendentif d’améthyste au cou qui aidera à maîtriser le caractère. Mais également – et ça n’est pas connue ni conseillé par les lithos thérapeutes, je le fais donc ici… Edgar. C relate que les anciens maîtres de l’Inde, les richis, prescrivaient de porter un bout de métal d’acier pur tout près de l’aine – facile aujourd’hui ; la poche du jean, du short – car le carbone est le principal élément utilisé pour le durcissement et la trempe – la structure du caractère, l’ossature ancrée dans le chakra racine. On doit trouver ça dans les minerais de fer, peut-être dans certaines météorites mais il faut en vérifier l’analyse de composition.

Edgar C, Rudolphe Steiner et Carolyn Miss… et bien d’autres chercheurs contemporains, démystifient le pourquoi du comment les pharaons les prêtresses et les déesses portaient toujours beaucoup de pierres précieuses et de métaux sur eux, particulièrement lors d’intronisations ou d’initiations. Il savait très bien que les minéraux ont une intelligence subtile qui fait canal entre l’intelligence cosmique et notre propre intelligence. Hélas notre système éducationnel l’a divisée en plusieurs parties séparées – conscience, esprit, mental, ego. Et comme ça ne suffisait pas, grâce à l’embrouille de la langue française il y a aussi moi supérieur, moi inférieur, conscient, inconscient, subconscient, le ça le moi, le petit moi le grand moi… et j’en oublie sûrement.

Pierres et métaux favorisant l’harmonisation propos d’Edgar Cayce.

Pendentif lapiz lazuli

Personnellement je me range du côté des grands chercheurs, des grands trouveurs comme Edgar Cayce Rudolphe Steiner Hubert Rives Mikao Usui et Yogananda pour ne citer qu’eux, et tout particulièrement mes maitres Reiki Komyo japonais et tout ce que j’écris et pratique, j’essaye de le canaliser par l’Esprit et la voix du cœur.

Les pierres précieuses semi précieuses et les métaux, portez-les sur vous, dormez avec ou posez les  à côté, écoutez votre cœur et votre intuition pour avoir le meilleur des modes d’emploi. Et soyez convaincus que les pierres précieuses et les métaux seront des alliés, des associés qui permettent à la conscience universelle de vous transmettre des messages. Ne prêtez pas l’oreille pour entendre le message d’une pierre, car comme vous, ils ne sont que les serviteurs du grand maitre ; l’univers.



Histoire de coïncidences synchronisées


Topaze impériale

Histoire de coïncidences synchronisées

Topaze impériale


Questions-réponses juin 2017


Un enfant en colère

Un enfant en colère

2CV Citroen-deuxdeuch


Montez dans la 2CV Citroen, la deuxdeuch !


F – Merci Dom, merci Reiki …Depuis plusieurs années, mon fils âgé de 9 ans aujourd’hui, avait de nombreuses colères « inconscientes ». Et il avait aussi très peur de l’orage. Suite à tes conseils sur les soins à faire, je me suis fait du reiki à distance, surtout les prières avec le symbole du cœur Reiki 2 pour que puisse arriver à ce que je lui dise les bons mots « d’autorité » et que lui, puisse les entendre … ; plus des soins à distance avec les 4 symboles Reiki 2 dans mon passé …tout ça…….et le soin que tu lui as fait, et où les paroles qu’il t’as confié, que tu as su « entendre » ont établi une prise de conscience.

Aujourd’hui il est dans « les paroles du cœur », la bienveillance, il a enfin lâché prise. Alors Merci à toi, et un peu à moi, à nous , pour sa merveilleuse métamorphose. Mais comme tu dis souvent Continuons à « Nettoyer », «Nettoyer »….

Un enfant en colèreDom – Le soin que je lui ai fait, après lui avoir posé tranquillement – mais en « pleine conscience » quelques questions et re-questionnement, le soin que je lui ai fait est une technique du 3ème degré Usui, IPE,  mixée avec deux symboles du niveau 2 Karuna®. Et fin de soin avec une méthode de Reiki niveau 4, pour la guérison spirituelle.

Mais avant de commencer le soin, je lui ai demandé de s’allonger sur la table de massage, et doucement, progressivement je lui ai fait écouter un autre orage.
Un soin sonore avec des gongs planétaires – Bain de gongs Paiste ; Gongs Planétaires -, tout en lui transmettant mes connaissance sur les sons de l’univers, le lien entre l’orage, l’Univers, et ses colères.

Une fois le soin reiki 3ème degré terminé, je lui prété la mailloche pour qu’il joue lui meme sur les gongs, qu’il joue à faire l’orage.

Au retour des parents qui me l’avaient confié pour le soin et l’entretient, j’ai fait un retour ciblé sur leurs filtres vis-à-vis des attentes de l’enfant.
Et enfin, un envoi Reiki avec les 4 symboles du 2ème degré durant 21 jours – dans le secret – afin d’écarter toute attente.

Et, joie, il n’a plus peur de l’orage.
Om Shanti (Paix dans le Karma)


Questions-réponses juin 2017

Parmi les échanges ; questions réponses enseignant-stagiaires

Quelques nouvelles locales du Reiki, suite à des questions posées par mes stagiaires, entre février et juin 2017. Ce n’est qu’une partie des échanges sur ce semestre. Je les publie, de façon anonyme, ceci uniquement afin que ces échanges puissent apporter des solutions à un plus grand nombre sur l’Hexagone et au-delà, car il y a beaucoup de gens qui consultent Planète Reiki.fr par curiosité, mais aussi pour trouver des solutions à leurs souffrances, au pour régler certaines problématiques. Comme dans un Forum Reiki.

Un enfant en colère

Restez calme…surtout n’allez pas péter un câble !

)Fracture du poignet

Fracture du poignet

– S… Ma fille qui fait du karaté s’est à nouveau fracturé le poignet ‘ radius et cubitus) toujours le même côté, le gauche  et j’aimerais si tu peux, me donner une information par rapport à cela et où aller chercher les infos car c’est drôle que ce soit toujours ce côté en lien avec la mère et tous les 2 ans à la même période, à l’approche de Pâques!!!

  • Dom…se blesser au poignet est représentatif d’un manque de flexibilité ds ce qu’elle fait. Dans une certaine situation. Quelque chose qu’on lui demande de faire, ou d’etre…
    Elle résiste, surement de peur de ne pas y arriver, de ne pas etre à la hauteur.

* la fracture témoigne qu’elle résiste, donc ça casse.
*l’os c la structure solide de l’etre…..elle doit etre solide mais pas rigide ! Le squelette est fluide, souple…..malgré l’illusion de la raideur. Il y a des articulations – pour nous montrer que ds la vie faut aussi Articuler !!  ne pas rester raide quand ça nous déplaît.
Et bien sur, le poignet est dans le prolongement de la gorge et du coeur !!!!



– N…On vient de diagnostiquer une hyperthyroïdie a ma fille aînée Je crois me rappeler que le Reiki t’avait en son temps guéri d’une maladie Auto immnune
Que penses tu que je puisse faire pour elle ou qu’elle puisse faire pour elle même??
Un stage ? Des soins?? Merci pour ton aide

– Dom…Pour répondre à la question ; le développement personnel et spirituel est la meilleure façon de guérir. L’inconvénient c’est qu’il faut se prendre en charge, se responsabiliser soi-même, au lieu de rester dans la zone de confort illusoire de remettre Uniquement ! sa vie entre les mains de la médecine traditionnelle. Le Reiki, à condition de le pratiquer, tel que je l’enseigne avec la connaissance des émotions humaines, physique quantique et connaissances spirituelles, permet effectivement de se transformer, de guérir les maladies auto-immunes. Et en fonction du rythme et des résistances à la guérison de chacun.
Le Reiki va à la cause du problème qui est toujours l’esprit ! Le Reiki agit sur le corps et sur le mental. Mental ou ego, est toujours responsable des problèmes physiques. Mais le mental, c’est l’esprit… donc, ; les pensées.

Voici quelques indications pour aider ta fille à mieux réfléchir sur quel cheminement elle doit orienter son développement personnel et spirituel ;
Hyperthyroïdie ; provient généralement d’une « détermination à atteindre des objectifs au détriment des besoins de repos ce qui épuise les réserves d’énergie ».
 Cette détermination a sûrement ses racines dans une peur ; inconsciemment la personne pense :  » je ne peux pas arrêter… je tiens le coup sinon… » il s’agit sûrement d’un désir inconscient de vouloir démontrer aux autres ce que l’on est capable de faire, ou d’être.

Question à se poser : « me serait-je demandé beaucoup pour réussir ? Pour trouver ce dont j’étais capable, pour être aimé parce que je me croyais indispensable ? ».

Et j’enseigne le Reiki dans ce sens ; le lâcher prise et l’amour de soi.

Je peux la recevoir en consultation, Qu’elle entende de vive voix en face-à-face ts ls détails de l’émotionnel que je ne peux ici te décrire par mail…. avec en plus, un soin karuna que je lui donnerais de suite après l’entretient oral, ce qui amorcerait un départ de guérison…


Retours de stage de formation à la maîtrise Reiki

Merci V….
je viens de t’initier au quatrième degré, la maîtrise Reiki Usui, je te remercie de ta confiance tout au long de ces années, jusqu’au bout du parcours.

je me retourne et vois ton cheminement depuis que tu as fait le premier degré avec moi, les embuches et les enthousiasmes, les cadeaux et les déceptions, espoirs désespoirs que tu as expérimentés, et je me dis que oui, tu as raison, il fallait que je le sache que j’avais été là tout au long de tbges cinq années de parcours comme je le promets au 1er degré ; vous pouvez compter sur moi. Merci de m’en faire ressentir le bénéfice par ton expérience.
mm si ce n’est que le respect de l’éthique du maitre Reiki, je réalise qu’avant tout c’est l’humain qui a un cœur. Un cœur ouvert, suffisamment, pour y accueillir tous les aspects des difficultés d’autrui. Je remercie le Reiki chaque jour pour ce qu’il a fait de moi, et grâce à vous, ce partage là.
Puisses tu connaitre à ton tour la beauté et la lourde tache de l’enseignement de l’essence du Reiki et etre une guide spirituelle pour montrer le chemin aux autres sans jamais, jamais faire les choses à leur place. 
Pas pour eux comme dit Gilles Deleuze, mais Avec eux.

M’autorise tu à partager cet échange, anonyme bien sur ?
Om Shanti

 V….Mais bien sur….Meme si pas anonyme. C est ton choix…. moi je confirme; Oui vas-y. V…..

Merci pour ce partage Dom…c’était un grand moment de joie en revoyant toutes les photos je ressent encore les bonnes vibrations du stage de formation à la maîtrise Reiki, je suis de retour en Touraine le soleil du Sud me manque,ici pluie…on accepte lol…sinon j ai fait 5initiations dès la sortie du stage…hui Yin contracté …bientôt toute la famille et ma mère qui m’a demandé cela devient contagieux hihi et bonne nouvelle un bébé reiki en route pour 2018…tonton une deuxieme fois merci reiki car ma soeur à eu un lourd traitement afin d avoir son 2emme enfant….J ai prié pour elle merci l univers…que de joie…et encore une fois merci à toi pour ton enseignement de qualité. …ta sagesse et tout ton amour….je t envoie tout plein d »Amour… sksk…namasté 


X…Juste un petit message pour te dire que depuis le stage de Formation à la maîtrise je me sens débordante d’amour et de compassion, avec une envie folle d’aider les personnes qui en ont besoin,
Ainsi qu’une envie irrépressible d’apprendre à me connaître mieux,
Je reprend un à un tous les livrets pour refaire le travail en profondeur cette fois-ci, pour moi ,
Bref je me sens portée comme jamais…Merci à toi pour tout ce que tu fais pour moi, pour nous, pour ta transmission de la maîtrise Reiki 4 remplie d’amour,Un jour, lorsque je serais prête, j’aimerais enseigner cette façon !


Bonjour Dom et amis Reiki, Merci infiniment Dom, maître Reiki par excellence. Quel beau stage et quelles belles personnes rencontrées, merci à tous, cela fait du bien.

2ème degré et tout s’éclaire…Honnêtement je pensais que cela allait se compliquer et oh surprise, tout m’apparaît plus facile…et ce qui est enseigné marche !

J’ai même ressorti mon nounours pour faire des envois Reiki à distance…et là aussi ça fonctionne…sans parler des pierres, quelle énergie !

J’aime les anecdotes et petites histoires du manuel Reiki 2ème degré de Planete Reiki, ça vous ressemble tellement…Je vous embrasse,à très bientôt j’espère…B


Natifs du signe astrologique Balance

Un des nombreux avantages d’être né sous le signe de la balance, c’est bien l’inspiration. L’imaginaire.
 Ça serait dommage de faire tout ce cheminement spirituel pour en problématiser l’élan. Ça ferait un trou dans l’univers, tu ne penses pas… !?!…

De tout temps on nous a dit d’écouter notre cœur, très souvent on a regretté de ne pas l’avoir fait. Inspiration… expiration… sans inspiration le cœur serait sec, et sans expiration il éclaterait. C’est drôle mais ce que je suis en train d’écrire m’inspire pour l’atelier de l’argent qui va commencer, la banque d’idées, dans quelques minutes. Merci à toi de « me faire t’écrire », merci l’inspiration !
Alors ne crains plus de suivre tes inspirations ; vis ta vie telle que te la dicte ton cœur et laisse les autres suivre le trottoir du troupeau.


Merci Dom, gratitude infini ! J’ai l’impression d’être enfin créatrice et actrice de ma vie. Le Reiki m’apporte et réveille en moi une force, une harmonie, un amour de moi même, d’autrui et une paix inespérée ! J’aime la vie, je l’accueille et la remercie comme jamais… Je rayonne, je vibre positif, et l’univers me le rend x1000 ! Je me sens trouver ma place dans ce grand et beau univers, et c’est le début d’une magnifique aventure qui s’ouvre à moi ! Merci merci merci !!!

– I… je ne sais pas ce qui est passe ; je voulais juste partagé mon évolution ;je travaille les sujets de l’acceptation et de la compassion ; grand programme ; je pensais accepter beaucoup de choses mais en fait il y a une différence entre accepter et subir de meme que pour la compasssion :etre compatissant pour les autres ne leur laissent pas tous les droits ;la frontiere est parfois tres proche ; peu à peu je restructure mon territoire differemment et certaines valeurs ; j’utilise bcp les cinqs principes de Mikao  et la meditation Gassho ;   apres le stage Reiki  komyo 3 ,j’ai senti le besoin de retravailler avec Reiki ces sujets ;tu pense bien qu’une infirmière ne peut y échapper ; je l’avais deja travaillé ;cette fois differemment puisque je suis plutot en reception de l’énergie et la laisse faire …

– Dom…c bien ça ! On apprend les 5 principes de vérités de Mikao par l’enseignement du Reiki, on est initié et instruit à la maitrise de transmission…..et ensuite il faut vivre l’épreuve de l’apprentissage face aux autres en confrontation avec nos mémoires distordues, faiblesses, désirs, peurs, autorité et soumission, tout un cheminement !!!
Ne jamais oublier que lorsqu’on enseigne on est Etudiant, élève nous mm.

Merci a toi pour ce stage UNITÉ, pour ta générosité, pour ta simplicité, pour avoir partager avec nous tes connaissances et expériences, pour l ‘ amour, pour avoir su trouvé les mots, pour donner l envie d aller de l avant. J ai hâte d être a fin mai pour revenir et découvrir le niveau Reiki 2ème degré. Un grand merci aussi a Véro, pour sa douceur, et son partage. Les photos reflètent bien notre stage.


A mon tour de te remercier Dom pour m’avoir non seulement ouvert l’esprit mais aussi initié à cette énergie universelle d’échange, de partage et de bienveillance. Dans ton mail, tu as fixé des images souvenirs du stage….. mais également semé une graine en conseillant justement cet échange, ce partage; A chacun de nous maintenant dans ce petit groupe fort agréable de faire grandir cette idée et j’en profite pour mettre tous mes nouveaux contacts en copie pour tous les saluer.


Dom et vous tous!!!!Je vous remercie également de ce partage, de cette union, de ces joies et émotions… Depuis le stage, j’ai beaucoup plus avancé sur moi-même, mon estime de moi-même, me regarder avec bienveillance, à réellement lâcher prise quand je fais mes méditations et dans ma vie de tous les jours… Ouaou!!!! j’ai tellement plus à dire mais un email ne saura pas faire passer toutes les émotions qui me traversent au moment où je vous écris…Un grand merci à vous, à cette amie qui m’a envoyée vers ce stage à Planete Reiki Juvignac, à l’univers qui m’a fait m’inscrire à ce stage en particulier et vous rencontrer… et merci à moi-même pour être arrivée au point où j’en suis!!! Je m’aime, je vous aime, je partage tout cet amour avec l’univers pour ceux qui en ont besoin…Je vous embrasse et au plaisir de vous voir très vite, Paix et amour

PS j’ai le sourire qui me fait mal aux zygomatiques en regardant les photos du stage !!!!!

​​ Le 23 mai 2017 à 14:35, 2 S… <…i@….org> a écrit :

Bonjour Dom, question : comment donner des soins Reiki à un ado qui manque de confiance en lui (mon gamin) ?

Sur la  vidéo dont je t’ai fait parvenir le lien, le conférencier mentionnait la confiance en soi pour les élèves, dans les applications possibles.

Si j’essaie de me souvenir de l’enseignement condensé reçu lors de notre WE alchimiste praticien Reiki 1er degré, je dirai :
– soin du corps complet, car ça ne fait pas de mal & pour être bien dans sa tête, il faut être bien dans son corps
– soin particulier au niveau des 3 chakras du haut.
Ensuite, comme j’essaie d’être appliqué, je consulte les documents reçus et je vois que différentes zones  peuvent être concernées, en fait, toutes les zones du corps !

Aurais-tu des conseils à me donner ? D’avance  merci & bonne journée

– Dom…merci pour la vidéo, je n’ai pas encore pris le temps de la regarder, mais je vais la caser dans mon programme j’ai juste essayé de zaper 2 , 3 endroits mais avec YouTube le zapping c’est compliqué. Je te dirai ce que j’en pense dés que je l’aurais visionnée.

Pour le manque de confiance ; en soi. Ce n’est pas que ça soit compliqué mais ça va prendre beaucoup de temps. On ne peut pas régler la confiance en soi en un seul bloc. Il convient de la régler contexte par contexte. 

Je te conseillerais de discuter avec lui et de faire une liste ;

-énumérer comme une liste de courses les domaines dans lequel il manque de confiance en lui…

Exemple ;

– physique, le corps, le visage…

– prise de parole, la voix, les mots, le vocabulaire, (j’aime pas ceci, j’aime pas cela… l’écrire sans juger sans justifier) et surtout sans tenter de rassurer.

– la mémoire, mémoriser les choses apprises et ne pas être sur de pouvoir les retranscrire lors des examens…

– les filles…

etc. etc.……… et il conviendra de définir quelle est la priorité et l’urgence : et choisir l’urgence et ; faire en sorte de trouver le moyen, ou les moyens, techniques de développement personnel, afin de comprendre l’origine de la cause du manque de confiance en soi dans ce domaine-là.

À partir de ce moment-là l’intelligence de l’énergie Reiki va agir sur la cause de ce problème et amplifier les efforts faits pour le transmuter.

Le soin Que je te conseille de pratiquer sur lui ;

– se fera sur la tête et la gorge en priorité au moins 15 mn, et ensuite tout le corps si possible si nécessaire ou s’il y a le temps, tous les jours jusqu’à ce que ça suffise.

Plus on est précis et plus on obtient des résultats rapidement.

Erreur commise par les Françaises et les Français en général c’est le syndrome du miracle ; vouloir tout régler d’un coup.

En attendant, je te conseille de commencer le soin par la prise cosmique durant 15 minutes minimum, puis 15 minutes tête et gorge, et terminer par les reins 15 minutes (qui sont le siège des peurs) Tu fais ça pendant une semaine tous les jours et tu me tiens au courant.


Un petit mot pour te dire que je viens de remercier l’univers de t avoir mis sur mon chemin. Ton enseignement… ta sagesse… et tout le reste qui constitue ton  » toi  » m’ont aidé à trouver mon chemin de vie. Depuis ma maitrise Reiki de belles choses me sont arrivées que je n espérais plus. Et bing…. elles entrent dans ma vie en me faisant rayonner de bonheur. J ai demandé à l univers de te renvoyer mes rayons de soleil et sans te bruler ! Namasté Dom Voila…. je souhaitais que tu le saches
Contres effets du Reiki ??

Cas de fatigue lors d’un soin Reiki à autrui ?

-Dom…​​C’est un des effets Reiki qui arrivent de temps en temps, dont j’ai parlé pendant le stage… mais il y a tellement d’informations pendant un stage…c pour ça que je les fais aussi en 4 jours maintenant..

N’arrête pas le Reiki sur toi-même ni sur les autres, car ce symptôme est encourageant, symptôme de guérison.
Pose toi au calme et, tout en faisant un soin Reiki sur toi, repasse en revue tout ce que tu pensais pendant que tu donnais le soin à ton amie ;
– quelles étaient tes pensées ? :
– Est-ce que tu voulais qu’elle ressente quelque chose ?
– Est-ce que tu avais peur qu’elle ne ressente rien ? 
– Est-ce que tu avais peur qu’elle ressente des mauvais effets ?
– Toi-même est-ce que tu as craint de prendre des mauvaises choses ? – – Est-ce que tu as craint d’être fatiguée, de t’épuiser ?
– Est-ce que tu te demandais si tu étais vraiment efficace ?
– Est-ce que tu pensais qu’en tant que débutante Reiki premier degré tu n’avais pas encore la capacité de la soigner ?….ect…

Avec ce genre de questions dans la tete tout en faisant un soin Reiki à autrui, sans t’en rendre compte tu utilise ta propre énergie et comme tu n’es pas magnétiseuse aguerrie (car c’est ça qui se passe ton propre magnétisme qui est utilisé dans ces cas-là en bloquant partiellement l’énergie du Reiki).
Le Reiki c’est l’amour inconditionnel, et le Reiki va laisser faire à la personne exactement ce qu’elle a besoin de recevoir, pour qu’elle apprenne quelque chose sur elle-même comme c’est peut-être le cas pour toi aujourd’hui… avec toutes ces questions toutes douces, inconscientes, des pensés automatiques qui vont faire que tu te sent fatiguée après avoir donné du Reiki – à TA façon, avec stress inconscient.

Lorsqu’on fait un soin Reiki à quelqu’un on se prépare correctement avant, comme tu as appris en stage, ensuite on pose les mains, on lâche prise et on sourit, on laisse couler le Reiki, de temps en temps on active le symbole et on sourit ; et surtout on ne fait rien, on ne demande rien pour la personne. Et prends bien note de ceci : on ne souhaite rien pour la personne ! Ça peut paraître égoïste, mais ça serait de l’illusion de croire que c’est égoïste. Pourquoi ? Parce que le Reiki ne nous appartient pas et lorsqu’on fait du Reiki à quelqu’un on laisse couler l’énergie et c’est le Reiki qui fait, ce n’est pas nous, ce n’est pas toi ; c’est une histoire entre le Reiki et la personne qui reçoit. Moins on en fait et plus le Reiki est efficace et plus on est rechargé soi-même. Et surtout après un soin Reiki boire un grand verre d’eau.

Une autre réponse possible : Il est possible qu’en ce moment dans ta vie tu ais besoin de repos, et peut-être que tu as un projet, ou que simplement pour aller de l’avant, pour avancer, aller au travail, ou autre activité…  peut-être que tu te sens un peu découragée, les jambes lourdes, fatiguée pas motivée….. et que le Reiki ai activé ces mémoires là, pour te dire  » regarde tu as besoin de repos et de te remotiver !!! « … 

C’est ce que l’on appelle « se prendre en main », en toute sécurité en se faisant du Reiki au quotidien, et en en faisant aux autres en lâchant prise et en souriant.
Fait toi une séance de rééquilibrage des chakras et pendant ce temps médite sur ces questions……et tiens moi au courant.

– H…Merci pour ta réponse . Effectivement, pendant le soin j’ai souhaité que cela fonctionne et qu’elle se sente mieux . J’espère retrouver rapidement vitalité car j’ai le corps qui est épuisé. Belle journée…H… 


​​ Le 19 mai 2017 à 15:25, Fv…. <fv….@…..com> a écrit : Je suis devant mon ordi et tombe par hasard sur les photos de notre formation Reiki KOMYO à Planete Reiki… bon souvenir … alors j’en profite pour te faire un petit bonjour du cœur ! et te dire que je ferai le niveau 2 à l’automne vers le 20 novembre de mémoire… Par ailleurs… je ne peux pas faire le niveau 2 le samedi et le 3 le dimanche : je dois attendre le printemps pour le 3 c’est bien ça ? J’espère que tu vas bien et passe le bonjour de ma part à ceux que tu croises à tes ateliers de partage ! Au plaisir de te lire, Amicalement, F…..

– Dom…Bonjour F…oui effectivement, le niveau 2 est quand même assez conséquent et il conviendra d’attendre entre six et neuf mois, le temps que les énergies, les symboles et les techniques que tu vas apprendre à utiliser fassent leurs effets sur le mental l’ego et la conscience, avec l’intégration des changements dans ton environnement et tes relations (changements liés aux effets Reiki pour toujours plus de bonheur pour soi et pour les autres), mais faut prendre le temps de changer les habitudes, même si le Reiki aide à cela… on a jamais rien fait de bon dans la précipitation ! Même avec le Reiki Usui Komyo Planete Reiki !
Mais je te garantis qu’avec le niveau 2 du 25 novembre tu vas te régaler ! N’oublie pas en octobre d’envoyer le bon de réservation pour officialiser, ou m’envoyer un mail si tu préfères.


​​- J…A part ça, côté news perso… J’ai bien plané pendant 2 semaines après ce stage de maitrise Usui !!!.. C’était trop bien. Par contre, côté rêve… Quel souk ! Même avec le dico des symbole, je rame… Mais je rame ! 

– Dom…Achète le livre de Pierre Fluchaire « la révolution du reve » ! Et ; étudie le, comprend intègre et applique, tu verras c’est merveilleux d’apprendre à mieux se connaître en interprétant correctement les rêves.

– J… Semaine dernière, ma soeur m’a appris que notre neveu nouveau né de un mois serait malade de la mucoviscidose. ( du coup… J’ai atéri un peu ) Je mets au conditionnel, parce que nous n’avons pas d’éléments concrets, et ma soeur qui est en panique n’arrive pas à nous parler. J’ai demandé à notre groupe reiki 4ème degré de leur envoyer un soin à distance, pour les soutenir emotionnellement.

– Dom…Envoyez beaucoup de Reiki à la mère, et faire en sorte que l’enfant puisse consulter un « Psychologue thérapeute psycho émotionnel et psycho corporel », et entame un processus de développement personnel afin qu’il apprenne à s’exprimer, à exprimer ses émotions et sentiments ses ressentis afin qu’il puisse réussir à établir clairement ses propres choix.

À mon avis la mère devrait en faire autant car la médecine « générale » est assez impuissante pour endiguer ce genre de symptome.

​​- J…Cependant, je suis étonnée.. Mais je suis calme. Pas dans les débordements émotionnels que j’ai pu expérimenter. Je dois t’avouer que je suis surprise. Est ce que ça veut dire que mon nettoyage a bien avancé ? Ou que c’est le calme avant ma tempête cosmique intérieure ?
L’avenir nous le dira…

– Dom…Ça veut dire que tu maîtrises, tu te maîtrises, alors qu’avant tu te serais contrôlée. Voilà un des effets bénéfiques de « passer la maitrise Reiki Usui KOmyo Kai »

​​- J…Autre question… Est ce que je peux placer l’obsidienne œil céleste brute que je t’ai prise dans ma chambre ? ( sur une commode en face du lit) sachant que j’ai une géode améthyste pas loin sur le même meuble ? Pas de contre indication de compatibilité ?

– Dom…Aucune contre-indication

​​- J…Tu as un ouvrage à me conseiller en lithotherapie ?

– Dom…Choisi d’aller dans un magasin genre Fnac, mais avant, fais toi un envoie Reiki à distance pour être guidé sur le moment quand tu seras dans le magasin au milieu des livres ! Précise bien : « le livre Lithothérapie qui me conviend à moi personnellement. »

​​- J…Enfin… Que penses tu de la pratique du pendule ? Mon amie Francine, praticienne reiki m’a dit que Nita Mocanu l’inclu dans ses enseignements.

– Dom…Ça ça m’étonnerait beaucoup… hihihi….c’est pas écrit dans ses manuels…..
​​- J…Du coup, si c’est le cas, comme c’est pas inclus dans ton enseignement, est ce que je peux te demander si tu as des réserves  sur l’utilité du pendule ?

– Dom…Tout est bon, il suffit d’apprendre à le faire, à mettre en pratique, de voir si ça convient, et l’essentiel toujours ; obtenir des résultats. Sinon on abandonne. Mais il y a une loi naturelle qui dit ; il faut essayer au moins trois fois avant d’abandonner ou de continuer. Personnellement j’ai fait plusieurs formations Lithothérapie et radiesthésie, et de temps en temps j’utilise le pendule et j’obtiens des résultats, il m’arrive même de temps en temps de faire des soins avec. Mais le pendule c’est de la radiesthésie et donc c’est un métier ; et pour obtenir les résultats maximum, comme dans tout métier faut le pratiquer tous les jours tous les jours tous les jours. Mon métier c’est l’enseignement la transmission et le suivi du Reiki, comme je suis en train de le faire avec toi maintenant, et donc je n’utilise pas le pendule tous les jours tous les jours tous les jours, mais je me consacre au Reiki dans les multi dimensions tous les jours tous les jours tous les jours.

 ​​- J… Hugggg 

Bonne journée !!! Gros bisous !!!! 

– P… Merci pour les news suite aux marathons Reiki à distance qu’on a fait pour Marie-Noëlle et pour Gaalad. Je n’avais pas pleuré au stage 2ème degré mais là, j’ai pleuré…de gratitude. Merci à l’univers. Bien sûr, nous continuons…

– Dom… moi itou, de belles larmes d’amour….

– P… Un petit retour sur le formidable stage que nous avons vécu grâce et avec toi. Merci ! les merci c’est de l’amour, on peut en dire autant qu’on veut  !

Ouf pas d’effet boomerang ce coup-ci, pas de rage. En partant de Juvignac, j’ai passé deux jours avec l’impression d’un cône lumineux inversé sur la tête, à tel point que je me suis rendu compte qu’inconsciemment je me tenais la tête bien droite, pour éviter de faire tomber un chapeau imaginaire. La connexion du premier degré était très « terre », aujourd’hui, j’ai l’impression d’être connecté plus haut, si je peux l’exprimer ainsi, avec beaucoup de sérénité. En prime la sensation d’un effet pop corn sur mon aura : je la sens plus dense et plus au large, c’est très…confortable . Qu’il est diffficile de mettre des mots sur des ressentis, je manque de vocabulaire. 

Le reiki, c »est merveilleux, c’est magique : avec le premier degré, j’avais reçu beaucoup sans penser que l’on pouvait recevoir encore. Au 2ème degré, c’est que du bonheur, c’est cadeau ! je suis impatiente et enthousiaste de la suite car maintenant je sais qu’il y a encore et mieux.

– Dom…profites bien des 9 mois voire un an du travail patient avec les techniques Reiki 2 apprises ! Le 3 sera alors vraiment différent, et….surprises !

– P… La nuit après le stage, j’ai rêvé d’un grand voilier qui voguait mais dès qu’il s’est arrêté à quai, il a coulé doucement sans explication…

– Dom…il te montrait une certaine stabilité émotionnelle lorsque tu navigue avec le divin, la relax, les états méditatifs, mais que tu peux en revenant à quai du quotidien boulot metro dodo frigo impo , couler…..!
Message ; restes connecter en tous lieux et circonstances ! D’ou l’envoi à distance au quotidien chaque matin avec ou sans quartz et les 5 Principes matin et soir….minimum ça. c’est l’anti coulage garanti

– P… Comme je n’avais pas bien compris (il m’arrive d’être lente),  le jour suivant en repartant en moto avec Marc, on s’est arrêté à un stop au bord du lac du salagou et…on a versé sur le côté, la moto d’abord et nous avec : Marc et moi aucun dégât (à part l’amour propre de Marc… LOL… et la moto pas grand-chose, j’ai même eu l’impression que l’on m’avait déposé doucement sur l’herbe : ok ce coup-ci nous avons compris, plus question de stagner, de tergiverser, on avance !

Comme j’ai essayé de l’exprimer à la fin du stage, avec le reiki, je suis chez moi. J’ai tenté pendant une quarantaine d’année de me convaincre que ce que je ressentais n’étais pas réel, le monde qui m’entourait me disait tous les jours que c’était des réactions d’enfant, qu’il fallait « grandir » et pourtant une toute petite voix disait le contraire ! Ceux sont des années à se croire décalée, bizarre, à chercher sa place et n’en trouver aucune. Et là maintenant, je sais que c’est réel, je peux me faire confiance, croire mes intuitions, mes petites voix, mes rêves…et utiliser mes « pensées magiques » sans culpabilité. C’est libérateur !Merci l’univers et le Reiki. eBisous à toi de nous deux.
– Dom… Merci de ce beau partage, je t’en souhaite encore comme ça chaque semaine. je vous embrasse fort vous deux !


Fatigue lors d’un soin Reiki à autrui

– M… Comme tu nous l ‘a conseillé lors du dernier stage je me suis fait un traitement me visualisant au travail. Il faut savoir que le week-end nous sommes en effectif réduit pour le mm travail qu’en semaine… Je me suis donc visualisée dans mon service, seule pour 13 résidents( Alzheimer ). J’ai demandé à ce que ma journée soit sereine, calme et sans stress. La journée s’est divinement bien passée, les résidents ont été calmes, l’équipe de l’étage est venue m’aider au moment du coucher ( chose qui ne se fait que très rarement, habituellement, chaque équipe reste dans son service, c’est un peu chacun pour soi) Idem pour le lendemain. J’ai remercié l’équipe de ce beau week-end. et bien entendu Merci Reiki !!!
J’ai maintenant une question concernant un soin que je vais pratiquer jeudi après-midi.
Un collègue de travail, infirmier, donc mon supérieur hiérarchique, est en dépression depuis un an. D’après ce qu’il m’a dit, il a tout perdu, se retrouve dans un logement de fonction tout petit ( une pièce). Il est en détresse totale. Je lui ai proposé de lui faire du Reiki en lui demandant d’abord s’il connaissait le Reiki. Il m’a répondu en me demandant combien je devais donner d’argent à cette association pour pratiquer….J’ai dû lui expliquer que je ne faisais pas partie d’une secte,et je lui ai dit « d’oublier ma proposition, que le moment n’était pas venu pour lui ». Un peu plus tard dans la journée, il est revenu vers moi, (et c’est là que j’ai compris qu’il était en très grande attente), il m’a demandé mon n° de tél., je lui ai conseillé d’aller chercher des informations sur Internet à La Fédération Française de Reiki pour comprendre réellement ce qu’était le Reiki. Cela s’est passé dimanche. Lundi, il m’a appelé, il est ok pour un soin, nous avons prit rdv pour jeudi après-midi, il va venir chez moi. Ce qui me préoccupe, c’est que je le sens très en détresse comme je te l’ai dit plus haut, très en attente. Et moi, là-dedans, j’ai un stress : si le soin ne lui apporte pas ce qu’il espère… Tu nous as dit que l’on ne doit rien attendre en retour, que l’on fait le soin, et Reiki fera le reste…que l’on doit être confiants. Je suppose que je vais devoir renouveler le soin plusieurs fois, qu’il devra revenir plusieurs fois…S’il n’y a pas de résultat pour lui, vu sa très grosse attente, je crains de ne pas être prise au sérieux.Je te remercie, Dom de prendre du temps pour me rassurer (car, je crois que c’est de ça dont j’ai besoin).

– Dom … bonjour Maryline, merci pour tes messages et bravo pour cette belle sychronicité avec les « collègues » du dessus !!! concernant ton appréhension…..facile : fais toi un traitement mental, la technique avec SHK du 2ème degré que viens d’apprendre à Planete Reiki, avec par exple : » AA, lorsque je donne un ou des soins Reiki, je suis calme, détendue, sereine et en paix, mon canal Reiki est ouvert et puissant, il arrive ce qui doit arriver, tout est amour, tout est bien pour tous. Merci ».

Et tu l’amplifie avec un envoi à distance pour toi : tu copie la phrase avec les 4 symboles sur le papier….facile non ? Bon Reiki ! Et les résultats n’appartiennent qu’à l’Univers ! 

— M… Merci pour ton conseil du 13 juin en ce qui concernait ma peur de ne pas être à la hauteur du soin que j’allais pratiquer sur mon collègue de boulot. J’ai été détendue, sereine. Je n’ai pas été fatiguée. tout s’est très bien passé! Merci, Merci, Merci.

bonjour,Un grand merci pour ses belles photos que nous transmet après les stages, elles sont très représentatives des émotions que  j ‘ai vécu lors de ce stage Planete Reiki , la rencontre de belles personnes. Merci. Du coup je profite de l occasion pour me lâcher, (je suis pas sûre d’être capable  de te le dire en face )   Je remercie l ‘univers de t’ avoir mis sur mon chemin parce que tu es une très très belle personne, humble , en retrait mais en même temps très présent , ton énergie est envoûtante mais pas manipulatrice, apaisant et stimulant en fait tu es le yin et le yang à toi tout seul parfaitement équilibré….(bon stop …trop de compliment tu le compliment) encore merci merci d ‘exister.  bonne journée,  om shanti.

Suite à un premier stage karuna niveau 1

– U… Bon j’ai fait un rève qui m’a perturbé cette nuit dis-donc, et je n’en comprends que des bribes, le voiçi.

Je suis dans une maison un peu sombre que je ne connais pas avec les enfants, et toutes les pièces sont en travaux, quand je dis en travaux, je veux dire que je sais qu’il va y avoir des travaux, mais que chaque pièce est détruite avec un amas de briques au milieu.

Je descends des Escaliers (remplis de briques sur les marches aussi) et je vois qu’il y a de la lumière en bars de cet escalier.

Là, j’arrive dans la maison où j’ai grandit, une ferme. Nous sommes tous endormis et je suis réveillés par les cris d’une tribu d’indien ( tu sais les bruits que l’on faisait pour immiter les indiens quand on était petit en tapotant notre main sur la bouche). Là je me lève et je vois , par la fenétre, beaucoup  beaucoup d’indiens sur leur cheval, ils galopent comme des fous et font très peur à un troupeau de vaches qui s’échappe et s’enfuie pour se cacher dans une autre pature pas loin de chez moi.

J’ai trés peur qu’ils viennent vers nous, et je n’ose pas réveiller les enfants,je ne veux pas qu’ils aient peur, et pourtant, je ne suis pas sûre qu’ils soient en sécurité.

Et je me réveille.

– Dom… le reve semble signaler une réserve (..sic…indiens….) d’agressivité et des éléments dans ton émotionnel un peu écroulés, des mémoires anciennes de l’enfance concernant la matérialité, les besoins vitaux ( soutient affectif, encouragement, reconnaissance…)…..des choses qui dormaient en toi depuis l’enfance…..tu es effectivement en travaux ; diverses initiations Reiki, lithothérapie, …ect. Cette agressivité lointaine écarte tes nouvelles aspirations spirituelles qui veulent grandir en toi….mais elles » restent à coté », elles ne sont pas « supprimées » mais tout de mm pas complètement « actives ».

 – U… Il faut que je te dise que ce Karuna (bien que tu ai dit qu’il était doux) m’a bien secoué.

Je suis très en colère depuis les initiations et je ne trouve pas la raison profonde de cette colère. Aussi j’ai souvent envie de pleurer, ça vient comme ça sans prévenir.

– Dom… Accepte, ne refoule pas…active Rama pour y voir plus clair et un papier vers l’Archange de Rama. pleure sans raison, ça fait fondre la glace ds le cœur….le sentiment de colère vient de frustrations, scanne toutes tes frustrations et note les sur un cahier…..puis applique leur,  l’une aprés l’autre la technique Reiki Usui ou/et Karuna appropriée .  Patience et persévérance.

– U…Bref je ne sais pas si le rève est lié,

– Dom… devine !!!???!!!

 – U…mais ce qui est sûr c’est qu’il y a comme un chamboulement en ce moment que je ne comprends pas. Usui ne m’avait certainement pas fait ça!!!

– Dom…surement un travail profond qui n’avait pas été fait. Travail intérieur pas fait en toi, ou que tu n’étais pas suffisamment prete et que l’es maintenant initiée Karuna….quoi qu il en soit, faut accepter ce que la vie nous montre à faire….aprés, tu sera libre la dessus.

– U…Éclaire-moi, mais seulement si tu en as le temps Dom.

– Dom…Pour l’envoi a distance avec Rama et L’Archange prends un Quartz rutile ou/et un quartz mandarine pour dissoudre et mieux comprendre la colère couplé d’un Diamant Erkimer et additionné d’un grenat…car ils travailleront en mm temps sur tes mémoires Akashiques.


Soin sur soi, et soin à distance à soi 

Le 5 février 2017 à 19:56, B…. <B…..@….fr> a écrit :Hello Dom dit moi j’aurais besoin de tes lumières sur un angle d’attaque en soin pour moi. J’ai un passé de quelqu’un de pas mal angoissé lorsque je me retrouvais dans un endroit que je ne connaissais pas ou dans une situation que je ne maitrisais pas. Evidemment ca va beaucoup mieux depuis que j’ai fais avec toi les 3 niveaux Reiki Komyo,  mais suivant la vie de tous les jours etc j’ai tendance à « rechuter » tous les 3 ou 4 mois par exemple et systématiquement je fais un passage chez ma kinésiologue. Alors c’est cool on travaille sur pas mal de point mais j’aimerais au bout d’un moment pouvoir me dire que tout va aller bien. Genre ; Novembre décembre janvier au top, et depuis 1 ou 2 semaine de nouveau je refais face à certaines angoisses de « je connais pas » ou la dernière fois à cet endroit je n’ai pas été bien donc mon cerveau est conditionné à « je repars à cet endroit boum je sens que ca monte et je passe des journées de m…. )

Et du coup lundi dernier passage chez la kinésio et bizarrement j’ai l’impression que cela a eu moins d’effet que d’ab comme si je devais prendre le problème autrement. Mais comme c’est pour moi – et non un soin à autrui… –  j’arrive pas à trouver un bon angle d’attaque. Si tu as des idées je suis preneur, Question soin et soin à distance.

– De : dom jeambrun <contact@planete-reiki.fr : B… <b…@…..fr>  Envoyé le : Jeudi 9 février 2017 13h39 ebjet : Re: Question soin et soin à distance​​

Salut B…je vais essayer de te sauver la vie…L’angoisse n’est pas une émotion. C’est un signal.

L’angoisse agit comme une soupape de cocotte-minute : quand la soupape tourne et siffle c’est pour te signaler que ça chauffe et qu’il y a de la pression. À chaque fois que tu vas dans un lieu et que tu angoisse : ça veux dire qu’il y a une peur que tu ne vois pas ! qui te mets la pression ! La question à se poser sur place, en rentrant en soi : « de quoi j’ai peur ? » Tu peux faire une introspection rétroactive ; c’est-à-dire en méditation trouver de quoi tu avais peur dans les conditions et les situations où tu angoissais ! Et à partir de la ; trouve la recette Reiki Komyo la mieux appropriée !

Boîte de réception x
11 févr. (Il y a 2 jours)    

Hola!!! Bon après introspection questionnement familial etc j’ai trouvé l’émotion en question. Grossesse de ma mère à 6/7 mois , elle a eu une phase très anxieuse et stressé du à des problèmes financiers au niveau de mon père et grand père paternel. Gestion des huissiers car blocage des comptes etc. Donc elle m’a dit « j’ai passé une phase vraiment pas bien ou j’arrivais pas à me détendre et me laisser aller, en plus de devoir gérer toute cette partie financière + la partie vie privée etc. »

Merci Maman pour le cadeau je comprend pourquoi j’ai du mal à lacher prise et pourquoi je ne suis pas bien quand je ne maitrise pas une situation ou que je ne connais pas l’endroit ou je vais … !!! Bon on va traiter tout cela, j’ai fait un super papier (merci la haut)  J’ai même senti un truc bizarre en écrivant le papier comme si j’avais trouvé l’émotion que je cherche depuis des années! Bon week end!!!!!


Avoir froid

Le 8 février 2017 à 21:48, M <M…..34@……com> a écrit :Coucou…Petite question ; est ce normal j’ai froid en ce moment plus que d’habitude est-ce normal. Merci pour la réponse.

– Dom …Le 16 février 2017 à 12:42, dom jeambrun <contact@planete-reiki.fr> a écrit :Cc….le froid est représentatif d’une difficulté à vivre la solitude. Donc l’énergie du Reiki te montre une piste de travail ; méditation/guérison de ce malaise intérieur…Généralement le froid de la solitude vient du fait qu’il y a UNE partie de soi qu’on n’aime pas. Le but est de trouver quelle est cette part de soi ! Puis de mettre la recette Reiki adéquate en action afin de commencer à l’aimer, cette partie de soi !Je te recommande de pratiquer la prière « estime de soi » elle se trouve vers la fin du Manuel praticien niveau 1 de Planete Reiki.

– M… Le 16 février 2017 à 14:38, M… <M…34@…l.com> a écrit :Coucou…Merci beaucoup pour cette réponse. Je pense en effet que je ne m’aime pas assez, il faut que je travaille dessus. Bises à bientôt.

– M… Mail suivant…g vécu ça. Et g trouvé, à l’époque, où je ne m’aimais pas : je n’osais pas affirmer mes opinions face à ma compagne. Donc je me reniais, je renonçais a m’affirmer pour ne pas la décevoir, pour ne pas qu’elle se fache de crainte de la perdre. Puis, de là, g réalisé qu’enfant ma mère m’interdisait ça ! : affirmer mes opinions face à elle, face aux parents…..


Coucou Dom, j espère que tu vas bien depuis le stage 1er degré Reiki Unité ! Super pour le deuxième degré on sera tous ensemble c est cool de pouvoir parler de nos expériences et notre évolution avec les mm personnes rencontrées. Ma cicatrice est fermée, oui oui ! , je n ai plus que des croutes en superficie, les infirmières ont halluciné !!! J ai fait un « premier vrai soin » a une copine, elle m a parlé de ce quelle a ressentie pendant le soin : douleur au niveau cou, épaules et omoplate ; froid au même niveau haut du buste, quand j étais sur la gorge j ai senti des picotements différents des autre parties du corps. Au niveau d un pied elle a senti comme une décharge et un froid qui suivait  la colonne vertébrale.

– Dom… Bonjour L…Dans des cas comme celui-ci faut continuer le soin car le Reiki a fait remonter des tensions dont ta copine ne s’occupait pas, et le froid ressenti correspond sûrement à une difficulté à vivre la solitude, ou un sentiment de se sentir seule, peut-être incomprise, peut-être un état de manque…C’est très positif cette réaction en Reiki ; cela s’appelle symptôme de guérison…Continue de lui faire du Reiki et au bout du troisième soin elle se sentira beaucoup mieux, transformée et apaisée…Exactement comme des cicatrices !


-S… Question pour apaiser quelqu’un d’angoissé,  mon fils (qui a 14 ans) et j’ai pensé que 30 minutes devait suffire non? qu’en penses-tu?

– Dom… selon la durée du soin, sur un ado comme sur un adulte, les ressenti de la seront plus fort plus le soin sera long….D’autres parts ; les effets seront plus évidents et durables si les soins sont quotidiens….et bien entendu si les soins quotidiens ou quasi quotidiens sont moyennement longs ou longs, le mental sera apaisé plus en profondeur avec des effets sur le corps insoupçonnés de dynamisme et de vitalité. De paix.


Bonjour Dom,Merci à toi c’était fantastique ce stage 2ème degré sur 4 jours, et je ne me suis jamais senti aussi serein de ma vie que depuis ces 4 jours, une douce sensation de sérénité m’ enveloppe depuis alors que le premier degré m’avait fait, je pense, ressortir mes peurs, mes colères liées à mon attachement aux autres en général et à une personne en particulier, je ne parvenais pas à comprendre que tout est juste, tout est absolument parfait, le «négatif» comme le positif…

Je n’en reviens pas, et ceci n’est que le début d’une très belle aventure j’imagine… Merci du fond du cœur pour ces précieux enseignements quantiques et des lois de l’Univers et ta façon merveilleuse de nous le transmettre.


Cher Dom,    Du fond de mon cœur qui s’est remis à battre, et qui n’a jamais été si plein d’amour, je te remercie avec une gratitude sacrée, pour ces miracles de Vie et d’Amour que tu opères autour de toi. Quelle magnifique voie tu as choisie et avec quelle générosité attentive et aimante tu t’acquittes de cette Mission : redonner Vie à tes frères et soeurs éprouvés par la routine, la négligence, et la souffrance. Avoir attendu 55 ans pour naître enfin à cette merveilleuse aventure de se construire soi-même avec ce qu’il y a de plus beau pour grandir dans l’Amour ! Toute cette première journée de ma vie après le 2ème degré, j’ai éprouvé avec intensité, la patience, l’indulgence, le partage, dans des situations professionnelles qui auparavant me semblaient pesantes, d’un poids parfois écrasants, et qui maintenant sont des occasions de grandir dans la conscience de la voie que ton enseignement et ton exemple m’inspirent. Je viens de finir un envoi à distance pour protéger Véronique qui est partie, dans la fraîcheur de la soirée, récupérer nos chiens dans les Alpes et que je ne pouvais accompagner car je travaille demain. Au terme de ce beau rituel que j’accomplis avec maladresse certes (un oeil sur le livret) mais avec une infinie confiance, j’ai terminé ce profond moment de recueillement avec ces mots : Merci Reiki, Merci Mikao, Merci Dom… J’ai voulu te les adresser aussitôt mais je pense que tu les avais déjà entendus dans ton coeur qui est immense.

                  Je te souhaite une excellente soirée et t’assure de mon affection et de ma gratitude…                                          M……


De : L <@gmail.comSujet : Ressenti sur le chemin du retour le 28 au soir. Corps du message :
Bonsoir Dom, Pendant le trajet du retour de ce deuxième degré Reiki en quatre jours, je me suis sentie apaisée comme je ne l’ai jamais été. Je me sens merveilleusement bien. Je rayonne de bonheur…Je suis pleine de gratitude envers toi et Véronique qui nous avez enseignés avec autant d’amour. Et envers les Maîtres de l’Univers, et mes Anges Gardiens qui m’ont dirigée vers le Reiki. Il me reste beaucoup de travail avant de pouvoir m’exprimer avec facilité et de pouvoir remercier avec effusion comme l’ont fait hier soir mes co-stagiaires, mais je ne désespère pas …j’ai maintenant les outils pour y arriver. Grâce à ton enseignement, je vais pouvoir me sentir en harmonie avec moi-même…Je vais pratiquer, pratiquer comme l’a dit Violette. Je me sens légère, détendue, et très reconnaissante. Merci, Merci, Merci!
J’entrevois même de pouvoir peut-être faire le 3ème degré dans 9 mois.
Malgré le fait que je sois en retrait, je me suis sentie accueillie dans le groupe, il y avait beaucoup d’amour, de bienveillance. J’ai pris du plaisir à partager . Merci Reiki. Merci Dom. Merci à Véronique, ta Collaboratrice enseignante.carapace-Émotionnelle-Alcoolisme

Comprendre le Karma à travers les états émotionnels.

La loi du Karma est un cas particulier de la loi de causalité.

La loi du karma est un cas particulier de la loi de causalité, selon laquelle toutes nos actions du corps, de la parole et de l’esprit sont des causes, et toutes nos expériences leurs effets. (Extrait du livre Transformez votre vie par Vénérable Guéshé Kelsang Gyatso.)


Karma or not Karma

D’une manière rationnelle, objective, je compare le karma à l’astrologie, au thème astral. Ils se ressembleraient en ceci ; deux outils majeurs pour une meilleure connaissance de soi. L’un comme l’autre pourraient se traduire ainsi ; plan du destin, ou carte du destin.

Je ne dirais pas qu’il y a un destin tout tracé, mais il y a un but. Notre vie à un but personnel. Et pour atteindre ce but nous avons le choix d’une multitude d’itinéraires. Certains itinéraires sont faciles, d’autres plus difficiles. Certains particulièrement difficiles, voire dangereux. Et d’autres chemins, si on prend la peine de les lire, nous démontrent qu’ils nous sont – pour l’instant – inaccessibles, qu’on a besoin de travailler et de travailler sur soi, et de se former encore et encore pour y avoir accès.

Certains traduisent le mot karma par dette. Pourquoi pas. Cependant il ne convient surtout pas de prendre ce mot, dette, de manière sociale, c’est-à-dire comme quelque chose que l’on doit payer, ou comme une punition. Un Blâme. Surtout pas.

Une dette karmique est un cadeau.
C’est l’opportunité, la chance de pouvoir réparer une erreur, ou une expérience ratée dans le passé. Une 2ème chance ! Je l’explique plus loin.

            Nous venons du monde de l’esprit, le monde bouddhique.
            Le corps est la matière.
            Sans l’esprit le corps ne peut pas exister.
            La terre est la matière.
            La matière terre et le corps sont les éléments et le lieu où en tant qu’esprits nous venons expérimenter notre personnalité (etre soi) à travers les émotions et la                   réactivité à ces émotions.
            Et dans la difficulté !


J’ai dépassé mon Karma !

Par exemple ; si quelqu’un m’insulte et que je me vexe, que je m’énerve, que je me sens humilié, que je l’attaque violemment, cela s’appelle réactivité émotionnelle.
Si cette même personne me complimente et que je me sens aimé, beau, utile, et que je ressens mes valeurs vibrer, et que je lui exprime ma joie, cela s’appelle aussi réactivité émotionnelle.

            Si j’ai atteint une maîtrise de moi-même ; intellectuelle, émotionnelle et spirituelle, je réagirais à l’insulte comme au compliment de la même manière ; en restant calme et posé. Posé au centre de moi-même : entre les chakras du bas – les besoins – et les chakras du Haut – la conscience et la spiritualité = l’esprit – et je resterais là, posé au centre : dans le chakra du cœur. Et j’accueillerai les deux situations avec amour. Seul l’amour saura répondre à l’un ou à l’autre – au négatif ou au positif – d’une manière juste. Equilibre.

            Si je réagis violemment à une insulte, c’est que inconsciemment c’est peut etre une mémoire karmique qui se réveille, qui se réactive. Pour le savoir, ou au moins pour ressentir ce qu’il se passe en moi, je vais me centrer une fois rentré chez moi. Je ferai une introspection méditative pour savoir : « comment ça se fait que je réagisse violemment à cette insulte ? ».

Car si socialement c’est normal de réagir ainsi, spirituellement c’est anormal.

En faisant une introspection je peux par exemple découvrir que je ne m’aime pas assez dans un certain domaine, que je manque de confiance en moi dans certains contexte, et que si quelqu’un vient appuyer sur cette fragilité : ça me fait réagir violemment. Parce que ça me fait mal à ce que je cache – ou/et qui m’est caché dans l’inconscient. La personne qui insulte cherche à faire mal n’est-ce pas ?

Et la personne qui complimente cherche à faire du bien, n’est-ce pas ? A aimer, n’est-ce pas ? Et donc quelle sera ma réaction ? la même chose ; rentrer chez moi pour faire une introspection, me permettre de comprendre que j’ai encore besoin d’être aimé dans un certain domaine ! Et en conclusion si j’ai besoin d’être aimé c’est que je ne m’aime pas, je n’aime pas « une partie de moi ». j’aime beaucoup de chose en moi, mais pas celle là, celle qui se réactive de temps en temps.

Dans un contexte identifié ; je n’aime pas tel aspect de moi donc je réagis quand quelqu’un m’aime à cet endroit : il m’aime à ma place. Mais cela va-t-il durer ? Non, bien sur, un jour l’autre on ne m’aimera plus là ou j’en ai besoin….et les réactivités deviendront de plus en plus fréquentes.

Sûrement qu’une personne qui vit cela va remonter à sa petite enfance et retrouver des situations qui ont créé ce besoin, le manque d’encouragement et de reconnaissance avec les parents. C’est très classique, et assez vrai. Et il y a de grandes chances qu’en réglant cette situation mal vécue dans le passé, émotionnellement, cette personne guérisse et son présent en tant qu’adulte sera beaucoup moins réactif, voir plus du tout.

Quelque temps plus tard, mois ou années qu’importe, il est possible qu’une vieille mémoire plus intense se réactive pour permettre à cette personne de refaire une introspection du manque d’amour de soi, mais de manière beaucoup plus profonde, et peut-être découvrira-t-elle, puisqu’elle aura évolué depuis, que c’est à peu près toujours dans la même situation, que ce soit l’insulte ou le compliment, que se déclenche une réactivité. Souvent en couple, ou au travail, ou en public… c’est de cette façon – la réactivité à une chose qui nous dérange – qu’on identifie une mémoire karmique qui se réactive – ou qui est active.

La sous-estime de soi est très profonde dans la mémoire ; cellulaire, ADN, et signifie que la personne a un mauvais souvenir d’une expérience qui peut etre vécue dans une vie d’avant. C’est peut-être pas encore très précis pour vous ? Alors je vais tenter d’illustrer avec un exemple…

            Il y a un an j’ai contacté un de mes anciens professeurs. Je lui ai posé une question lui demandant son avis sur un sujet précis concernant notre profession aujourd’hui commune. J’ai fait cela par mail. Au lieu d’essayer de comprendre ma question et de partager d’un avis objectif, il s’est empressé de me faire des remarques subjectives, puis a pointé du doigt deux erreurs que j’avais faites du temps où j’étais sous sa coupe. Rien à voir avec le sujet. Les mails se sont multipliés et n’ont abouti à rien. Si ! Ils ont abouti à déclencher en moi de la rage. Cet ancien employeur à une grande renommée dans notre profession. J’ai cessé de lui répondre et pendant un an j’ai réfléchi, médité, prié avec les symboles Usui et Karuna, échangé avec mon guide Reiki afin de comprendre qu’est-ce qu’il se passait réellement en moi.
Car je ne voulais absolument pas lui répondre rageusement. C’était hors de question. Je comprenais qu’il jouait un rôle inconscient dans le but de me faire réagir afin que je m’interroge sur ma réactivité.

Et petit à petit…les réponses me sont arrivées. Par intuition, connaissance intuitive, en rêve la nuit, et souvent en fin de stage ou à la fin d’un atelier, à la fin de mon enseignement ; quand on donne on reçoit beaucoup.

Le résultat fut surprenant, édifiant ; J’étais rageusement jaloux de sa notoriété, une partie de moi ne pouvait se contenter, contentement, de jouir de mon propre succès. J’entends professionnellement. Je l’ai donc mentalement remercié de tout mon cœur, et j’ai remercié le ciel pour le cadeau qu’il m’avait fait ; régler une dette karmique ; remplacer le besoin de notoriété égoïste surement exercé dans une ou des vies d’avant.

Pourquoi ? Parce que mon but spirituel, et c’est le but spirituel de tous, mais nous ne le savons pas tous, le système éducatif enseigne autre chose…..mon but d’homme en conscience est le succès mais avec l’altruisme.
 C’est-à-dire que la réussite et l’abondance ne sont pas le but, le but c’est servir l’univers et jouir du succès et de l’abondance de façon détachée.

Or, cette confrontation avec un ancien professeur ayant la renommée et pas moi, cette confrontation m’a signifié que dans une autre vie j’avais eu la renommée et que je ne m’en étais servi que de manière égoïste. Une fois décédé et retourné dans le monde bouddhique, je pris conscience de mon erreur ; le succès la notoriété l’abondance mais sans amour.

Dans cette nouvelle incarnation je suis confronté à une altercation visant à « prouver à mon ancien professeur » que j’ai raison. Ce qui pourrait être interprété ainsi : « je ne m’aimerais vraiment que quand je serai reconnu par lui ; mon pair – mon père ne m’ayant pas reconnu ».

Il y a un vieux proverbe qui dit si tu as un ennemi, assieds-toi au bord de la rivière et un jour tu le verras passer, tu verras passer son corps noyé. Prie et laisse le ciel faire les choses.
Et c’est ce qui est arrivé. Pendant cette année où je méditais, je priais, je comprenais comment j’étais, comment je réagissais, et pourquoi ; je voulais qu’il me reconnaisse ! Et lui, au lieu de ça ; m’a rejeté. Ceci est aussi une vielle mémoire ; j’avais rejeté d’autres personnes moi aussi dans le lointain passé ; tout ce que tu fais on te le fera…..loi absolue de l’Univers.

Et c’est alors que j’ai pu constater trois erreurs professionnelles fondamentales commises par cet homme. Je lui ai donc réécrit un mail pour en prenne conscience, il s’est excusé.
Mais cela n’a pas provoqué en moi une grande réactivité, j’avais dépassé et purifié – non payée ! purifiée, nuance – ma dette karmique. Le résultat final et qu’aujourd’hui je suis vraiment mon propre élève, et mon propre maître. Je n’ai plus rien à voir avec lui et ses méthodes, c’est son karma plus du tout le mien. j’ai gagné dans cette histoire une meilleure connaissance de moi-même, donc un meilleur futur. Et une meilleure connaissance du fonctionnement des lois karmiques. Et des lois de l’univers au quotidien.

Je n’ai pu ariver à ce merveilleux aboutissement que grace à la connexion Reiki HSZSN et CKS avec mon guide Spirituel. Et en méditant les Gokais, particulièrement Gyo wo Ageme. Et Kansha Shite pour l’épreuve 2ème chance.

Un échange avec une stagiaire de Planète Reiki, sur les lois d’incarnation, le Karma.

– X… Après avoir médité tes paroles concernant les missions de réparations diverses selon les expériences de vies antérieures, j’ai déterré des leçons de vies assez intéressantes dans mon terreau familial. Quand tu as raconté l’histoire du roi qui siphonne les finances publiques, meurt et renait en Pape qui refait la même chose pour enrichir l’Eglise, et en réincarnation c’est une dette qu’il a pu être amené à retravailler à notre époque. Compte tenu de son passif, j’ai entendu une sonnette d’alarme résonner dans ma conscience.
Alors bon, j’ai médité dessus, et j’ai recoupé mes ressentis avec les expériences de vies familiales de ma mère, ma grand-mère maternelle, et mon arrière-grand-mère maternelle… J’ai trouvé de grandes similitudes d’expériences concernant certains domaines, dont financier. 
Je regarde avec mes brèves expériences dans ce domaine, je commence par rédiger une lettre symbolique… et pouf ! Voilà que ça débloque un premier nœud dans mon quotidien.
Je crois que je suis sur la bonne piste mais du coup j’ai une question : Une fois qu’on a mis à jour une problématique ‘karmique’, qu’on a mis au clair les ressentis qu’on éprouve en étant dans la position ‘victime’ de ce problème qu’on aurait soi-même généré dans une vie antérieure on fait quoi ?

Dom – il faut profiter de ce ressenti, bien vivre cet état émotionnel où l’on prend conscience comme tu le décris si bien, et…

– 1 accepter inconditionnellement cet état de conscience qui se révèle à soi. Avec SKSK par exemple.
– Ce ressenti est un langage corporel non verbal et avec toutes les émotions et les sentiments qu’il suscite à travers toi, l’offrir à l’univers comme un repenti des actes manqués (ne pas se juger ne pas culpabiliser car il s’agit de mémoire ancienne, et pour l’univers ce n’était que expérimentation).

– Il conviendra d’utiliser les techniques deuxième troisième ou quatrième degré Reiki voir Karuna, et la merveilleuse technique Reiki de changement et guérison du passé ; avec un bon cristal de quartz Aqua-Aura par exemple ou quartz Rutile, pourquoi pas les deux en même temps – car ces 2 quartz permettent d’amplifier un travail précis sur les vies antérieures – et poser à côté des quartz un morceau de Zircon, qui enlève les héritages Karmiques indésirables tout en créant un ancrage très puissant.

– Et par la suite rester éveillé !…pour bien comprendre les messages, les rêves, les intuitions et les élans, les états indésirables aussi car tout changement engendre le chaos, mais c’est un chaos Reiki ; donc que des cadeaux que l’on appelle symptômes de guérison. Et derrière se trouve la nouvelle vie !
Pour les pratiquants Karuna ; 1 – HSZSN + Zonar dans les vies passées = La Vie Passée qui engourdi ton Présent. (en chargeant un cristal élestial de préférence pour cet envoi à distance dans le passé avec Zonar = c’est SON quartz !)

2 – HSZSN + Zonar envoyé à l’Archange du symbole pour qu’il guérisse cette partie du karma…Ajoute une émeraude et invoque l’Ange actuel (jour de l’échange mail avec X…) ; 43, Veuliah…..HAHAHA ! drole de coïncidence non !!!?!  « Accumulation dérisoire d’argent et de bien…. »    MAIS ne pense qu’à la Vertu opposée : Prospérité Divine.

3 – 7 jours après = Halu en guérison à distance + séance avec Halu de négociation avec la partie sombre…

4 – en fonction des résultats = Traitement mental pour ancrer une nouvelle habitude… !


– X…….. Par exemple, je crois que je suis une femme spoliée par un mari ; mes ressentis me font vivre la chose ainsi, à travers mes filtres, au point que je crois réellement vivre cette situation, que du coup je génère et vis ainsi, et je me souviens que ma mère, ma grand-mère et mon arrière grand-mère ont vécu ça… et 400 ans plus tôt, j’étais peut-être ce mari qui dilapidait la dote de sa femme au lieu d’assurer la survie de son foyer familial … 

Et en même temps, cette femme que j’ai été/suis avait certainement un problème d’ancrage qui l’empêchait de gérer comme il faut ses ressources, peut-être avait-elle des difficultés à honorer ses responsabilités par elle-même (les femmes de ma famille s’en remettaient toujours à quelqu’un d’extérieur pour ces questions-là, et généralement elles y perdaient beaucoup par négligence et par crédulité), je me retrouve aussi dans ce cas-là.

Dom – c’est tout à fait ça ! Il y a la loi d’incarnation ; on revient pour réparer les expériences ratées, et dans ton cas il s’agit bien de la loi de cause à effet ; « tout ce que tu fais, aux autres, dans cette vie ou dans une autre vie on te le fera ! » Non pour te punir mais pour que tu ressentes ce que les autres ont  ressentis le jour où tu les as spoliés.

– X… – bref, une fois qu’on en est là, en plus de demander pardon en conscience pour avoir agi comme ça il y a 400 ans, après avoir fait un travail de pardon auprès de sa famille, et s’engager moralement pour agir différemment en tenant compte de cette expérience, y-a-t-il autre chose à faire pour réparer tout ça ? Ou bien, la prise de conscience suffit tout simplement à rétablir l’équilibre ?

Dom – la prise de conscience est très importante, elle est le déclencheur d’un changement. Ensuite tu te référa à ce que j’ai écrit plus haut ; pratiquer les techniques de changement et de guérison du passé.

– X… – J’ai beaucoup travaillé les énergies et avancé pour progresser chaque fois que des difficultés m’empêchaient de fonctionner dans cette vie, avec les repères propres à cette réalité, mais j’avoue que l’approche des vies antérieures reste bien mystérieuse pour moi… par contre, je sais dans mon cœur à quel point c’est vrai, à quel point tout cet aspect de la vie possède une dimension de vérité à part entière, à la fois ancienne et actuelle, chez chaque individu. 
Alors si tu es d’accord, je crois que j’aurai besoin de tes conseils avisés. Et je te remercie déjà pour tout ce que tu m’apprends parce que je fais des progrès énormes grâce à toi.
Dom – J’avance sur le cheminement spirituel au service du Reiki, au service des autres, et plus je constate par moi-même, par les ressentis du corps, en vivant les sentiments qui sont assortis à la vibration d’une prise de conscience karmique, je suis témoin de ce que d’autres auteurs ont écrit avant moi, j’en ai lu plusieurs sur le même sujet, et je vis je ressens cela ; la connaissance intuitive.

J’ai toujours cru à la réincarnation sans savoir exactement comment cela se passait, jusqu’à ce que je reçoive des messages puissants et subtils en claire audience, en claire perception, et en clairvoyance. Les ressentis du cœur ne m’ont jamais trompé. Ce que je lis dans certains ouvrages, je l’expérimente le plus possible sur moi, avant de le retransmettre. Et en le retransmettant je reçois de nouvelles informations, pour moi et pour les retransmettre… et ainsi de suite dans ce vortex d’amour de partage et de mystère.

Alors oui je suis d’accord et je répondrais à toutes tes questions, de mon mieux et un accord avec les lois de l’univers.

Ce n’est qu’un exemple de plus, il y en a des milliers, tout s’explique par la loi karmique. J’en parle dans mes stages et ateliers, au cas par cas, quand je sens intuitivement que ça peut utile à quelqu’un.
En pleine conscience je sais qu’en enseignant la Voie, je purifie mon Karma.

Voici un autre échange, d’un tout autre genre, mais qui peut aider à comprendre le comportement humain.
Mon Karma à moi

– V… : Je voudrais aider les gens décédés, et aussi aider pour les demande sur des intentions collectives, en fait, je pensais à une intention de paix par exemple. Je voudrais savoir comment utiliser l’énergie du reiki et CKR sur plusieurs personnes qui souffrent dans le monde. Mais peut être que le REIKI n’est pas approprié à ma démarche. 

 – Dom : Hummmm…attends d’avoir le niveau Reiki 2ème degré pour ça.
Comprends qu’il est bien plus important d’installer d’abord la Paix dans ton monde intérieur avant de vouloir l’installer dans le monde environnant. Tu agiras alors bien plus en puissance et en accord avec les lois de l’Univers.

Ai simplement des pensées d’amour pour l’humanité toute entière, ainsi que pour personnes décédées, et un regard de compassion pour les victimes et les bourreaux….
Beaucoup de gens veulent régler les problèmes des autres et fuient leurs propres problèmes, ce n’est pas dans l’enseignement de Mikao Usui.
Parfois en voulant « utiliser le Reiki dés le 1er degré pour aider ceux qui ne nous ont rien demandé » on se rajoute des distordions karmiques qu’il faudra nettoyer plus tard, ou de suite, ça arrive aussi.

Lors du stage second degré je te donnerais toutes les recettes en accord avec les lois de l’Univers pour faire ça correctement sans aucun risque pour qui que ce soit.

 – V… : Ta réponse concernant les êtres que je voudrais accompagner après leur décès et l’humanité souffrante en général me va bien. Elle me situe bien dans ce que je suis en ce moment et me correspond. Et tu as raison de me rappeler de veiller à mon karma.


Questions réponses Reiki, un échange, un partage.

Les Questions Réponses Reiki, FAC, un échange avec les praticiens Reiki, Usui Karuna et Komyo Kai.
Une Question = des Réponses.

question-reponse-FACNous ne sommes sur terre que pour apprendre, pas pour réussir.
Et c’est idiot, vraiment, de punir les erreurs et les fautes dans les écoles et dans la vie. Car c’est grâce à elles que nous apprenons. …mais tandis qu’on enseigne et pratique la voie de l’unité d’autres exigent la réussite à tous prix.  C’est le culte de la réussite qui est à blâmer, pas l’échec.

Octobre 2016

Kyste, hématome, les fesses…

Le 5 avril 2016 à 18:25, N…….> a écrit :

N – Depuis mon 3ième degré, ….il y a eu l’opération du kyste ovarien le 30 par célioscopie. J’ai eu quelques jours où j’étais  comme endormie, je ne réalisais pas que la vie m’envoyait des signes à décoder. Mais hier tout (enfin énormément de choses) s’éclairait, m’apparaissait. C’était un enchaînement sans fin. J’avais l’impression d’être noyée. Noyée: plusieurs heures après être remontée dans la chambre j’avais demandé si on pouvait enlever le carré de protection des draps car je me sentais très mal et sale. Quand je l’ai vu je me suis dit: c’est carrément un bain de bétadine! Déjà 2 idées liées: bain et noyade. Et après tout c’est enchaîné. Ovaire gauche, ablation d’un kyste, hématome énorme autour du nombril. Sans exagération, il a la taille de ma main avec les doigts écartés, l’infirmière en est restée scotchée. 2 ou 3 jours après, ma cicatrice d’appendicite c’est retrouvée elle aussi au milieu d’un joli bleu. Allergie sur la fesse droite, urticaire, démangeaison. On peut peut-être ajouter le refus de prendre une infirmière pour les piqûres plus que je me les fais moi-même alors que je n’en avais jamais fait. Je pense que j’ai fais à peu près le tour. C’est comme si la vie m’avait dit que je pouvais maintenant enlever ce kyste car je pouvais, j’étais capable, je devais… assumer, affronter, me libérer… Je n’arrive pas à mettre un mot précis pour décrire ce que je ressens. Bon je ne vais pas me relire pour ne pas changer les phrases et laisser tel que c’est venu. Je ne sais plus par quel bout y prendre. peux-tu m’aider ?

Dom – Je peux t’aider en le faisant comme si c’était pour moi-même. Personnellement je fais du Reiki et je laisse couler, mais pendant ce temps je demande à mes groupes Reiki niveau 2 niveau 3 niveau 4, à tous je leur demande de m’envoyer du Reiki à distance en leur précisant de demander au Reiki de M’aider à comprendre « quelles sont les causes dans l’esprit qui créent ces conséquences dans le corps physique ». 

Pendant ce temps je fais de la méditation sur un seul symptôme à la fois !
Par exemple ; un kyste ; c’est une boule de peine.
Comme un petit flocon de neige que tu vas pousser pousser rouler rouler rouler qui deviens une boule. Une pensée, que tu tournes en rond, que tu rumines, d’année en année et qui finit par devenir un boule qui suinte (liquide = émotions) . On l’appelle un kyste. 

Boule de peine : tendance à toujours se passer le même cinéma intérieur. 

Comme ce sont les ovaires, cela représente ta féminité. Ce kyste à l’ovaire est une réponse à une douleur de perte, ou d’une grande déception, concernant ton pouvoir de création (enfants OU projets). Il peut s’agir d’avortement, de la mort d’un enfant, une séparation, de la mort de son enfant ou de la difficulté à enfanter ou à mettre en route un projet qui te tient à cœur, ou qui t’a tenu à cœur. Parfois on voit passer des années et on peut craindre de ne plus pouvoir avoir d’enfants ou un second si tel est le souhait…

Est-ce que tu te désoles parce que tu n’arrives pas à devenir enceinte ou à  réaliser un projet qui te tient à cœur ? 

  • Mets cette phrase présente avec un quartz : « je me réjouis de ma féminité. J’adore être une femme. J’aime mon corps. » ou suis ton intuition.
  • … Encore une autre,  tu peux faire les deux ou alterner « je me réjouis d’être qui je suis. Je suis une merveilleuse expression de la vie, qui coule parfaitement et sans cesse. »

Les fesses : représentent le pouvoir ; s’asseoir sur son trône. Elle peuvent représenter aussi l’inactivité, le repos ; allez pose ton Q, souffle respire médite… détend toi. 

Dans l’allergie urticaire, la démangeaison à ce niveau-là, à mon avis, représente quelque chose qui te tarde de faire, (ou tu insupporte d’être oisive à l’hosto)  ou te tarde d’avoir ton propre pouvoir, ou alors de t’asseoir de te reposer…

L’urticaire par contre serait liée à une personne de ton entourage qui t’énerve qui t’agace et qui n’était pas prévu qu’elle serait comme ça et qui devient supportable ; toujours concernant le symbolisme des fesses. 

Hématome (de savoie… lol…) : c’est une accumulation de sang suite à un choc ou un accident et sont donc reliés à de la culpabilité puisque l’accident s’est de l’autopunition/autodestruction. Comme l’hématome se situe au niveau du ventre, du nombril : le plexus solaire ; la personnalité. À mon avis il doit y avoir une culpabilité concernant les causes des kystes ovariens… tu me diras si ça te parle. 

Tu es en période d’initiations et ces symptômes ressortent parce que le Reiki te dit qu’aujourd’hui tu es prête pour les régler. Avec des années de retard à rattraper. Les deux phrases que je t’ai données devrais être efficaces ; en envoie à distance pour toi-même, et la première en traitement mental jusqu’à ce que tu sentes que tu deviens toi-même. Dans cette vie, dans cette incarnation tu es venu dans un corps de femme ; ton devoir spirituel, ta mission divine est d’incarner la femme dans tous ses états. Même si cela doit passer avant par des réparations. C’est pour cela que la première phrase correspond tout à fait. En acceptant que le Reiki te donnera des leçons, d’autres choses à nettoyer, ton chemin va alterner entre ronces pelouse pâquerettes, des plages ensoleillées et des orages, pour aboutir finalement un jour ou l’autre dans la réalisation de toi-même ; en accord avec les lois de l’univers, dans l’amour la joie et la satisfaction.

Migraines récurrentes

Suite à la séance consultation sur mes migraines à répition et ta façon d’orienter ma façon de voir et de penser, j’ai pris quelques jours et j’ai décodé des fonctionnements de cause à effet et une grosse migraine qui m’a clouée au lit hier pour la journée a confirmé ton diagnostic.
Merci pour ton éclairage…


J’ai encore fait un rêve cette nuit avec mes voisins. Je te passe les détails, mais à la fin, j’ai ressenti (dans le rêve et pour de vrai) de la compassion pour ma voisine qui avait un petit problème physique, je l’ai écoutée et rassurée, et je l’ai vue repartir en marchant sur le trottoir en face de celui où j’étais, elle était toute guillerette, contente que je m’intéresse à nouveau à elle, et dans de très bonnes dispositions à mon égard…. Ça devient bon !!!  merci pour ton éclairage !

Retour de stage KARUNA
je veux te remercier de tout mon cœur pour ce fabuleux stage karuna…..je sens kil s’est passé kelke chose en moi d’extraordinaire….comme un sentiment d’avoir trouvé les clés ki ouvrent tous les cadenas de mon ètre (j’en ai des frissons en te le disant !!!)…les symboles karuna et leur signification me parlent énormément…différemment du reiki usui et du reiki komyo Kai….comme si je venais de trouver LA solution !!!!
d’habitude kan je rentrais de stage le soir, je me posais et après j’attendais le lendemain pour me replonger dans ce ke nous avions vu….et hier soir, non !!! je me suis posée, mais j’ai senti ke je devais me rapprocher des symboles de suite…comme une urgence….et avant de m’endormir, j’ai eu une image : tous les symboles karuna étaient derrière une porte fermée, en trépignant d’impatience…alors, je leur ai ouvert la porte et ils se sont mis à danser, comme pour montrer leur joie…..et ce matin, je me sens très bien, différente, apaisée et heureuse…prète à démarrer ma semaine avec Z….avec l’impression, ke tous les symboles reiki Karuna font déjà partie intégrante de moi….c’est génial !!! un énorme MERCI!!!!


Un merveilleux retour de stage d’initiation 3ème degré Reiki Usui Kai

 » Reiki , 3e degré, journée 1

J’ai vécu une journée extraordinaire samedi, peut-être plus intense que l’initiation au 1er degré.
Je n’entrerai pas dans le détail de la formation par elle-même. Ayant approché de si près la connaissance et la puissance des symboles, je comprends mieux maintenant l’intérêt du Mystère.

Retrouver Dom est en soi une belle expérience. Sa présence même nourrit notre âme, et son enseignement, donne sens à la vie, à la mienne en tous cas. J’espère de tout cœur (et j’y mets du reiki 😉 ) atteindre un jour ses connaissances, son humilité, son sens de la compassion.
Les grands hommes sont rares, c’est un bonheur d’en croiser un sur son chemin.
Retrouver Cabrières, la yourte et ce cocon de verdure sièges de tant d’initiations, c’est comme pénétrer dans un entre-deux mondes magiques, c’est ouvrir une parenthèse spirituelle.

Arrivée là est déjà une mise à nue bienfaisante.

Ce troisième degré est une redécouverte des précédentes expériences.

Dom y aborde l’aspect spirituel du reiki plus profondément, alors qu’il ne fait que semer quelques graines lors des degrés précédents. ET j’ai enfin eu un tas de réponses qui m’ont apaisées. J’aurais voulu  dire : encore, encore ! il y a tant à apprendre !!
Premier symbole, première claque. Très vite, je m’aperçois que je le dessine presque d’instinct. Il coule de source, familier, c’est un bonheur. Là où tout fut laborieux au second degré, tout devient fluide et évidence.
Nous apprenons à le tracer sur papier , puis devant nous et sur nous.
Lorsque je la trace sur ma gorge, j’en ai le souffle coupé. 

Une porte s’ouvre, j’ai l’impression d ‘avoir reçu un coup de poing en pleine figure.

Dom me demande « ca va ? »… j’ai du mal à répondre et à reprendre mes esprits « oui, … Ca arrive …». 

Il me faudra de longues minutes pour me remettre de ce premier choc, à tel point qu’à quelques minutes de  l’initiation, j’ai un peu peur. Vais-je y arriver ? Suis-je prête ? Et si je rentrais chez moi, là, tout de suite ?? lol !!

Tracer les deux nouveaux symboles sur papier et dans l’air éclairent la présence et la puissance de ceux déjà reçu précédemment. 

Leurs sens respectifs se confirment, dans une douce alchimie, j’ai l’impression de tous les réapprendre et me les réapproprier.

Ce troisième degré est une évidence, une révélation. Pas d’attente avait dit Dom, mais pourtant, que de résultats !!

L’initiation se passe en douceur. Je suis surprise à un moment donné car je sens une présence derrière moi, un peu sur la gauche. Cette présence m’absorbe, je pense que c’est Dom, mais non, il est là devant moi, il vient de me prendre les deux mains ! Alors qui était là, tout proche ? Cela restera un mystère.

J’ai les yeux fermés et un symbole m’apparait brutalement. Derrière mes paupières, impression noir sur fond blanc, il est puissant, un « oh ! » silencieux m’envahit. Le temps que je comprenne, il disparait. IL m’a marquée, il raisonne encore , même maintenant. 

C’était la première fois que je vivais ça. Je ne connais pas ce symbole, même si une partie de moi sait qu’il est familier. Il ressemble à un autre, et pourtant ce n’est pas le même.
La douche de lumière m’envahit, je suis bien, et Dom me dit que je peux ouvrir les yeux. Déjà ? Mais ça vient de commencer il y a quelques secondes ??
Où étais-je donc tout ce temps ? 😉
Ensuite je travaille sur moi, dans la yourte, je me nourris, c’est la première fois que le Reiki coule aussi fort en auto-soins. Toujours cette sensation d’une évidence, d’un voile qui se lève.
La première méditation avant le repas me plonge dans un premier ravissement. Ce n’est plus de la lumière qui coule en moi, je Suis la lumière, j’en suis la source, canal et émetteur à a fois, quelle puissance, mais en même temps, quelle douceur.
De nouveau ce sentiment écrasant d’évidence et d’être à ma place, là où je devrais être, en communion étroite avec mon moi intime et l’Univers.
Il est dur de revenir de cet état de transe transcendentale, même pour aller manger !! 
Le premier exercice après le repas redémarre doucement. Entre temps , je suis redescendue sur terre, et puis c’était tellement formidable que je pense ne pas pouvoir retrouver cet état de nouveau. Mais on trace DKM dans nos mains, et là, la lumière explose et grandit de nouveau, c’est juste « ouah !!! » Bein oui, quels mots mettre là-dessus, c’est impossible, c’est juste un nouvel état d’Etre que j’ai découvert ce jour là. Le reste de la journée avance, je baigne dans la lumière, je plane, je règle une douleur d’oreille, et j’entends enfin ce que je ne voulais pas. Ca fait mal. Au cœur. Aux tripes. Et le soulagement vient.
Merci reiki, merci J. , merci Dom !

Troisième méditation, puis Dom nous fait ensuite  pénétrer dans la yourte pour une méditation guidée pour rencontrer notre guide le plus élevé en Reiki.
J’avoue que je suis assez dubitative, je ne vois pas encore trop comment ça pourrait être possible, et puis, je baigne déjà tellement dans la lumière que je n’attends plus rien de plus. M
ais je fais confiance, je suis les consignes avec application et je lâche prise. En fait, l’initiation m’a mise en condition, je baigne dans le reiki, je dois le secréter par tous les pores de mon corps !!nIl suffit donc d’activer les symboles et de suivre la voix de mon Maître Reiki.

Je me  retrouve d’abord à marcher le long d’une plage, au bord de l’eau. Très vite, la végétation apparait sur ma droite, touffue, prolifique, et je me vois pénétrer dans une forêt tropicale. Je suis les indications de la voix qui me guide. Je m’immerge dans les sensations, j’avance pieds nus, je sens la mousse sous mes pieds, sur le chemin.
J’atteins la clairière, avant même que Dom ne le dise, je l’ai aperçue.
Je m’approche de la cabane qui s’y trouve et j’observe la lumière qui filtre au travers du bois.
Comme demandé, je pousse la porte.
La cabane est vide, très sombre.
Immédiatement, s’y dessine une silhouette : Un bouddha d’or, qui se construit sous mes yeux émerveillés, l’image délicatement ciselée d’or et de lumière.
Mais au même moment, Dom me dit de voir le symbole reiki, je chasse donc cette image de Bouddha, elle n’a rien à faire là!
Une deuxième fois, l’image se construit devant moi, de la même façon, indépendamment de ma volonté. Je suis perplexe, ce n’est pas ce qui est prévu, ne suis-je pas censée  voir le symbole reiki demandé?
Alors je chasse de nouveau le bouddha, et je façonne le symbole reiki avec ma volonté.
Il estt nettement moins puissant que mon bouddha de lumière.
Avec du recul, je me dis que j’aurais dû laisser venir ce qui s’offrait à moi, mais j’étais comme dans une transe profonde, incapable de résister à la voix qui me guidait là-bas, dans la yourte.

Je quitte donc la cabane pour découvrir l’arbre, un peu plus loin, par derrière . Cet arbre a une forme indéfinissable, ondulante, rayonnant de lumière , arbre primordial, sans doute, qui m’évoque l’expérience du grand Pin d’Akhéna.
Sa forme change pendant que mon cerveau tente de lui donnait forme, mais il résiste à mon analyse, je suis face à l’Esprit Arbre. L’énergie qu’il dégage est douce et puissante à la fois.
Puis, comme Dom l’indique, quelque chose sort de derrière l’arbre.
Je m’attends à une silhouette, une forme humaine, avec appréhension et curiosité, enfin !!!
Mais c’est un condensé de lumière qui s’avance vers moi, sans forme, ni visage. Je me sens alors emportée loin, dans un espace très gris, uniforme, sans mur, ni repère visuel.

Dom nous propose de demander son nom à notre guide.
Chose que je fais, avec impatience, bien sûr !
Je reçois une réponse teintée d’humour, de douceur, de connivence, un clin d’oeil à nos rencontres astrales précédentes au cours desquelles il a souvent joué à cache cache avec moi.
Une réponse affectueusement moqueuse : Il ne me donnera pas de nom, il restera « Guide ». Dans le même temps, je perçois que ce n’est pas si important.

Je sens alors que je secoue la tête, dans mon corps physique, dans un « non » silencieux, je ne me sens pas prête à ce qui va suivre, pas à la hauteur de ce qu’entrevois. J’ai peur.
Je reçois un message de lumière, sans mot, sans parole, un message d’amour, de reconnaissance « sa fille » me reste comme impression, et le sentiment que j’appréhenderai le message plus tard, que ce message se grave en moi et que je n’ai pas besoin de le conceptualiser maintenant.
J’entends au loin Dom qui nous propose de demander un cadeau à notre guide, et un message pour progresser d’avantage en Reiki.
Je me sens alors étreinte de douceur et de lumière, et je reçois un message en parole pour la suite des évènements : »laisse faire, aies confiance ». 
A regret, j’applique les consignes de retour, je ne veux pas le laisser partir, je me sens déjà orpheline. Je me détache pourtant doucement de lui, deux entités lumineuses fondues l’une dans l’autre qui se séparent. Mes bras de lumière tentent de le retenir, et le chagrin me serre le coeur en y repensant maintenant. J’ai  l’impression fugitive de deux espaces temps qui se rejoignent puis se séparent.

Dom nous  demande d’emprunter le chemin du retour dans la forêt, et je ressens nettement mon corps de lumière qui réintègre le corps physique sur le sentier. Je pleure là bas, dans la yourte, puis je reviens à moi, en ouvrant les yeux. Les larmes coulent un bon moment après ça.
Chacun retrace son vécu de l’expérience, les récits sont différents, mais chaque récit m’éclaire sur ma propre expérience.
Je passe la soirée chez une amie dans un état second, connectée à la lumière, entre rires et larmes car chaque émotion, chaque mot, chaque moment est exacerbé. Et je regagne mon lit vers minuit pour m’effondrer de fatigue et de bonheur !!


Maitrise Reiki Usui Kai 
Merci Pour ces 3 jours riches en emotions et sensations uniques!!!..Merci de m’ avoir permis de parcourir tout ce chemin et de m’avoir prepare à cette nouvelle vie!! Accepte toute ma gratitude,pour cela et pour ton écoute permanente et ta façon de nous guider avec humour et bonne humeur!!! Merci ,à l ‘ UNIVERS, de m’avoir permis de vivre cette experience exceptionnelle de la Maitrise….une  BENEDICTION.

Je ressens une vive émotion en pianotant sur mon clavier pour t’écrire que c’est une Grâce qui m’a été accordée que de te rencontrer afin d’être initié jusqu’à la Maîtrise. Je ne mesurais pas jusqu’à quel point il fallait être investis pour initier à cette merveilleuse Energie du Reiki dans les règles de l’Art. Je ne mesurais pas tout l’investissement que tu fournissais. KANSHA SHI TE.
Ma vision du Reiki est à présent bien plus riche. Je te disais en préambule du stage que je ne souhaitais pour l’instant pas enseigner mais à travers ton enseignement, j’ai compris l’acte d’amour que c’était de répendre cette merveilleuse Energie.
J’ai aussi compris, comme disait Benjamin Parker, qu’« un grand pouvoir implique de grandes responsabilités ». aussi je travaillerais sans cesse pour être un Maître le plus pur et divin possible. Ainsi je me sentirai un digne représentant de la lignée MIKAO USUI/…/Jeambrun et honorerais au mieux mon Maître Obi Wan Keno Reiki.
Je te remercie de tout coeur et de toute àme pour cette lumière, cette force, cet Amour que je ressens tant malgré la distance et l’écran…. J’éspère te revoir avant l’an prochain mais si ce n’est pas le cas,c’est avec un immense respect et une immense gratitude pour le Maitre que tu es que je travaille jour après jour à chacun de tes enseignements afin de me rapprocher de ce que je suis vraiment, de mon essence perdue, ou du moins oubliée,depuis trop d’années.

En passant, le très beau cristal Arco Iris que je t’ai acheté la dernière fois m’a permis de faire un bon de géant lors de mes dernières séances en guidance. D’une stabilité et d’une précision laser ! Un vrai bonheur 🙂

Hier je me balade sur ton site web ( ça faisait longtemps)…assez malade comme tu le sais, douleurs extinction de voix…. toux plus plus…bref que du bonheur : Je tombe sur ton article MIEL CANNELLE, assez septique je lis jusqu’au bout et parviens à me convaincre d’essayer…Ben ca va mieux!!!!  toux encore génante mais plus de douleurs sauf gorge mais moins qu’avant le traitement….Sur le cul je suis….
De toute façon il faut procéder par ordre et donc commencer par m’aider moi-même. J’en profite pour avouer que ça fait beaucoup de bien de s’occuper de soi et de se rendre compte que l’on existe!
Tu as l’art de nous secouer dans le bon sens Dom. Ça pique un peu au début, mais en même temps, on se dit: » je ne vais pas mourir idiot », alors hop, on prend un livre…..et puis après la lecture, on remerçie Dom et nos guides qui nous ont menés vers Dom; pour cette piqûre de rappel qui nous a mené vers la connaissance ( enfin le début de celle-ci, je reste humble). B…
Très cher Dom.Voilà un an jour pour jour !!!Je remercie le Tout d’avoir guidé mes pas vers toi!!!Je te remercie infiniment pour tout ce que tu m’as apporté, ma gratitude est infinie..Ta formation reste dans mon cœur un merveilleux souvenir. J’ai beaucoup évolué depuis et ça ,c’est grâce à toi. Tu m’as ouvert la voix de la sagesse ; j’ai trouvé mon rôle ici, aider ceux qui en ont besoin ,à se guérir et protéger tous ceux que j’aime. Aider!!!! Partager. Merci, merci !!!Gratitude infinie.
Je voulais également te remercier pour l’enseignement que tu m’as offert et ceux qui arrivent car j’ai fait le point sur moi il y a quelque temps avec tout ce qui m’arrive ( notamment message pendant mes rêves à communiquer à des personnes proches venant de leurs aïeuls, de gros ressentis quand je soigne etc ) et cela m’a transformé! Tout le monde autour de moi ne fait que dire que j’ai changé, que je rayonne, que j’attire les gens, qu’on aime être en ma présence…  Et tout cela grâce au Reiki qui m’a permis de changer , évoluer et de faire sortir le Vrai Moi Intérieur!! Et c’est trop coooooollllll .

J ai beaucoup apprécié votre stage du samedi 21 Mai, merci pour l’énergie que vous donnez à tous….cela m’a tellement parlé …..J ai l’intention de continuer avec vous et toutes les personnes qui vous entourent…. il me faut du temps…. J’ai eu des réponses à certaines questions et situations vécues les jours qui ont suivi votre stage ….. simplement je prends mon temps pour digérer les informations …..très cordialement 

merci beaucoup pour les photos du stage et surtout pour ce merveilleux week-end passé tous ensemble….je me suis vraiment régalée !!!

évidemment depuis le stage, plein de 2eme effets kiss-cool….lol…des agréables : amplification de l’énergie, plus de lacher-prise, moins de douleurs…. et des moins agréables : grosse fatigue, crises de guérison….des surprenants : frissons électriques….donc, c’est génial !!!!

je fume encore, mais moins envie et moins de manque….donc, je continue le traitement mental chaque jour, jusqu’à la réussite !!!

Phrases affirmatives de Planète Reiki
Je fais le soin avec les phrases affirmatives sur les chakras chaque matin et cela me fait bcp bcp de bien! Je sens un travail qui se fait profondément en moi… c’est génial… je me sens de mieux en mieux.

Le Reiki est venu à moi au bon moment! Sans oublier ta rencontre, car ton savoir Être et savoir Faire sont vraiment précieux!
Merci l’Univers….

Merci pour ces belles photos et surtout merci pour ce stage de Reiki Komyo qui a été très enrichissant pour moi.


Trois jours après la révision du niveau 1 en stage puis l’initiation au niveau 2, je reçois un appel d’une personne voulant me rencontrer et savoir si j’étais toujours a la recherche d’un emploi, pour me proposer un poste auquel j’avais postulé il y a plus de 6 mois et ou mon POLE EMPLOI m’avais dit clairement qu’ils ne me sélectionnerai pas compte tenu qu’ils demandaient des diplômes que je n’avais pas.


La personne que j’ai eu au téléphone m’a donné rendez-vous pour me rencontrer et aujourd’hui je viens de passer un entretien d’embauche avec cette même personne. Je me suis fais du Reiki avant l’entretien et il s’est passé a merveille. J’ai eu un très bon contact. J’aurai une réponse la semaine prochaine et si c’est ok on me forme pendant 1 mois et je débouche sur un CDD de 6 mois puis CDI.Je te tiendrais au courant de la suite de cette belle surprise.

Un grand merci pour ce stage qui m’a appris beaucoup et apporté encore plus….. et de même., il m’a apporté un enrichissement personnel extraordinaire et m’a apporté les clés qui, je l’espère me permettrons de travailler sur moi… pour pouvoir, enfin, aider ceux que j’aime le plus au monde, et les autres….. et tout le monde !!!
Aussi un grand merci à ce merveilleux groupe sans oublier V…. On sens tellement de bonté en vous 2 que le retour à la maison à été difficile car l’ambiance du Dojo est tellement sereine qu’il est difficile de retourner dans la réalité terrestre….
Merci aussi pour tes conseils de ce matin, je vais m employer à bien les appliquer…. merci pour tes conseils, et merci pour les conseils sur les pierres..

Incarner ou ne pas incarner  ?

Entités ou pas d’entités ?

R…En discutant avec différentes personnes, j’ai appris que lorsque tu vas à l’hôpital, il y a des tas de choses qui trainent dans l’air, entités, âmes …. (Et tout ça pas toujours bienveillants) et que ça peut s’accrocher à toi. 

– Dom.. Il n’est nul besoin d’aller dans un hôpital pour avoir ce genre de choses, appelé entités, qui s’accroche à nous ; il y en a partout ! Nous vivons dans un monde inouï, on nous a toujours interdit de côtoyer le monde invisible en nous faisant croire qu’il était dangereux. Or le véritable danger : ce sont les peurs qu’une personne a en elle, ces croyances négatives, ses phobies, ses accumulations de frustration et d’agressivité refoulée, tous ces manques au niveau de l’amour, le besoin d’être aimé, toutes ces peurs d’être soi-même, peur d’être aimée etc. etc. etc.

Ces pensées conscientes ou inconscientes génèrent des vibrations énergétiques qui peuvent se ressentir jusque au-delà du corps physique ; dans l’aura. C’est ce que les médiums « de surface » (niveau en dessous des médiums de haute envergure,) perçoivent la plupart du temps et appellent entités ou parfois les prennent aussi pour des mémoires de vies antérieures. 

Il peut arriver lors d’un soin Reiki que par empathie nous ressentions ces vibrations qui sont dans l’aura de la personne que nous soignons, soit sous forme d’images, soit sous forme ressentis intuitifs, ou encore des perceptions dans le corps physique et/ou éthérique, comme ce que tu décris.

Dans ces cas-là ; selon l’intensité de tes craintes, ton mental peut te faire croire que c’est toi qui as attrapé ça ! Avec le risque que tu t’affoles, que tu y crois, c’est comme si tu disais que ça t’appartenait en quelque sorte… 

Quelques rares fois certaines personnes retiennent dans leur aura des particules de personnes proches décédées qu’elles refusent de laisser partir. Les vrais médiums, les vrais clairvoyants – clairs sentant -, nous affirment que jamais en aucun cas aucune entité quelle qu’elle soit ne peut faire du mal à un humain. Ce genre de situation n’existe que dans les cerveaux des ignorants et au cinéma.

Par contre il y a la loi d’attirance ; on attire à soi ce que l’on est, ça c’est absolu. Et peut-être que tu as attiré à toi cette personne là pour que tu es à faire un nettoyage au niveau psychologique concernant le symbolisme des cuisses et des poumons, et une colère que tu retiendrais dans tes mains sensation de brûlure = colère.

Ce genre d’expérience est toujours enrichissante quand on la prend du côté métaphysique, du côté de la vie, au lieu de rester coincé dans la matière et dans la peur.

– L…J’ai lu un reportage ; qu’il était essentiel d’apprendre à bien  se protéger. !!!???? (on peut s’attraper tant de saletés en faisant du Reiki ??)

  • Dom…Depuis 20 ans que j’exerce ce métier d’enseignant Reiki et de soigneurs Reiki, de formateurs d’enseignants Reiki…je peux t’affirmer que les gens qui disent ça ce sont eux les « saletés« . 

Tous les « grands » maîtres Reiki savent très bien que depuis plus d’un siècle que le Reiki est pratiqué dans le monde il n’y a aucun exemple prouvant que le Reiki a fait du mal à une personne. Les gens qui disent ça ont été soit, très mal formés au Reiki ou ne le pratiquent pas de manière correcte, soit n’y connaissent rien, et ne font que des suppositions.
Cependant il est important de savoir que le Reiki est un système énergétique et que la fine subtilité du Reiki qui entre dans la personne que l’on soigne ou qui se soigne avec le Reiki peut parfois faire remonter à la surface les distorsions à l’inverse d’un antibiotique ou d’un anxiolytique qui eux, vont « endormir ». Alors la personne va s’affoler et va croire qu’elle a chopé quelque chose avec le Reiki. Mais la seule chose qu’elle a chopée , c’est l’extraordinaire chance de pouvoir nettoyer des mémoires distordues –venant souvent de la petite enfance – et qu’elle passe à côté de ce cadeau en arrêtant de faire du Reiki, ou de recevoir du Reiki. Elle ira surement chez un autre « réparateur » qui va lui donner des médicaments ou l’enfermer dans un système de croyances négatives, de craintes et de peurs.

Je reviens donc que sur ce que j’enseigne au premier degré ; pendant les premiers mois après le stage d’initiation et de formation au Reiki : pratiquer le plus souvent possible une à plusieurs fois par jour le rituel complet de préparation en traçant CKR sur chaque chakra avec l’intention que ce symbole protège des autres et protègent les autres de soi. Ce protocole si simple va créer un bouclier énergétique d’amour et permettra d’entrer en contact avec qui que ce soit en éliminant absolument tous les risque d’interférence indésirable (c’est ce que je fais depuis 20 ans et Dieu sait si j’en ai vu des phénomènes ! ! !)

Ensuite : avant d’aller à l’hôpital ; soit à ton domicile, soit dans la voiture, ou en arrivant sur le parking de l’hôpital, ou que ce soit d’ailleurs pour aller voir n’importe quelle personne pour lui faire un soin même si c’est une amie que tu connais : tu te fais un envoies à distance en mettant en avant que ton canal Reiki est ouvert pour laisser librement couler l’énergie du Reiki pour la personne (non pour toi), et que tu es protégé à tous les niveaux et que tu es en sécurité totale. Et dans la voiture avant d’entrer à l’hôpital, te faire un auto rayonnement une ou deux minutes après avoir tracé CKR sur les chakras. C’est la moindre des choses à faire.

Sinon tu vas entrer en résonance avec les distorsions qui sont dans la personne, activées et excitées chez elle par la maladie et la peur, mais en sachant que tu as d’éventuelles mémoires en toi ; la loi de la résonance. L’effet miroir. Ce n’est jamais par hasard que l’on va donner un soin à à une ou à plusieurs personnes.


-P…Ma question est : quels sont les dangers que je cours en me servant de l’énergie car même en faisant kenyoku et CKR  j’ai la sensation que je prends je ne sais quoi. Y a-t-il tant de danger que ça qu’on ne voit pas ?
Faut-il que j’arrête de pratiquer et que je me forme plus profondément car je ne sens pas l’énergie ni je la vois, ni j’arrive pas à méditer, faut’ il vraiment être concentré sur les symboles que l’on fait avant le soin car j’ai tendance à les faire automatiquement. Est-ce que Kenyoku et CKR sont suffisants pour me protéger (mais de quoi ?).Je suis un peu perdue dans tout ça et aussi un peu inquiète. 

  • Dom…Peut-être néglige tu le rituel de préparation, enfin, tel que je te l’ai enseigné au premier degré et au deuxième degré. 

Peut-être néglige tu l’intégration des cinq idéaux de Reiki chaque matin et chaque soir. 

Peut-être néglige tu de pratiquer régulièrement chaque technique de changement du deuxième degré pour guérir le passé. Les mauvaises habitudes avec le traitement mental, les peurs les craintes les blocages avec la guérison à distance dans le passé. 

– B….Je trouve que l’initiation Reiki beaucoup plus puissante que l’extrême onction. Que le symbole réunifie le corps et l’esprit sur tous les plans de la conscience.
Je sais que l’ame reviendra avec ce don dans sa prochaine incarnation.
je le fais gratuitement parce que j’aimerais qu’on me le fasse quand je partirais, une grâce. Une dernière fois recevoir de l’amour qui ai du sens. Partir avec ça donne envie de revenir, tu parles, le dernier souvenir est un souvenir Reiki, trop bon. Je ne connais rien de meilleur que le Reiki. C’est le sens de la Vie. Et de la mort aussi.

Merci Dom , ça fait du bien de te lire ds tes news letter. Perso je n’ai jamais fait de soin à une personne en fin de vie ( sauf un chat…) et ce que tu dis me  » convient  » ; j’ai à ce jour toujours donné les soins reiki que l’on me demandait gratuitement , et ce alors que je suis moi-même dans la précarité ( je n’ai plus de domicile fixe et n’ai aucun revenu ) mais il semble que tous les jours je sois bénie puisqu’il y a toujours un lendemain ; je fais et j’ai confiance même si c’est pas toujours facile . Par contre je ne sais pas si j’aurai envie de revenir, me réincarner … peut-être me faudrait-il croiser quelqu’un comme toi au dernier jour.

– Dom…on doit tous revenir pour régler nos distorsions, qu’on le veuille ou non. C’est la Loi Cosmique de la réincarnation.

le but de la vie n’est pas de réussir mais d’apprendre qui nous sommes et comment nous fonctionnons au milieu des autres, et ça : à travers nos expérimentations que nous nommons « métiers » « familles » « couples »…. les émotions !!!!

…et aussi à travers la faune des « récompenses à la performance » leurs dérives : l’illusion : médailles, titres d’excellence, star système, diplômes automatiques……on s’incarne en partie pour apprendre à comprendre pourquoi nous n’atteignons pas l’Altruisme, et pourquoi nous restons coincés dans l’égocentrisme et l’attachement à la matière, au pouvoir qu’elle exerce sur nous. Par manque de connaissance.


Le 18 mai 2016 à 13:44, S….> a écrit :

Bonjour Dom, Dans le cadre de séances énergétiques, je suis amenée à nettoyer/libérer les centres énergétiques de programmes indésirables chez mes clients. Mes guides thérapeutes et les anges m’enseignent une méthodologie pour déprogrammer de la « mauvaise onde » (celle qui entrave la liberté, le libre arbitre).
Mes questions sont les suivantes : Nous abordons dans tes ateliers les mantras pour dynamiser les chakras, ce qui ouvre et augmente le taux vibratoire de ces chakras. Ces mêmes mantras travaillent-ils indifféremment dans le sens de la vie et de la mort ?

– Dom. Bonjour S… je ne me préoccupe que de la vie, la mort n’existant pas, étant simplement un processus de transformation. 

Le mantra n’a qu’une seule fonction c’est d’aller au cœur de l’ADN, résonance avec les chakras, dans un seul but ; d’activer le potentiel endormi de l’être. Seulement 3% de l’ADN est actif, les 97 % restant roupillent.
Le plus simple, serait de chanter ! De lacher prise, et de Vivre pour Vivre.
Hier il s’est passé un très bel événement qui m’a permis de me rendre compte de ….tout ça. ..je suis rentré dans un cloître je ne sais pas pourquoi…il a y avait  4 personnes qui faisait une prière en chantant à haute voix j’ai eu l’impression que c’était pour moi tout ce qu’ils disaient
Suite à ça, j’ai fait du Reiki sur une des 4 personnes, qui avait un bouton au niveau du nez qui lui faisait extrêmement mal, deux heures après elle m’a appelé pour me dire qu’elle n’avait plus rien. ensuite le soir mon fils avait mal à la tête j’ai fait du Reiki il s’est couché…m’a appelé et m’a dit maman je n’ai plus mal! en fait le Reiki c’est comme ce que faisait Jésus et cela m’a émue j’ai pleurée d’amour… car c’est merveilleux donc je ne me pose plus de questions et je me lance j ai confiance.

C est incroyablement merveilleux!!L amour ne me quitte pas, toutes les personnes que je rencontre veulent du reiki mais je ne me sens pas prete encore? Je ressens un besoin de travailler chez moi de pratiquer sur moi meme, avant de me lancer (j ai un peu peur je ne sais pas pourquoi ) …donc j ai décider de me laisser une semaine ensuite je rappellerai les personnes qui veulent du reiki qu est ce que tu en penses?

  • Dom…Oui c’est merveilleux maintenant l’amour ne te quittera plus jamais, tu y reconnectée et c’est à vie ! Ce que je pense c’est que si tu donnes du Reiki tout de suite tu en feras l’expérience tout de suite. Et que si tu attends c’est simplement représentatif d’un manque de confiance en toi en général.
    Donc c’est en faisant l’expérience de donner du Reiki de suite que tu gagneras en confiance en toi et non l’inverse ; c’est-à-dire d’attendre d’être prête pour en donner. J’ai insisté lourdement là-dessus sur le stage, tu as reçu de l’amour, tu vas donner de l’amour, et si tu t’inquiètes : Shin Pai Suna.


Main qui chauffe beaucoup


– V…Je reviens vers vous car la pomme de ma main gauche me brûle régulièrement ça me gêne et ça me faisait peur.

  • Dom…Dans ce cas il ne faut pas se poser de question faut pas réfléchir faut la poser sur quelqu’un, ou sur toi et laisser couler le Reiki en accueillant. Tu peux la poser sur la terre et demander à la mère terre de décharger le trop-plein d’énergie et de te montrer par la voix du cœur comment canaliser l’énergie du Reiki de la meilleure des façons. 

– V…J’ai arrêté le reiki (pratique et 2ème degré) que j’avais prévu de faire je trouvais ça aller trop vite ces sensation fort…J’ai envie de reprendre parce-que je sais que ça marche et que ça aide mais j’ai peur. Est-ce normal et que puis-je faire ???

-Dom…Il ne faut jamais avoir peur des sensations que donne l’énergie du Reiki, ni des changement que le Reiki peut provoquer ; car ça signifie qu’il y a des années que tu attendais que ta vie change, alors quand ça arrive il faut sauter en l’air les bras tendus vers l’Univers et remercier,  accueillir tous avec beaucoup de joie : sinon tu retiens et ça brûle.

       Est-ce que tu as peur de changer et est ce que ça gêne ton entourage, ton environnement, ta famille ? ? Est-ce que ça serait ça qui brûle en toi ? La main gauche est le prolongement du cœur…l’affect.

C’est bien que tu reconnaisses que tu es peur. Et sache que l’énergie du Reiki c’est l’énergie de la terre, de la planète, et que cette énergie sait exactement de quoi tu as peur, et l’énergie du Reiki va t’aider à changer et à transformer tes peurs. Le véritable courage, la véritable force, c’est d’agir malgré la peur. Car derrière l’épreuve se trouve la liberté, le bien-être et le bonheur. Et tout l’entourage en profitera. Et en pratiquant le reiki régulièrement, ça va se dissoudre tout seul…(à peu près tt seul …) Une dernière question : est-ce que tu donnes souvent des soins Reiki aux autres ?


– V…Bonjour Dom merci pour tes réponses et tes encouragements. 
Non malheureusement je ne donne de reiki à personne même pas à moi pour éviter que cette brûlures s’intensifie je savais pas qu’il fallait faire le contraire.
La patience, c’est comme un grand champ de fleurs au soleil, et des oiseaux joyeux, des insectes bourdonnant de satisfaction, et l’amour dans ton cœur.

L’impatience, est comme un jour de pluie et de mistral, tu es décoiffée, mouillée et agacée, tu es seule et tu as peur.
– B…Hier j’ai senti que le reiki me remuait un peu car je n’étais pas trop trop bien, je me sentais patraque. Ma Tante E…. ma dit que c’était normal et que elle, grâce au reiki, elle est en train d’évacuer des calculs reinaux.

  • Dom…Yes ! Le Reiki des fois ça remue, c’est que ça en a besoin !! Mais aussi le Reiki ça équilibre, ça met de bonne humeur, et parfois on oublie de rester sur cette fréquence de bonne humeur et on laisse notre esprit fabriquer des pensées lourdes, négatives. Alors on dit que c’est le Reiki qui nous remue, alors que NON !  ce sont nos pensées nos sentiments nos émotions lourdes et ténébreuses, mécontentement ou autre, c’est ça qui nous brasse.

C’est très difficile de rester en permanence sur la fréquence du bonheur qu’apporte le Reiki. Au début.

Mais quand on se rend compte qu’on est sorti de la lumière et qu’on broie de l’ombre il suffit d’une toute petite éclaircie – une pensée positive affirmative, ou activer un symbole – pour nous faire penser que c’est le moment de faire une séance de Reiki – qui peut n’etre que de 3 mn – et retrouver la joie, la bonne humeur, et on est beaucoup plus fort pour régler la situation embarrassante car on y voit plus clair.

Anciennes relations et changements d’état d’esprit

Par rapport au sujet dont tu me parlais vendredi avant la soirée, des gens dont on s’éloigne parce qu’ils ne suivent pas le même chemin d’évolution que nous, j’ai curieusement rencontré samedi matin (comme par hasard….lol) un ami que je n’avais pas revu depuis une bonne dizaine d’années, ou plus. Toujours aussi sympa. Mais enfermé dans une lutte. Il y a 15 ans on se voyait beaucoup, toujours au sein d’un groupe d’amis. A cette époque je n’étais pas le mm et il me complexait avec ses paroles de sagesse d’amour et de paix et les admiratrices admirateurs qu’il avait autour de lui. Je nourrissais à son égard un sentiment d’infériorité et de jalousie. À ce niveau – la connaissance spirituelle – seulement. Sûrement qu’à cette époque la loi de résonance me montrait que j’avais le même homme spirituel en moi et que je souffrais de ne pas le connaître ni même le faire connaître aux autres.

Son histoire est triste ; lui qui parlait d’amour de paix et d’harmonie de respect des autres, il est parti un long moment en prison pour avoir frappé sa femme violemment et l’avoir envoyée à l’hosto dans le coma. Et le pire, il est parti en laissant sa fille de 4 ans. Depuis huit ans il souffre de colère de ne pas pouvoir voir sa fille plus d’une fois par trimestre et d’être confronté au rejet et à la haine de celle qui fut « sa chérie, la mère de leur enfant, sa fille qui a huit ans aujourd’hui ». Et sans fierté particulière (que j’aurais pu avoir il y a 15 ans…) j’ai ressenti beaucoup d’amour et de compassion pour lui, et pour elles. Et je suis reparti sur mon chemin lumineux Reiki avec un sourire dans le cœur en sachant qu’ils vivaient une expérimentation dans le monde des émotions et qu’un jour ils finiront par réparer ça.
Dans cette vie ou dans une autre.


Ne t’en veux pas de ne pas avoir assez parlé à la soirée, je comprends très bien ces états de conscience que l’on vit tous à un moment ou un autre, ils sont légitimes et respectables. Le Reiki, la connaissance par les chakras, par les rêves, par les pierres etc. etc. etc. …. nous fait grandir certes, met aussi à nu notre sensibilité que nous avions barricadée par la forteresse, la carapace de l’éducation psychorigide que nous avons reçue, qu’on nous avait imposée. Et cette sensibilité, ces émotions respirées que nous vivons, sont là pour nous aider à avoir encore plus confiance dans ces énergies qui nous aident d’une façon si vraie ; un amour sans complaisance. Cet amour qui nous a manqué du point de vue maternel et paternel, et  éducationnel. Comprendre que le système éducatif parental et national était dirigé non pas pour notre bien-être mais pour que ces gens-là soient en paix et tranquilles et puissent gouverner leur petite famille ou leur petite nation en étant sûrs que les jeunes ne viendront pas leur casser les pieds ; sinon : violence. 

Je suis content que tu ai vécu ta tristesse, que tu ais pleuré, que tu sois vraiment en contact avec tes sentiments. C’est promis y aura d’autres soirées silence et le plus tôt possible sera le mieux.
Envois à distance

Super merci ! Et merci reiki ! Après 1 mois et demi de recherche sans même voir une annonce qui m’intéresse, voilà que les visites d’appartement s’enchaînent ! Le choix va être difficile lol c’est incroyable, ça a commencé dimanche en rentrant du stage Reiki 2 avec une 1ere annonce intéressante. C’est vraiment magique l’envoi à distance ) je profite de ce mail pour te demander les références de la musique que tu nous a passé pendant le stage, quelle page sur ton site. Et je souhaitais connaître le tarif des différents ateliers (rêve, chakras, méditations etc). Encore merci pour ce fabuleux stage et la qualité de ton enseignement.
Le balancier du pendule….

  • JC….Bonjour à chacun d’entre vous, j’ai vu que pour certains la semaine qui vient de passer marque de grands changements et pour d’autres un véritable yo-yo émotionnel, j’en fais partie, un jour je sais qui je suis et où je vais et dans la même journée je doute de tout, j’essaie avec recul d’en comprendre le « message », et malgré cet état j’essaie au maximum de pratiquer sur moi et certains de mes amis, sans oublier de « méditer », voilà un peu le constat.

Malgré un état qui semble assez confus et qui en temps normal m’aurait bien gonflé, assez paradoxalement je reste serein et confiant, à croire que mon esprit cartésien est en train de régler son curseur avec cette dimension ésotérique qui m’est tombée dessus pendant le stage et que je ne peux nier au fond de moi.

Merci du plus profond de mon cœur à chacun pour ces journées vécues ensemble et ces étincelles de moments magiques, moments furtifs mais chargés d’amour pur et d’émotions intenses.

– Dom….Bonjour JC….merci pour ce partage, c’est courageux.

Le Reiki te fait un beau cadeau encore une fois ; il te montre où tu en est sur le plan intellectuel et sur le plan affectif. Deux états de conscience intérieurs qui oscillent ;le balancier ; tantôt l’illusion de se connaître ( confondre ce que l’on fait – métier – et ce qu’on a fait et réussi, construit, établi – la personnalité – et qui on est – être soi sans rien prouver)

et tantôt ; côté affectif douter de soi, ou de tout, peut démontrer une insatisfaction de soi. Quelque chose en soi que l’on n’aime pas peut créer ce déséquilibre, c’est-à-dire ne pas être dans l’axe entre intellect et affect : content de soi.

Spirituellement, c’est-à-dire intérieurement, content de soi ; c’est ce que l’on est soi et non en fonction de ce que les autres attendent ou que l’on croit que les autres attendent de nous.

Si tu accèdes au deuxième degré puis découvriras les outils adéquats pour rééquilibrer. Je t’encourage à continuer les pratiques du premier degré car le Reiki va à la cause des problématiques. Reste dans un bel optimisme quand au symptome grace au reiki usui. Le symbole, il te suffit de le lire, et tu préserve ta sante.

Atelier hebdomadaire MÉDITATIONS GUIDÉES

Des méditations guidées pour une douce introspection.

Les méditations hebdomadaires.
Méditer avec les pierres
Clic ici pour l’heure….
Les blessures de l’âme
.en savoir plus…clic


Les blessures de l’âme ;

Avec Véronique Gouin

Pour vous accompagner dans votre cheminement spirituel, votre développement personnel, votre démarche de guérison émotionnelle… des ateliers qui vont vous aider tout en douceur. Partenaire idéale du reiki, la méditation permet de se positionner en témoin neutre de soi-même, de s’observer avec bienveillance et de se soigner là où il y a besoin. L’état de conscience alpha dans lequel on se trouve en méditant, permet d’être en communication directe avec son subconscient, sans que le mental intervienne.

On peut alors accueillir les problématiques, les traumatismes, les souffrances… avec un autre

regard et leur offrir une autre réponse.

Cette année je vous propose de pratiquer la méditation au Dojo de Juvignac, sous forme de modules thématiques indépendants les uns des autres. Les ateliers sont ouverts à tous, praticiens reiki ou non, seule une intention vraie de plonger au cœur de soi est requise…



Dojo-reiki- sagesse du bouddha-méditations guidées


Basé sur les travaux de Lise Bourbeau, ce module va permettre de mettre de la lumière

sur les cinq blessures principales que nous portons tous, avec une plus ou moins grande

intensité. Chaque méditation, entièrement guidée, sera un voyage intérieur destiné à se

revisiter différemment, à se pardonner et à s’aimer mieux. L’enfant intérieur sera

accompagné avec Amour vers une libération de ses souffrances, et…… En savoir plus

Cet atelier hebdomadaire de méditations guidées sur les thèmes de Lise Bourbeau seront animé par Véronique Gouin. Je l’ai formée à la Maitrise Reiki Usui et Karuna et depuis le début de l’année 2016 elle m’assiste dans pratiquement tous mes stages de Reiki. Pour ces stages, je lui ai demandé, et elle m’a proposé, de créer des méditations spécifiques sur les symboles Reiki Usui Shiki Ryoho, afin d’aider les stagiaires à mieux intégrer les énergies de chaque symboles. Elle guide les stagiaires en stage avec SES méditations, en fonction du stage et du ou des symboles transmis ces jours là. Et c’est pour tous un ravissement, et de beaux voyages.
Voilà pourquoi je peux aujourd’hui lui ouvrir le Dojo afin que vous puissiez tous profiter de son talent, et de sa voix vraiment mélodieuse.
Et des hauts bénéfices de la méditation.

Méditations guidées blessures de l'ame

Véronique Gouin


            Méditer avec les pierres

Avec Dom Jeambrun
L’Atelier sera en place en Février : de 20h30 à 21h30…env

Je proposerais des séances de méditation avec les pierres, guidés dans l’ouverture du coeur ; l’ouverte de la Nouvelle Conscience.



Des biologistes ont trouvé de la vie chez les minéraux : les pierres sont vivantes !***lire en bas l’article…




Ces méditations ont pour terme d’inciter à les vivre et à les ressentir, puis à les utiliser comme un moyen de percevoir plus vivement la nature des pierres.

Il apparaît évident à notre époque d’aujourd’hui de tenter de découvrir ce que les êtres inconnus veulent, car notre relation avec les pierres a pour but le bien du monde et non le nôtre, même si elle nous guérissent, et les êtres des pierres sont intimement liés à l’âme du monde, de par leur nature minérale.

Dans la profondeur de mon enseignement je peux affirmer que servir l’âme du monde est ce que souhaite le plus mon cœur, et que le retransmettre à autrui me touche infiniment et me motive à servir avec amour.

De toute façon, cette pratique est très puissante et profonde, tout en restant douce et sensible, c’est une vibration. Un geste de bienvenue et d’estimation aimable envers les pierres. Comme vous le feriez avec un animal qui vous aborderait en pleine nature.

En méditant de la manière dont je me propose de le faire en vous guidant, j’espère vous apporter un moyen de fusionner encore plus profondément l’esprit et le corps.

Pour encourager le corps ;

  • à être plus éveillé
  • à se sentir aimé par vous.
  • À se sentir en sécurité avec vous.
  • Apprivoiser le corps a laissé « la conscience du corps » rencontrer les êtres vivants des pierres.
  • Découvrir la conscience de votre corps de cristal.
  • Ainsi votre esprit s’élèvera, avec une meilleure conscience de la matière.

Dates de cet atelier « Méditer avec les pierres » :

de 20 h 30 à 21h30…env

à partir de février.

Grande découverte et immense avancée dans le domaine de l’exploration du monde vivant : une équipe de physiciens-biologistes du CERN (Paris VII) dirigée par Guy Yom Fodrill, a pour la première fois observé la présence de cellules vivantes constituant l’organisme des minéraux (incluant tous les types de minéraux connus).

Cette étude menée en Février 2014 visée prioritairement l’exploration microscopique de Fractales (Le chou romanesco est un exemple de fractale naturelle) mais l’utilisation d’un nouveau microscope électronique nommé ATLAS (A Toroidal LHC ApparatuS) utilisé dans le domaine de la physique des particules au fameux LHC de Genève a mis à jour un réseau cellulaire vivant au sein même de ce qui compose les minéraux.

De plus l’équipe a observé que les pierres sont des organismes vivants avec un système organique différent des modèles vivants connus (animal et végétal), en effet l’agglomération des cellules mortes dans la « soupe primitive » selon les recherches en Abiogenèse (déf: dans son sens le plus courant, désigne l’étude de la génération de la vie à partir de la matière non vivante) et qui remonte à environ 3,5 à 3,8 milliards, montre que comme le disait Antoine Lavoisier : « Rien ne se perd, rien ne se crée, tout se transforme. » amène à confirmer que le vivant fait partie de toutes choses existantes sur Terre puisque les cellules Eucaryotes et Procaryotes au fondement de la vie Terrestre n’ont pas disparues mais se sont agglomérées pour former la roche qui a permis aux êtres microscopiques de remonter à la surface puis à l’air libre en développant peu à peu des membres moteurs extérieurs (pattes, queues…). C’est donc des milliers d’années d’agglomération de cellules vivantes qui forment la pierre.

Ces recherches vont bientôt élargir le champ d’observation du monde qui nous entoure et pourrait bien changer notre vision du monde et du vivant.

Source : Futura-Sciences rubrique Biologie (http://www.futura-sciences.com)

Written on septembre 27th, 2016 ,

Selon les stages, l’ensemble des techniques enseignées lors du stage second degré Reiki, se trouve être un peu trop riche.

Ce n’est pas qu’il faille enlever des techniques, non, elles ont leurs raisons d’être et sont très utiles à chacun. Néanmoins nous avons souvent convenu entre nous, stagiaires et enseignant, que ce stage serait plus confortable, voilà, c’est une question de confort et de plaisir d’assimilation, donc pratique et confortable s’il s’étalait sur une semaine ou au moins sur 4 jours.

Cela fait quelques temps que j’y songeais sérieusement, et voilà, c’est cette année le test. La réalisation du projet !
Les techniques d’envoie à distance seront les mêmes mais étendues en possibilités et en mise en pratique. Imaginez donc ; toute une journée à apprendre les envois à distance avec les quartz, au lieu de le faire en seulement 2 heures – vu qu’il y a les 4 initiations et les 4 temps de pratique de l’auto-traitement.

Il en sera de même pour le traitement mental ainsi que pour les guérisons dans le passé et la guérison longue durée du passé. Mais aussi, au lieu d’une demi matinée, une journée entière sera consacrée aux multiples façons d’utiliser les 4 symboles combinés entre eux, en soins, entre stagiaires sur les tables de massages, tandis que je vous guiderais en fonction des besoins de chacun, ou de situations imaginables au vu des vingt ans d’expériences vécues en soins, sur moi même et sur autrui.

Le Reiki et les symboles restent gratuits, vous ne payez dans cet échange, que le savoir faire. Le moyen sûr d’apprendre à les utiliser. Et en fonction des retours sur ce stage que ferons les stagiaires, je mettrais ce principe en fonction sur la plupart des stages, Reiki premier degré, second niveau et niveau trois. La formation à la Maîtrise Reiki Usui se faisant déjà sur trois jour, pourrait aussi se prolonger sur quatre jours de stage. Planète Reiki vous permettra toujours le paiement échelonné.

Date prévue pour ce premier stage de second niveau Reiki Usui : les 2,3,4 et 5 Juin 2015.



Places limitées, bien entendu, pour ne pas surcharger un stage dont le but est de le rendre confortable…..
Commentaires laissé sur l’article ; 
« Bonjour cher Maître
Comme tu dis, le stage est riche en informations et cela permettrait sans doute une meilleure assimilation. Bien que tu restes très disponibles pour nos questions une fois le stage passé et je t’en remercie encore.
Toutefois, et c’est aussi à prendre en compte, l’avantage d’une formation sur deux jours, c’est qu’elle peut avoir lieu sur un week-end alors que là, celui qui a un emploi à temps plein doit obtenir l’autorisation de son employeur pour poser des congés. Mais bon, si l’appel du Reiki se fait pressant, on trouvera toujours le moyen de se libérer. Bises »

Les Ateliers sur les Chakras sont une aide à la compréhension de soi et du monde

Les Ateliers sur les Chakras permettent d’obtenir des éléments quantiques précieux en complément à la pratique du Reiki

Les Ateliers sur les Chakras lithothérapie ; Pas nécessaire de s‘inscrire ni d’etre initié reiki pour y participer.
Ateliers sur les Chakras
Les couleurs de la Vie !
 de 9h30 à 17h…env…
 Chakra     Sacré  Vendredi   9   Nov.       2018
 Chakra     Solaire  Vendredi   21   Déc.      2018
Chakra du Cœur   Vendredi   25 en janvier
Chakra   Racine   Samedi    30   Mars 
Chakra Frontal – 3ème oeil Vendredi  27 Avril      
7ème  La Couronne Le Père/intuition

8ème Chakra 
Important d’avoir fait un bon nombre des 7, pour bien comprendre cet atelier du 8ème chakra !
Les Ateliers sur les Chakras permettent d'obtenir des éléments quantiques précieux en complément à la pratique du Reiki

 Vendredi   24 Mai   

Vendredi     21    Juin

Les Ateliers sur les Chakras permettent d'obtenir des éléments quantiques précieux en complément à la pratique du Reiki




 Les soirées partage, cliquez ici
Les Buts du Travail sur Les Ateliers sur les Chakras & lithothérapie

La transformation de la conscience; cultiver l’estime de soi.

Les Ateliers sur les Chakras permettent d'obtenir des éléments quantiques précieux en complément à la pratique du Reiki


   Contenu d’un atelier

L’atelier chakra
l’occasion conviviale de récolter de précieux trésors spirituels.

La découverte, parfois déconcertante, des valeurs humaines vues au travers des centres énergétiques qui nous animent, fait tout l’intérêt de ces ateliers.
Déconcertant de se découvrir, certes, surpris aussi de voir comment ne plus se confondre avec l’autre en soi ; l’ombre en chacun de nous. 
Se libérer du poids du passé, tout au moins le comprendre, l’apaiser. Et se donner les moyens de faire bouger ce qui stagnait.
Brasser, activer le tambour du nettoyage neuronal, décongestionner le corps et « Ouvrir » les chakras, l’un après l’autre, atelier après atelier.


Enseignement de théories connues et inconnues. Pour mieux se comprendre afin de vivre un meilleur présent.
De subtiles et profondes informations sur le comportement de soi.
chants de Mantras

Au cours de l’atelier ;  pratiques Qi Gong, Mudras subtils, Mantras profonds, des infos, des images, les Chakras & lithothérapie; des minéraux scintillants, et de merveilleuses méditations guidées pour éveiller les énergies du  chakra. Méditations guidées, huiles essentielles. Ainsi que certains petits yoga assis ou debout, facile à refaire chez soi.

Des documents visuels sur les pratiques sont donnés en cours d’atelier ainsi que la pierre du Chakra du jour.















de la

Les Ateliers de Planète Reiki s’adressent aux personnes initiées et non initiées au Reiki.

Participation pour la journée    9 h 30 -pause repas-17h……25 €


L’animateur ; Dom Jeambrun, Maître Reiki Usui et Karuna, s’est également formé à d’autres Maîtrises de Reiki ; Komyo Reiki style Hayashi, Shambala, Corps Miroir, Reiki Tibétain, Reiki TCl. Reiki des Rêves…PNL. Longtemps il a animé des ateliers de théâtre et d’écriture thérapeutiques. Pour  l’accompagnement de personnes bloquées émotionnellement, il agit en tant que Passeur en écriture.

Artiste sculpteur forgeron alchimiste il s’est passionné dans l’étude du symbolisme, puis se forma pour retransmettre et obtint le diplôme de Concepteur de projets Artistiques et Pédagogiques.

Il pratique le Qi Gong Woodang 3, et à suivi diverses formation de massages : Assis, Lomi Lomi, Sportif, Tantra avec Nick Douglas & Penny Slinger. Ayurveda.

J’anime les ateliers sur les 8 chakras : au dojo de Juvignac.
également à…. clic ici     La Quette de l’Ange 34730 Prades le Lez……..

Les Ateliers Reiki  à Montpellier et les ateliers reiki à Nîmes ainsi que les ateliers reiki à Prades le Lez ont pour vocation de cultiver l’utilisation approfondie des symboles Reiki Usui et Karuna, des techniques d’auto-traitements, de soins, d’approfondir les multiples techniques « à distance » pour soi et autrui. Progresser !!!

Written on octobre 5th, 2014 ,
Formations       Retour REIKI 3ème degré
Ce stage s’adresse à ceux qui désirent approfondir leur travail sur soi grâce à  l’utilisation des symboles Reiki traditionnels.
Élargir leur chemin spirituel et personnel, et s’auto-guérir (complément thérapeutique), sans pour autant vouloir accéder
au degré de Maître enseignant – 4ème degré reiki Usui.-Ce stage donne accès à l’initiation au REIKI KARUNA !
Contenu    des    stages
       J’enseigne le troisième degré de Reiki  en deux jours intensifs
pour les soins et particulièrement en développement personnel durable…

Contenu du stage 3ème degré de Reiki :

-réviser et approfondir le Reiki du premier degré reiki et du stage deuxième degré reiki.

– Initiation à la pratique Gasshô Shinto Komyo.

-réviser les stages antérieurs ; remise à niveau et re-initiation aux symboles du cœur et des pieds)

-enseigner et expliquer les utilisations et l’activation du symbole de Maître Usui.

-enseigner et expliquer les utilisations et l’activation du symbole de la gorge

enseigner les multiples combinaisons de ces symboles avec ceux du 2ème degré-les initiations au symbole de Maître.

-Les initiations au symbole de la gorge.

-Les initiations au symbole de maître intérieur.

-méditations guidées spécifiques du 3ème degré Reiki avec les symboles.-Utilisation des cristaux de quartz et Reiki : comment confectionner une « grille de cristaux » qui envoie du Reiki à un nombre illimité de destinataires, chacun recevant selon ses besoins et selon son degré d’ouverture. J’anime cette partie du stage en y consacrant l’aprés midi du Dimanche sous forme d’atelier.

-méditations guidées avec les cristaux.

-Vous repartirez avec votre grille chargée et activée en Vrai !!!

-l’Antahkarana – symbole Tibétain ; toutes les façons de l’utiliser.

-IPE – Intervention Psycho-énergétique : qui aide à éliminer « l’énergie négative » de soi-même et d’autres personnes pour une autoguérison profonde.

-méditation guidée « Rencontre ton guide Reiki ».

-TJR (Techniques Japonaises de Reiki) : Reiji Ho, Gyoshi Ho, Koki Ho, Joshin Kokyu Ho,  Reiki Undo

 – Des Supports visuels + 1 Livret ou manuel du stage : vous y retrouvez l’enseignement du stage et plus /  et diplôme.

A propos du symbole de la gorge transmit habituellement au 3ème degré, je me permet de préciser ceci :
Qu’il existe des Maîtres Reiki qui ont suffisamment d’envergure de conscience et d’expérience d’enseignement pour transmettre ce symbole tout en respectant le protocole sacré des initiations, dans le fond et dans la forme.
A savoir que ce changement n’est pas dicté, chez certains Maîtres, ni par le mental ni par par l’Ego, mais par l’écho. De leur connexion sincère avec l’Univers.Ainsi, je garanti cette transmission en pleine conscience, vous garantissant un 3ème degré dans les règles de l’art, aux résultats efficaces – j’ai de nombreux élèves qui peuvent en témoigner !!! – L’amour inconditionnel en pleine conscience.
Les dates du 3ème degré reiki                           le tarif du troisième degré reiki 

– J’ai un parcours d’une vingtaine d’années d’enseignement du reiki mais me suis parallèlement formé dans diverses techniques…
DU d’Animateur d’ateliers d’écriture thérapeutique, DU de linguistique, 20 ans d’étude sur les chakras et l’ensemble du symbolisme,
acteur théâtre, master PNL, forgeron alchimiste, Yoga tantrique, sophrologue, Qi Gong Wu Dang 2, et initié à 5 Maîtrises de Reiki différentes…

Un vécu de guérison personnelle qui me permet de nourrir mon enseignement traditionnel du Reiki avec une connaissance sur l’émotionnel, les sentiments,

les peurs et les craintes.

L’étude du langage.

Depuis 3 ans je suis une formation de lithothérapie et de radiesthésie, ainsi que de Yoga Nidrâ et de Yoga du son.

Etude des lois de l’Univers et la physique quantique en lien avec le Reiki et les symboles du Reiki.

Ceci amplifie ma pratique du Reiki Karuna, du Reiki Komyo et Usui bien sur. Et l’ensemble de ma manière d’enseigner.

 informations et descriptions du contenu des formations et stages Troisième degré Reiki Usui Montpellier nimes lunel….Lyon 

Written on mars 24th, 2014 ,

2ème degré REIKI 

Contenu    des    stages
SHK Symbole mental émotionnel
mental émotionnelcréé d’après la lettre

lettre sanskrite
    J’enseigne le deuxième degré de Reiki  en deux jours intensifs.

Contenu du stage 2ème degré de Reiki :

-réviser le Reiki du premier degré.

-4 Initiations, enseignement et explications complètes des multiples façons d’activer et d’utiliser les symboles « traditionnels » ;

+ HSZSN symbole de distance

+ SHK Symbole mental émotionnel

+ SKSK Symbole du coeur
+ CKR symbole de protection et de concentration de l’énergie

 -Utilisations d’un symbole seul ou/et en combinaisons avec les autres symboles.
De nombreux exemples, pour soi, au quotidien, sur les autres, et aussi à »distance ».

Partage en groupe des utilisations des symboles traditionnels dans : l’auto-traitement, le traitement pour une autre personne.

-le traitement à distance et le « beaming » ou technique occidentale : faire du reiki à distance à une personne ou un groupe  qui est dans la même pièce.

-Guérison des problèmes spécifiques, multi-traitements dans le passé, dans le présent et dans le futur, Reiki dans les dimensions, etc.

-Présentation des spécificités des quartz et des cellules du corps, de l’ADN en relation avec le cristal de roche.

-l’utilisation d’un cristal de quartz dans 7 à 9 situations possibles de traitements à distance.

-Mises en pratique de quatre façons d’utiliser le cristal pour envoyer du Reiki à distance.

-J’anime cet atelier en y apportant ma connaissance des minéraux et cristaux, Litho-thérapie et physique quantique lors du stage. 

-Méditations guidées avec les cristaux de quartz, et avec les symboles.

-Méditations Accompagnées de Bols tibétains.

-les initiations du deuxième degré bien sur.

-les initiations au symbole du coeur et les initiations des pieds (des 3 chakras des pieds).

-Pratiquer des traitements en direct et à distance avec les symboles et les quartz.

-Les techniques Japonaises de Reiki) : Jacky-Kiri Joka Ho, Laser Ho….

– Une matinée spéciale pour « décortiquer et explorer » le Traitement mental – technique de Mikao Usui – durant laquelle je vous enseigne les bases de la linguistique et du questionnement pour mettre en forme une pensée positive et obtenir la réalisation d’un désir profond.

* Avec mise en pratique sur un fait réel que vous pourrez « traiter » de suite !
* Cela s’accompagne d’une prise de conscience en douceur et d’une meilleure connaissance de soi.

-Explications sur des exemples de chacun des participants de LA GUÉRISON dans LE PASSE, suivi de la mise en pratique en méditation guidée.

-Enseignement de la méthode détaillée de LA GUÉRISON longue durée DU PASSE – qui est différente de la guérison DANS le passé !

-Support visuel, livret ou manuel du stage, et diplôme.

Les dates du 2ème degré reiki                           le tarif du second degré reiki 

– J’ai un parcours d’une vingtaine d’années d’enseignement du reiki mais me suis parallèlement formé dans diverses techniques…
DU d’Animateur d’ateliers d’écriture thérapeutique, DU de linguistique, 20 ans d’étude sur les chakras et l’ensemble du symbolisme,
acteur théâtre, master PNL, forgeron alchimiste, Yoga tantrique, sophrologue, Qi Gong Wu Dang 2, et initié à 5 Maîtrises de Reiki différentes…

Un vécu de guérison personnelle qui me permet de nourrir mon enseignement traditionnel du Reiki avec une connaissance sur l’émotionnel, les sentiments,

les peurs et les craintes.

L’étude du langage.

Depuis 3 ans je suis une formation de lithothérapie et de radiesthésie, ainsi que de Yoga Nidrâ et de Yoga du son.

Etude des lois de l’Univers et la physique quantique en lien avec le Reiki et les symboles du Reiki.

Ceci amplifie ma pratique du Reiki Karuna, du Reiki Komyo et Usui bien sur. Et l’ensemble de ma manière d’enseigner.


Written on mars 24th, 2014 ,

Mes opinions surL’éthique du Maître Reiki.

Le premier symbole Reiki Usui sur l’éthique du Maitre Reiki.

Un enseignant Reiki à Lyon un jour eu l’idée de donner à ses élèves le mot Reiki écrit en Japonais en leur disant que c’était un symbole ésotérique. Ce n’est ni « dangereux ni incorrect » mais, d’une part ceci n’apporte pas grand chose et d’autre part, dire que c’est un symbole Reiki, ce n’est pas très correct. Et bien sur, les Maîtres qu’il a formé continuent croyant bien faire…personnellement ce n’est pas mon-éthique.

 enseignant Reiki à LyonPour ma part j’ai été initié il y a 20 ans au 1er degré sans aucun symbole et c’était très bien. Par contre recevoir 4 symboles au 2ème degré j’avais trouvé ça dérangeant et compliqué à assimiler.
Mais j’étais destiné à enseigner professionnellement et j’ai travaillé durement avec ces 4 symboles étendant mes recherches bien au delà de ce que m’avait transmit l’enseignant de l’époque. Notamment sur les plans émotionnels et spirituels qui manquaient totalement à son enseignement. 

Il y a 15 ans environ, suite à un sondage, auprès des personnes pratiquantes du 2ème degré par rapport aux techniques à mettre en pratique après les stages traditionnels 2ème degré, ou sont transmis 4 symboles et des techniques de changement associées en seulement 2 jours, j’ai décidé de transmettre le 1er symbole d’ancrage, comme d’autres enseignants le font, au 1er degré. Et croyez moi, tous les élèves apprécient ! Déjà d’avoir un vrai symbole au 1er degré, ensuite d’avoir pu l’intégrer et se familiariser avec celui ci. Plus les effets positifs car toute leur attention est focalisé sur un seul symbole !

Ceci facilite leur vie lorsqu’ils passent le second degré et reçoivent les trois autres symboles.

Je sais que certains Maîtres, un tantinet séculaires, conservateurs, préfèrent enseigner comme autrefois et temps pis s’ils critiquent notre manière contemporaine de Maîtriser notre enseignement, mais c’est leur problème n’est ce pas….et non celui de l’évolution et de l’élévation spirituelle de la planète qui avance avec son siècle. Et l’évolution se fait Dans le changement.

Étant donné que le Reiki est un système énergétique quantique qui permet de faire circuler dans les cellules et l’ADN une énergie curative naturelle et cosmique, il peut arriver chez certaines personnes que des émotions enfouies remontent à la surface et provoque des situations inconfortables. C’est pourquoi avec une grande sagesse, qui est approuvée et  recommandée aussi par les fédérations de Reiki, il est « recommandé » de pratiquer le plus régulièrement possible 3 mois avant de passer le second niveau. Il faut prendre ici en considération que la majorité des Français sont impatients d’enchaîner les degrés de Reiki pour arriver le plus vite possible à la paix et la sérénité. C’est légitime et respectable, mais la précipitation n’amène pas le bonheur. Il en va de même entre le deuxième degré et le troisième degré ; questionnez les praticiens et élèves de Planète Reiki ils vous dirons tous que les six à neuf mois entre les deux stages sont hautement nécessaires et bénéfiques. Bien entendu, chacun est libre de passer le second niveau ou le troisième lorsqu’il le sent ou le désire. Un enseignant Reiki quel qu’il soit ne peut en aucun cas décider qui serait « prêt » ou pas, ni « forcer » à passer au niveau suivant.

C’est en chacun le cœur qui doit parler, résonner et guider l’être sur son chemin. Et bien souvent c’est en faisant des erreurs de précipitation, d’impatience, que l’on peut apprendre et  évoluer. Il suffit juste de reconnaître quand est-ce qu’on fait une erreur ou qu’on est impatient.

Dans le Reiki je suis une personne à part. Le monde en a besoin. J’ai longtemps été rebelle, artiste provocateur, me permettant d’être moi-même. Audacieux dans mes expériences mystiques et énergétiques et malgré quelques petits penchants encore non purifiés je sais que je suis un bon maître Reiki, et plus encore. Et je sais aussi que le monde a besoin de variétés, de différences. A mon sens le but du Reiki et de redonner à chacun son individualité et non d’imposer une globalisation. Car la seule cause de la souffrance c’est bien de ne pas être soi-même. La liberté, la vraie, c’est d’être soi. La violence policière que l’on voit aujourd’hui dans notre nation démontre bien que les gens qui « ont raison » veulent empêcher les autres d’être eux-mêmes. En connais tu le sens spirituel ?
Demande à ton cœur, à tes rêves ou à ton guide ce qu’ils en pensent.

Mes-opinions-sur        La manipulation

Il arrive parfois d’être excédé par une situation. Dans de telles circonstances l’esprit peut se trouver si encombré de ressentiments que la conscience n’a plus une seule petite place et ne peut intervenir. L’être agit alors « sans conscience ». Mais pas sans conséquence.



       Il y a des gens, qui ont dans leur entourage, d’autres gens, qu’ils insupportent. Même des praticiens Reiki, quel que soit leur niveau d’initiation peuvent se laisser assaillir. En voulant y remédier vite fait bien fait….ils dégainent plus vite que leur ombre. Brrrr !
Il peut arriver qu’à leur insu des praticiens Reiki, déroutés par le dérangement, envoient à distance des formulations Reiki et que celles ci soient faites comme « tentative de manipulation ». L’ennuie, c’est que même rédigé de manière inconsciente cet acte, un jour ou l’autre, se retournera contre l’expéditeur. Et bien sur dans tous les cas l’envoie à distance lui, n’aboutira jamais ; l’Univers infini ne valide jamais de telles demandes – sauf si…si le destinataire à lui même fait cela à quelqu’un un jour. Chacun aujourd’hui est en mesure de connaître la loi cosmique du « retour ». D’ou l’invitation au bonheur  « Fais aux autres ce que tu aimerais qu’ils te fassent ».

Heureusement, dans la boîte à outils Planète Reiki, nous avons ce qu’il faut pour y remédier, ce qui vaut mieux que culpabiliser. Planète Reiki, c’est l’énergie du coeur ; aider à comprendre que le « MAL » est éducationnel.
Je vous propose de partager un échange mail avec un praticien stagiaire, et vous verrez que le taux d’exaspération fait du « coupable de manipulation » une victime de lui même.
L’amour, n’est pas la chose la plus enseignée dans l’éducation nationale….mais il nous appartient de l’apprendre de nous même, grâce à la connaissance. Et aux symboles Reiki.

QuestionMerci Dom pour les mails des contacts de notre groupe du stage « Amazones »  et pour les photos  prises  en plein  boulot Reiki ! Merci encore pour ce don précieux transmis (j’en suis émue , je pense que ça t’étonne pas !) et je sais que j’en ferai bon usage. Merci pour ce  stage niveau 2 qui a été riche en émotions et  libérateur .  Je me suis organisée des plannings  pour recharger le cristal en envoie Reiki à distance, et pour faire mon traitement pdt 21 jours pour la confiance. 
Une question à te poser…j’ai un vœu URGENT à faire par rapport au boulot, un souci avec qqu’un  qui bosse depuis 1 an dans notre école, qui change toujours d’avis , et depuis ce  mardi elle fait C………… vraiment  , c’est une grosse  C …………. !!!!!  Elle fout la M ………dans l’école et  du coup dans l’équipe. Elle me sort par les yeux, je ne peux plus la voir  et  impossible de lui faire confiance .  Elle fait ses coups en douce. D’ailleurs une collègue avait eu des échos sur elle : que  c’était une emmerdeuse et une fouteuse de m…….. dans d’autres écoles et qu’elle répétait tout et n’importe quoi et qu’il fallait s’en méfier. Je dois voir le dirlo de l’école. 

Dans ma demande Reiki à distance, j’ai écrit ;  » je veux que  X……….parte de l’école maternelle …. . Je veux être respectée et soutenue par mes collègues et ma direction. Je veux garder ma place divinement. Merci. »    

  Qu’en penses tu ?  Pendant que je charge le cristal ; je visualise, je l’imagine qu’elle part de l’école et je suis libérée et contente.

Dom, réponse – Ce n’est pas correct du tout. La formulation de la demande à distance est incorrecte! C’est l’inverse de l’esprit Reiki tel que je l’enseigne et qu’il m’a été transmis. L’envoie à distance ne sert pas à changer les gens. Tu dois te recentrer et demander à l’Univers, au Reiki, à ton guide ce qui est juste pour toi et pour l’autre. Une emmerdeuse joue ce rôle pour voir comment vous réagissez – elle ne le sait pas bien sur. Si vous voulez que le monde change, c’est à vous de changer, pas rejeter ceux qui vous dérangent.

Il m’apparaît que vous avez une certaine difficulté de communication dans ce contexte, c.a.d ; ne savez pas exprimer en face votre colère d’une manière juste, objective, constructrice et non agressive.

Je pense que c’est sur cette émotion contenue – par l’habitude à l’école de la complaisance sans doute – que vous devez travailler. Car ce n’est pas la personne qui vous dérange, mais l’émotion qu’elle fait remonter et que vous contenez. D’autant plus important que dans les écoles de l’EN vous n’enseignez pas aux élèves l’art de compréhension de l’émotionnel et c’est très dommage. En tant qu’initiée au Reiki 2, avec les techniques apprises en stage et les symboles auxquels tu es initiée, en travaillant un peu ts ls jrs, tu en sera un jour à « montrer l’exemple » en ne réagissant plus avec l’ego face au dérangement.

voilà comment je remplirais la prière :
« Avec amour, ma relation à Melle X….s’améliore chaque jour. L’énergie du Reiki me permet d’exprimer mes ressentis d’une manière juste et loyale, profitable à tous et en accord avec les lois de l’univers. Merci. AMOUR AMOUR AMOUR« .

Et pense à ajouter au quartz un quartz rose pour l’équilibre du cœur.

Question, suitesi je  rajoutes sur mon papier : « merci de donner toute l’intelligence et la sagesse  au directeur Mr ……..  qui doit trancher« .

 Dans ce cas  je suppose qu’elle reste dans l’école .  C’est bien ça ???? Et du coup  la fouteuse de m………sera là . C’ EST URGENT car c’est à la FIN JUIN (soit 6 jours)  qu’on saura si cette nana reste dans l’école, après la décision de la Mairie. Pour plus d’intensité et de réussite  comment faire ????  Merci pour ton aide.

Dom – Le Reiki n’est pas un service administratif répressif ! En aucun cas on ne doit demander au Reiki d’influencer qui que ce soit, c’est de la manipulation. On demande au Reiki le meilleur pour le bien de tous. Le sachant, croyant, et en confiance avec l’Univers, en l’inconnu, on laisse l’Amour du Reiki agir, on n’attend rien. C’est la façon la plus sure d’obtenir le meilleur.
Même si parfois il faut insister longtemps ; ça signifie qu’il y a des résistances. Résistances au changement, résistances à faire confiance à l’improbable, résistance à aimer être guidé par autre chose que le mental et ses besoins. Résistances à accepter que les autres ne soient pas comme tu voudrais qu’ils soient, résistance à les respecter.

Vu l’urgence il est possible que la demande à distance n’aboutisse pas à cause du peu de temps et du manque d’expérience. Mais ce n’est pas une raison suffisante pour ne pas la faire. Ainsi tu montreras à l’âme du monde ta volonté de comprendre que « ce qui te dérange » ne vient pas de « l’autre » mais des mémoires en toi – et en tes collègues – d’une mauvaise ou fausse utilisation de l’autorité (colère juste)  et qui demandent à être clarifiées et transmutées. C’est ça ce que le Reiki 2 aime et sait faire. Applique les techniques apprises en stage en méditations guidées sur les guérisons du passé. Agis sur toi avec le Reiki et ton environnement changera, ça c’est l’Amour Reiki.
Et c’est pour ça que je l’aime tant.

Bonne chance dans l’amour et la lumière


MAI 2015           


La maladie la plus grave de toutes. Et pourtant, tout le monde court après elle. Un jour ou l’autre chacun réussi à la chopper. D’une manière, ou d’une autre.
Et à lui faire du mal.

          amour-reiki-sentiments     Pourquoi est-ce si difficile de conserver l’amour…pourquoi cela nous est il pratiquement impossible. Est ce à cause de ce modèle de vie qu’on nous enseigne depuis si longtemps, l’E.N – Education Nationale – apprendre par cœur, dans la tête et pas du tout avec le cœur. « on t’aimera mieux et plus si tu es premier »….se battre pour être plus fort que les autres, briller. Comme brille un caillou au fond de l’eau, jeté et laissé là, noyé dans son chagrin. Après de multiples ricochets sur le courant impitoyable de la vie sociale. Quelques fois dés le départ de la vie. Né échoué.

   Ça fait mal et c’est pourtant la réalité « on t’aimera beaucoup plus si tu es premier » ou bien « regardes , lui il fait ça bien – tu peux pas faire comme les autres non ? Pour une fois fais un effort ! regarde ton frère lui il…toi tu n’arriveras à rien, tu finiras comme ta mère… ». La vie couverte de pansements, de fard et de logos vestimentaires pour faire semblant que « tout va bien« , « je ne m’aime pas mais tout va bien ». Installation dans le besoin de plaire, de séduire, besoin d’être aimé et l’irrépressible peur de la solitude.

    Peu de gens ont cette chance de s’aimer vraiment et de se connaître à ce point d’avoir Foi en soi. Je me retourne souvent sur mon merveilleux métier, enseignant Reiki. Les premiers stages, les souffrances et les résistances, les deuxièmes stages et les secousses dont certains sont ébranlés, des fondations bâties si durement, à reconsidérer. Quelques mois après je vois les mm personnes avec leurs nouvelles physionomies une fois passées les affres du chaos intérieur, alors je me réjouis. Je n’ai pas été ferme pour rien. Douceur et fermeté, comme la rose et l’épine, le chemin de l’amour, naturel. Chaotique et imprévisible. Si on laisse l’amour nous guider on prend le risque de l’inconnu. Aller en soi, jamais seul avec le Reiki. Résultat…probable dit on en physique quantique. La liberté est à ce prix ; il faut en passer par là ; nettoyer les anciennes mémoires, les vielles et fausses croyances, la peur de s’aimer, la peur de déplaire et sarcler l’acceptation du plaisir et de la joie. Transformer la colère en volonté. Ça ne se fait pas sans bousculer l’intériorité confortable.

                            quantique-reiki-cordes  C’est là que le Reiki m’a touché ; dans le quantique. Dans l’infiniment petit. Atomes. ADN. Ces minuscules choses qui, ensemble, forment le gigantisme, le monde, et qui se laissent commander uniquement par l’amour pur et inconditionnel. Ne rien attendre, probabilité et soumission. L’Univers est extraordinairement précis.
Et sans faille.
Notre amour, notre amour social a des failles. Par lesquelles pénètre le mal être. Ou bien le mal être crée des failles dans notre amour social. Nos intentions sont distordues, observez le monde, ça crève les yeux et les tympans.
Nous avons pour nous aider à apprendre l’amour, deux symboles énergétiques. Le premier dans le système Usui et le second dans le système Karuna. Dés le départ de mon apprentissage Reiki l’Univers m’a bousculé lorsque je prenais mes notes pendant mon stage Reiki 2 et j’ai placé au stylo, ce symbole, symbole de l’Amour Inconditionnel, en 3ème position.

Un, connexion verticale, deux, calme émotionnel et mental, trois, l’Amour, et quatre la confiance en toutes choses. Quatre vertus, quatre symboles.

Je ne vois pas pourquoi, poète et artiste qui vénère l’amour je le métrais à la fin du protocole. Parce que ce n’est pas Mikao Usui qui l’a créé et introduit dans le 1er système Reiki…question pour un champion. Je ne suis pas un champion. Je suis, c’est tout. Mikao Usui est décédé d’une crise cardiaque, chakra du cœur, problème lié à l’amour, c a d manque de joie et trop d’efforts. Voilà pour ma réponse. Personnellement je crois que s’il avait eu vent de ce symbole, ou si l’humanité avait été prête a cultiver l’amour en 1921 il l’aurait reçu de l’Univers lors du Satori – l’aurait créé – et introduit dans son œuvre, le Reiki. Et la question, que je ne me pose pas, c’est ; en quelle position l’aurait il transmit, n° un, deux, trois…nous avons le choix car c’est Aujourd’hui qu’il nous est donné de cultiver l’amour laissé en friches mentales dans le coeur tous ces siècles. Sacré défi !

  Mon choix, depuis toujours, est d’enseigner le Reiki en mettant l’amour au premier plan et dans tous les domaines, toujours. Y compris le symbole du cœur que je mets au centre du protocole. Car Il n’y a pas de bon ou mauvais protocole, il n’y a que l’amour. Et si c’est fait par amour, alors l’Univers est complice. Je laisse les règles fixes rigides aux autres. J’y préfère les lois de l’Univers, le seul amour tangible, improbable et sûr à 100 %.

 son-3ème-oeil-chakra-gorge  Le son. Leçon d’amour. Le son entre par les oreilles – chakra de la gorge – et pénètre dans le cœur – chakra des sentiments – une pensée est un son. Une pensée négative, rageuse, jalouse, peureuse, excessive, obcésioneuse, chaleureuse, amoureuse, une pensée gourmande affamée rigolote méchante haineuse vicieuse videusedecomptesbanquairesdesautres   =  son.

Toute pensée est un son qui pénètre le chakra du cœur, absolument. Et lui, vibre résonne et donne à l’extérieur ce qu’il perçoit à l’intérieur. Ainsi se crée le monde. Par nos pensées. Et non par celles des autres…(sic…).

                Chantez l’amour et vous ne vivrez que l’amour !
Je chante un kotodama pour SKSK, par amour je l’enseigne aussi, fi des vielles règles rigides « y a pas de kotodama pour SKSK parce que c’est pas Mikao qui… ».…oui, mais il y a une prière ésotérique….et on ne chante pas l’amour ? j’ai toujours trouvé ça boiteux comme raisonnement, la raison, trop de raison  ment. J’y préfère l’amour.

C a d  j’aime la réflexion de l’Univers et sa résonance dans l’anse de mon cœur ; chante mon amour, chante la voix du cœur de l’Univers SKSK le son de l’amour.
Et je chante aussi CKS ! Et quand on chante CKS  ou savez ce que ça chante ?


Merveilleux non….je crois qu’il aurait été heureux d’entendre chanter un tel kotodama indépendant.

CKS ouvre le chakra de la gorge pour avoir de meilleures pensées, écouter le son intérieur et ouvrir le 3ème œil et laisser le son du cœur exprimer ses sentiments. CKS aide à chanter et SKSK aide à ouvrir les voix, les voies. L’audace d’Aimer.
L’amour, de soi à soi, ne se calcule pas, il se donne.

Si vous voulez laisser un commentaire, ça se fait en bas de page, tout en bas.

Février 2015
je-suis-charlie-7             Et , si dans le plan karmique de la nation, les distorsions politico religieuses sociales et financières étaient voulues et volontairement entretenues par les hauts guides spirituels – les êtres de lumière j’entends. Dans le but éducationnel  de nous montrer nos propres résistances aux changements, nos orgueils cachés derrière nos apparences séductrices, nos excès de politesse et de convenances…?
Notre devoir être gentils à tous prix. Hypocrites, sans doutes, par peur de ne plus être aimés. Nos parcelles de pouvoir que notre inconscient garde en mémoire à notre insu….? Et bien plus flagrant encore ; notre colossale résistance à partager et à nous ouvrir aux autres par peur de perdre notre attachement le plus ignoble ; au luxe. Ne dites pas que nous sommes parfaits, nous ne sommes Maîtres qu’en orgueil, et encore….
     J’envoie sans cesse à mes démons religieux politiques sociaux sexuels intérieurs du Reiki à distance en sachant que leur dissolution aura la même incidence sur l’humanité. Le monde est le reflet de ce que je suis, donc je regarde ce monde et ce qui me dérange je regarde ou ça me dérange. Je regarde ou en moi, ça me touche. Ou dans mon corps, quel chakra, quelle émotion me touche de voir ou entendre des gens faire du mal à d’autre gens ? Et, soit je me soigne, soit je m’en br….. et je m’occupe des autres, je cherche à faire du bien autour de moi manière de ne pas m’occuper de mes distorsions….je m’oublie et rien n’avancera…
Un jour j’obéirais à mon guide à 100 %, un jour, c’est prévu. Mais pour l’instant le monde nous renvoie nos imperfections politico religieuses internes – notre façon personnelle de s’interdire nos vrais désirs, nous mentir à nous mm pour nous faire croire que nos illusions sont la réalité.
On peut continuer de lui envoyer du Reiki au monde brutal, on en profitera tous au passage.

Om Shanti
Paix dans le Karma

Le Reiki Karuna – le Reiki de l’élévation par Acte de compassion.

La question que je reçois souvent.

« Bonjour. Je suis très intéressée par le Reiki Karuna mais j ai lu qu’il il fallait être praticien 3 eme degré; ne puis je quand même faire le stage après le 1er degré si je sens profondément que c est ce qui me convient? »

je le voudrais bien, croyez moi. Hélas ça ne vous servirez à rien de bien. Il est indispensable d’avoir purifié un maximum de mémoires anciennes – mémoires cellulaires du corps et souvenirs, le passé auquel s’attache le mental, éliminé quelques vielles habitudes – en pratiquant les auto-traitements assez régulièrement avec l’énergie du 1er degré, puis de faire le ménage dans l’esprit et dans le coeur avec les outils -techniques de changement et développement personnel appris en stage – grâce aux 4 symboles du 2ème degré Usui. Le 2ème degré fait le ménage pour préparer à accueillir la force du 3ème degré qui va éveiller la conscience. 
Arrivée à ce niveau d’éveil  Reiki 3 le Reiki Karuna peut être envisagé. Selon le degré d’évolution de la personne, le Karuna va peu à peu élever le coeur à la compassion par l’acte de compassion. Croyez moi, ce système est structuré de manière à vous apporter le bonheur, mais pas trop vite pour éviter l’inverse du bonheur.
       Je ré-initie régulièrement des personnes ayant passé trop rapidement les degrés. d’autres ayant été initiés par des profs Reiki qui mélangent à leur gré Usui & Karuna. Ils viennent « refaire » un stage car ils ne ressentent pas les effets ni de changement et surtout, leur corps leur signale « qu’ils leur manque quelque chose ». C’est pratiquement ce que toutes les personnes venant se faire ré-initier disent en stage « je sentais qu’il me manquait quelque chose ».
SAUF ! si vous avez déjà un parcours efficient – ce quelque chose d’autre qui seul active « effectivement », c’est-à-dire « efficacement » la maîtrise de soi sur les choses de la vie, en sorte qu’il devienne « efficient » produise ses « effets » – dans le domaine énergétique et dans l’auto gestion des émotions. A ce moment là on peut tout passer rapidement, car capable d’assumer seule les conséquences.  être guerrière quoi ! De la lumière bien sur.

14 Octobre 2014    Nos mémoires distordues

.ane-tetu-memoire-distordue..et si dans le plan karmique les distorsions politico religieuses sociales et financières étaient voulues, volontairement entretenues par les hauts guides spirituels pour nous montrer nos propres résistances aux changements, nos orgueils cachés derrière nos apparences séductrices et nos excès de politesse et de convenances…? Notre devoir être gentils à tous prix. hypocrites sans doutes par peur de ne plus être aimés. Nos parcelles de pouvoir que notre inconscient garde en mémoire à notre insu….? Ne dites pas que nous sommes parfaits, nous ne sommes Maîtres qu’en orgueil, et encore….

J’envoie sans cesse à mes démons religieux politiques sociaux sexuels intérieurs du reiki à distance en sachant que leur dissolution aura la même incidence sur l’humanité.
Le monde est le reflet de ce que je suis, donc je regarde ce monde, ce qui me dérange je regarde ou cela me dérange, je regarde ou en moi ça me touche de voir des gens faire du mal à d’autre gens et, soit je me soigne, soit je m’en br….. et je m’occupe des autres….je m’oublie et rien n’avancera…

Un jour j’obéirais à mon guide à 100 %, un jour, c’est prévu. Mais pour l’instant le monde nous renvoie nos imperfections politico religieuses internes, on peut lui envoyer du Reiki au monde brutal, on en profitera au passage.
Om Shanti
Paix dans le Karma

Juin 14     Nos différences

je-t'aime-amour-lapinL’un des plus grands défis dans notre société est d’accepter nos différences. Si j’ouvre mon cœur et regarde sans jugement ce qui me dérange chez l’autre je vais vite m’apercevoir qu’il y a en moi des choses qui y ressemblent. L’autre est un autre moi, particulièrement lors d’une relation un peu suivie. Au bureau, au travail, au club. L’autre peut être également une nation étrangère, des êtres ayant une culture, une religion, des meurs différents des miens, parfois allant à l’encontre des convenances de Ma culture. Le racisme commencerait là. Là ou l’autre nous dérange. Dans ma nation aussi ; il y a des humains qui ne pensent pas comme moi, qui ne mangent pas ce que je mange, qui ne vont pas là ou je vais, qui ne s’habillent pas comme moi, des gens qui font ce qu’ils veulent comme ils le veulent et non comme je voudrais qu’ils le fassent. Certains vont jusqu’à conduire pas du tout comme il faut conduire, d’après moi. Et se conduire. Avec les femmes. Avec les enfants. Et les animaux.Et  puis il y a l’autre, celle que j’aime le plus au monde après mon enfant, ma compagne. Bien différente de moi. Avec une méga dose de « trucs » en commun, nos atomes crochus. Nous, jumeaux réunis par l’Inconnu, par nos guides. Tant de grâce.
Les différences en couple apparaissent vite, on les contourne au début, on y rentre dedans dés que le couple commence à être en harmonie. Comme si deux saboteurs s’évertuaient à détruire l’espoir du bonheur. On pourrait lui dire «oui, tu as raison » à notre saboteur, et se contenter d’un échec, donner la voie de notre vie à nos peurs.
J’ai appris, j’ai mis en pratique, aujourd’hui je retransmet comment utiliser les symboles Reiki Usui et Karuna dans tous les domaines du quotidien. Idem avec l’idéal Reiki n°5. Le «chanel » du respect de la nature ; respect des différences autour de toi sous toutes ses formes. Y compris les «défauts » de ton amour. Car les mêmes sont en toi et la relation est là pour te les montrer à la loupe afin qu’Ensemble, on les transcende. Tantrique.
Heart, pour mettre de l’amour ou on en manque.
Rester égoïste, ne pas… « S’emmerder »…à vivre avec les différences de l’autre et les fuir à défaut d’avoir réussi à « passer outre », au lieu d’y mettre toute le force de Bouddha ; mettre de l’amour dans notre pensée là ou il en manque.Le Reiki est un système parfait et non manipulable ; on utilise le symbole d’acceptation dans le cœur, celui de la souplesse du mental et de l’émotionnel pour délier les exigences de l’ego, et le symbole de communication – gorge – pour demander au guide d’aider à voir ce qui ne se voit pas en nous et qu’on voit en l’autre.
Le travail avec les symboles et les idéaux du Reiki permet de nous connecter à tous les aspects de soi, ceux qui brillent et ceux qui demeurent dans l’ombre ; Nos différences en nous !  Afin de progresser vers notre vraie nature, celle ou on sait pouvoir être en paix un jour. C’est facile d’être en paix lorsqu’on est seul. Le grand défi dans la vie c’est d’être en paix face à l’autre.  Si l’autre nous dérange c’est qu’on n’est pas en paix. Un «autre » viendra bientôt nous le rappeler. Et puis un autre….et encore…
Alors c’est ici et maintenant, face aux différences, face à cette montagne, qu’il est bon de s’assoir et de méditer. Au présent.
 Dans l’espace Sacré du cœur.

Mars 14

Les grandes questions sur les mystères du Reiki

Dom –  Bonsoir….
je vous répond dans le texte…..

j’ai parcouru votre blog,j’éprouve une certaine attirance mais aussi une méfiance  vis à vis du reiki car je pense qu’il existe de nombreux charlatans dans ce domaine (attention je n’ai pas dit que vous étiez un charlatan !!!).

– Dom – des charlatants, il y en a dans tous les domaines, du médical à la politique, du garagiste aux policiers et des instits aux charcutiers….donc, dans les Maîtres reiki aussi…

J’accepte le fait que l’on puisse canaliser le chi de l’univers pour le donner à la personne en demande mais j’ai du mal à concevoir que les symboles reiki permettent cela comme par magie

– non, pas par magie, mais par fréquences vibratoires spécifiques réactivant la mémoire originelle de l’être.

– sachant qu’ils sont donnés au compte goutte en fonction du niveau et bien sûr des chèques….

– Je vous comprend, mais je rajouterais juste ceci en tant que professionnel de l’enseignement Reiki ; l’éthique, ce n’est pas une question de « donner des symboles » au compte goûte ni de chèques, mais de réaction émotionnelles chez les personnes correctement initiées, nous les guidons vers une progression de conscience et de taux vibratoire progressifs, un peu comme au judo nous passons des ceintures (ceci dit le judo coûte énormément plus cher puisqu’il faut s’abonner des années à un prof, voire plusieurs clubs dans une tranche de vie). Remarquez aussi que pour devenir chirurgien dentiste il faut du temps en années et de nombreux chèques.

si certaines personnes passent une maîtrise reiki et font à leur sauce leur enseignement, cela correspond à la politique sociale française ; attisant, artisanat d’art…et L’Art.
ces 3 étapes ne sont pas atteintes part tous, même avec de l’argent. Le reiki lui seul décide qui a suffisamment « travaillé sur son coeur et sa conscience » pour lui assurer le succès et la notoriété.
Comme les bons artisans et les vrais Artistes.

Donc voici mes petites questions:

-Qu’apporte un premier niveau reiki sur son évolution spirituelle et sur sa propre énergie ?

– Il n’y a pas de règles, les techniques et les symboles Reiki ne sont pas des prothèses. Les résultats seront en fonction de l’assiduité à la pratique qui vous est enseignée, qu’importe la discipline si vous activez un peu la régularité et le plaisir que vous cultiverez après un stage reiki. Si vous êtes prêt à vous prendre en mains et à les poser sur vous chaque jour pour canaliser le Reiki et en faire autant à autrui autour de vous, alors votre mental s’apaisera et vous y découvrirez plus de confiance en vous, un recul plus clair dans votre vie, votre corps s’assouplira et votre taux vibratoire atteindra la subtilité qui vous est propre ; celle qui est programmée dans votre ADN, vos gènes, prête à s’élever.
Mais cela ne dépendra que de vous.
Je veux dire par là que le reiki ne donne aucun résultats ou peu sur les personnes qui ne font rien de ce qu’ils reçoivent en stage, même pour les collectionneurs de stages.

– Pouvons nous faire des soins dès le premier niveau?

– Oui, absolument ! et diplômé.

– Devient on un « canal » pour transmettre l’énergie de la source?

– oui, dés la 1ere initiation, et il en a 4 dans le wend

– Est-ce que çà peut être dangereux si c’est mal employé?

– Pas du tout. ça n’est jamais arrivé depuis un siècle que le reiki Usui a été fondé.

il n’y a que l’humain et son comportement parfois inconscient qui peut être dangereux. Le reiki, le canal Reiki, ce n’est que l’amour de la nature, du bonheur.

– A quoi servent les symboles ?

– A activer une énergie spécifique dont la fréquence qui est propre à chacun des symbole ré-active le potentiel énergétique de l’humain qui a apprit à l’activer.
Ainsi on atteint l’éveil….grâce aux symboles – mais pas que – et le temps pour y arriver est fonction de chacun, des peurs, des croyances, de la pratique active ou inactive….des résistances et des espoirs, de l’audace, et de l’amour mis dans la pratique à activer les symboles.

– et comment sont ils utilisés?

– Le merveilleux du Reiki c’est que c’est simple !

Le malheur du Français, c’est qu’il est compliqué, crâne bourré pendant 20 ans d’école le détournant de ce qui est important : AIMER.

il y a plusieurs façons d’utiliser les symboles, on les apprend en stage, pas dans les livres, c’est l’enseignement du vécu, du coeur.

–  (incantation, pentagram … c’est de la magie?

– Peut être…seulement c’est vous qui être la baguette….les symboles vont vous apprendre à devenir le meilleur des magiciens ; c’est à dire à être VOUS.

-Est-ce que votre méthode garanti un résultat et sinon existe-il des personnes non réceptives à la technique ?

– Les résultats, donc, sont en fonction de chacun et de la façon de faire après le stage. Je garantie des résultats à celles et à ceux qui pratiquent, et il y en a un très grand nombre….toujours grandissant dans le monde. Les personnes non réceptives, sont à mon humble avis des personnes qui, sans le savoir ont peur de changer et de grandir, et sans le savoir sabotent ce qu’ils ont apprit en stage et abandonnent en disant que ce n’est pas pour elles….comme un robinet qui fuit, on le laisse fuir, on paye la note et les années passent.On n’apprend pas à s’aimer dans l’EDUCATION NATIONALE, n’est ce pas ?

-Comment se déroulent les 2 jours d’initiation  du premier niveau?

– De la manière la plus intéressante et la plus positive ; chaleureuse, studieuse, joyeuse, ambiance d’amour et d’humour, vibrations énergétiques s’élevant au fil du wend, émotions, découvertes de soi, découvertes des lois de la nature, pratiques et dons à l’autre et à soi, bons petits plats partagés, échanges d’adresse, rencontres et reconnaissance, gratitude. La vie, la vraie quoi, lorsque la terre et le ciel s’unissent pour notre plus grand bien. Découverte et mise en pratique du 1er Symbole authentique Usui, du bonheur.

– Pour info j’habite sur Nîmes .Pourriez vous me donner les modalités d’inscriptions , les horaires des stages et me dire s’il reste des places pour la prochaine session (en avril je crois)?

– Les horaires ; de 9h30 à 18 h, poses, repas…et à 10 h le dimanche. Tarif national ( environ…) 150 €. Pour vous inscrire ; envoyez un mot et un chèque d’acompte d’un montant de votre choix qui n’est encaissé qu’après le stage à l’adresse ci dessous, en retour vous recevrez toutes les infos et le déroulement complet du stage ainsi que le plan d’accès.
oui il reste de la place pour Avril…Mais faut pas traîner car fin Mars il y a le salon Sésame….


Ceci n’est pas un symbole du système Usui, mais le mot Reiki écrit en Japonais !


Bonjour, Je suis tombée par hasard (si on peut dire, mais je me doute qu il y ait un hasard ) sur votre site, qui me plait beaucoup car très explicite. Je me permets de vous écrire car je m interroge, j ai lu sur une de vos page que l ecriture du mot reiki n’était pas un symbole.  Je suis initiée au 1er degres de Reiki depuis le 8 decembre, mon stage a durer deux jours et j ai eu 4 initiations en tout. A la fin de mon stage, on m a donc dit de me faire un auto- traitement de 21 jours a raison de 2 fois par jour. Avant de commencer mon auto- traitement je dois m ancrer dans la terre puis me connecter au cosmos, une fois l ancrage effectue on m a recommande d écrire le symbole (Reiki en Japonais) dans les 2 mains. Taper 3 fois mes mains l une contre l autre en prononçant : Reiki ( 3 fois), puis en positions Gasho prononcer 3 fois : j appelle le Reiki , j appelle mon ange gardien, j appelle mon Guide Spirituel. Puis a la suite de tout cela je commence mon auto- traitement….
J aimerais savoir ce que vous en pensez s il vous plait, car j etais persuadée que le mot Reiki en lui même était un symbole. Bien a vous .n.

Bonjour N…
ça n’est pas grave du tout…l’essentiel étant que vous ressentiez les effets bénéfique du reiki…depuis presque 3 mois. 

C’est un maître Reiki de Lyon qui il y a quelques années à baptisé « Symbole » ce graphisme du mot Reiki, il l’a nommé « Logaem »…ayant initié des enseignants, ceux ci à leur tour disent que c’est un symbole. C’est pas grave, mais ce n’est pas correct. Surtout vis à vis de Mikao qui a tant œuvré à créer les symboles. D’autant plus que pour le dessiner sur les mains c’est assez long, il conviendrait de se faire faire un tampon…lol….à mon avis, les personnes qui donnent ce dessin pour un symbole, ça doit venir d’un manque de confiance en leur capacité d’initier ; donner un support pour que les autres aient « plus »confiance au reiki. et cela vient nécessairement d’un manque de confiance en l’autre. je lis toutes les exigences qu’on vous a enseigner pour pratiquer, j’y perçoit cette volonté de convaincre….afin d’être convaincu. 

Le reiki est merveilleux car il est simple. 

Une fois initiée on pose les mains et ça coule tout seul, on enlève les mains et ça ne coule plus. L’ancrage, l’appel ce n’est absolument pas nécessaire, ce sont des plus, des bonus consentis pour communier avec les forces de la nature, pour se relier volontairement au sacré de la vie, à l’essence du Reiki…j’appelle ça le rituel de préparation, on se défait des nœuds liés avec le monde social pour entrer dans la paix, le temps d’une séance de Reiki. Mais l’énergie reiki n’en est pas plus forte….c’est notre être intérieur Divin qui participe et retrouve sa vraie place au sein de nous, dans le chakra du coeur, l’amour infini du monde, dans le noyau divin en nous. On l’active, ou ne l’active pas ; « je me fais du reiki, je souris, je remercie, je m’aime, je me fais du bien » – « je fais du reiki à X…je souris, je remercie, je lui donne de mon temps et le reiki coule en lui s’il le désire »….
Quand aux vrais symboles Usui, et Karuna, ils s’activent d’une manière très simple et joyeuse.

un auto traitement par jour est parfait ! En exiger 2 à mon avis cette personne à une volonté farouche à vouloir changer le monde. Mais si vous arrivez à trouver le temps de vous faire 2 soins reiki (d’1 heure ? chaque ? ) vous devez avoir une patate d’enfer ! Et combien de soins donnez vous aux autres en moyenne par semaine ? 7, 8 ?….! 

Pour revenir au symbole Reiki, un symbole active une énergie spécifique qui vient s’ajouter à l’énergie propre du Reiki.
Et pour répondre à votre interrogation, on ne le dessine pas que sur les mains…!! si vous saviez …ça ne serait pas supportable avec « Logaem ».

Février 14

Une pensée sur la prévention

Lorsqu’il s’agit de prévention, généralement en France nous pensons épargne, retraite, sécurité sociale, assurances tous risques, réserver un emplacement aux pompes funèbres, nous pensons ; « au cas ou »…
Il fut un temps ou cette façon de penser était nécessaire et bien venue, après une peur panique nationale importante, la perte d’une guerre par exemple. Ce souvenir rend fébrile. L’ego a tendance à se refermer sur ses défaites, la peur de reproduire l’échec lui fait croire à une vision négative du futur, alors il engage des frais des lois et des règles terribles et obligatoire pour tous, forçant la vie à se contraindre à son autorité armée de gadgets, serrures, alarmes, pilules, check-up, règlements. Et… vaccins.
Mais la vie elle s’en fout ! Car c’est pas ça, vivre.

J’ai dressé ce portrait un peu rapide juste pour constater que tout – ou presque tout- est prévu…pré  vu, vu à l’avance – prévention – pour le « cas ou », mais seulement à l’extérieur de l’être. Heureusement en praticiens Reiki on se retire de ce fléau, tout bonnement en se calant confortablement dans l’idéal de Mikao – le 1er des 5 idéaux ; « Juste pour aujourd’hui demeure libre de toute pré-occupation ». 

Pour l’instant aucun gouvernement Français, aucune autorité publique n’a comprit l’intérêt d’orienter la prévention vers l’intérieur de l’être. Peut être que la raison en est que ces « âmes » ne vont jamais en elles sonder leur conscience et leur coeur pour voir ce qui conviendrait le mieux pour gouverner et diriger la nation vers une paix intérieure puisque, on le sait maintenant, créer la paix extérieure ils n’en ont jamais été capables. Excepté pour leur confort financier. S’il faut des chiffres en voici ; les prisons sont pleines, les hôpitaux sont pleins, les cliniques sont pleines, les hôpitaux psychiatriques sont pleins, les centres de redressement sont bondés, les assistantes sociales sont débordées, les villes sont envahies par des hordes de voitures souvent coincées en embouteillages qui énervent les êtres et ils s’engueulent les uns les autres.  La circulation le matin et à 18 h se fait dans l’agression honteuse des « klaxonnons des mots orduriers ». Injures à l’intérieur des voitures apparemment « jolies » mais qui reflètent une illusoire apparence de l’être et non la richesse intérieure, hélas. les rues sont parsemées de mendiants et les « gardiens de la paix » sont toujours armés ; comme au mayen âge l’étaient les gens d’armes, ce qui est représentatif de l’échec d’harmonie entre les citoyens. Quand aux problèmes dans les écoles ils vont en empirant de la même façon que le stress suicidaire au travail dans les soit disant »grandes entreprises » mais n’attons pas envie de les appeler « entreprises de surproduction ».

Les ordures débordent, autant alimentaires qu’emballages. Et…nucléaires.

On voit bien que les masses dirigeantes ont tout prévu, bravo.
Prévu = pré-vue = voir à l’avance.

La pratique des diverses techniques énergétiques, celles également comme le reiki dés le niveau 2, de développement personnel, vont, dans un premier temps, réparer l’être d’un stress qui ne l’a jamais concerné ; puisqu’il lui a été de tout temps imposé par la peur des dirigeants. Voici une phrase d’Elisabeth Cluber Ross qui confirme cela ; « Pour devenir un être authentique, spirituel, il faut laisser parler l’intuition, la partie de nous qui sait. Les décisions fondées sur la seule raison sont généralement prises face aux autres. Alors que les décisions intuitives nous font plaisir au risque de nous rendre ridicules aux yeux des autres. Mais en devenant authentiques, on apprend à se désintéresser de l’opinion d’autrui ». Coluche fut un être du coeur Intuitif. Le Reiki Usui et le Reiki Karuna sont conçus avec un système d’activation de symboles ésotériques qui peu à peu permettent à l’être d’écouter son intuition, de se découvrir et de se comprendre, de rectifier ses pensées de peurs et l’énergie canalisée par les mains sur lui et sur autrui agit en prévention saine et fiable pour sa santé physique mentale et émotionnelle. Une réparation optimale spirituelle personnelle.
La pratique du Reiki, la plus régulière possible, est en matière de prévention, la meilleure façon de penser ; ne te pré-occupe pas ; occupe toi ; fait du reiki et ton avenir s’éclairci.
Parfois c’est long à éclaircir, il y a des karmas chargés, plus pour certains, moins pour d’autres, les fuites de responsabilités et de discipline sont souvent liées à des réflexes conditionnés par les avatars, personnels, ou ceux des dirigeants – qui dictent influencés par leurs peurs – souvent la peur du manque, le manque de confiance en soi, d’ou le choix de métier de pouvoir sur les autres afin de se sentir moins seuls.

je pense qu’un jour le reiki sera enseigné dans les écoles. De plus en plus de parents praticiens font initier leurs enfants au reiki. J’ai initié plusieurs parents à la Maîtrise de Reiki car ils souhaitaient initier leurs enfants et ceux de leurs deux familles. L’effet boule de neige est irrésistible ; au printemps tous les arbres fleurissent. Plus il y aura d’enfants initiés au Reiki et plus ces enfants seront dans l’auto discipline et vivrons dans la non peur. Peu à peu ils donneront aux autres enfants l’envie de pratiquer eux aussi le Reiki Usui. C’est cela pour moi, prévention ; agir au plus profond de soi.
Dom Jeambrun

Reiki-hopital-clinique-ReikiVoici un article qui vient des USA ou le Reiki est largement pratiqué ; pour en savoir plus…ici.  

South County Hospital, 100 Kenyon Avenue, Wakefield, RI, USA, propose de séances complémentaires de Reiki.
Le Reiki est une technique d’imposition des mains pour la réduction du stress pour le corps et pour l’esprit. Les recherches indiquent que le Reiki peut réduire la douleur et l’anxiété, améliorer la qualité du sommeil, stimuler l’appétit, ainsi qu’accélérer le processus de guérison des patients.
Pour demander un traitement de Reiki, parlez à votre infirmière ou appelez le : 401 788-1981.
Source : http://www.schospital.com/Services/…


Novembre 2013

La colère et L’idéal de Mikao

Un échange d’Emails, suite à mon propos sur la polémique au sujet des maîtres Reiki plus ou moins compétents…lire ici – l’article de sept., sous cet article de Nov.

X _ Bonjour je ne suis pas tout a fait d’accord avec certains points…
une personne mal initiée peut se trouver polluée par le Maitre Reiki, et oui, il m’arrive de voir cela lors de soins énergétiques que je pratique et bien plus encore. Non il n’est pas anodin de choisir le bon Maitre Reiki et encore plus de se faire initier par n’importe qui, trop de personnes abandonnent les soins car l’initiation n’était pas accompagnée d’un minimum d’informations et d’un maximum de spiritualité. Il ne suffit pas de transmettre simplement des symboles encore faut-il les avoir testé et vérifié comment ils fonctionnent, mais ça….c’est une autre histoire.

Dom – Dans l’article je ne critiquais pas les « mauvais maîtres ». Je critique certains comportements d’un peu toutes les corporations, le système. Relisez le texte peut être vous comprendrez mieux… Sachez tout de même que j’ai rencontré des personnes maltraitées par des magnétiseurs et par des guérisseurs, dupés également par des personnes œuvrant dans l’humanitaire. Moi même j’ai été fortement déçu lors de soins que j’ai reçu par des magnétiseurs il y a une dizaine d’année. Dans tous les corps de métiers il y a des incompétents,  la faute en serait à une éducation archaïque basée sur les règles d’un passé révolu. Hier encore, en stage Reiki niveau 2, un moment émouvant lorsque nous abordions une technique pour soigner les blessures des suites des lacunes du passé. 12 témoins…des adultes…qui étaient jadis des enfants, à l’école.

Je maintiens mon propos qui consiste à dire que le Reiki ne peut pas polluer une personne et ne l’a jamais fait depuis un siècle. Une personne initiée à la maîtrise Reiki ayant un comportement négatif, peut nuire, mais jamais le Reiki ni les symboles qu’il canalisera. Le Reiki protège mais certaines personnes sont destinées à être victimes, et donc, c’est triste mais il leur faut des « bourreaux ». Sans bourreaux il n’y a pas de victimes, et vice versa.
Alors s’il y a des gens qui initient mal d’autres personnes, ce sont ces gens qui polluent, pas le Reiki. Ni le Titre de maître.
Le Reiki lui, va attirer les personnes l’une à l’autre pour tenter de leur faire apprendre une leçon par l’expérience qu’ils vont vivre ; une confrontation de 2 miroirs : la victime et le bourreau.
Le ciel a toujours été neutre, respectant le libre arbitre de TOUS. Le Reiki c’est l’intelligence du ciel. Cette énergie ne peut en aucun cas polluer. Les symboles encore moins.

Les personnes que vous soignez se polluent d’elles même ; elles ont besoin d’entrer en contact avec des gens nocifs pour enfoncer le bouchon en elles, et ensuite elles les accusent de leurs maux à défaut de savoir comment regarder en elles. Je crois sincèrement que la pollution que vous avez vue, ou croyez voir, doit venir de leurs peurs et de leurs résistances, des crispations dans le chakra du coeur qui certainement remontent à l’enfance. Vous devriez peut être vous méfier de l’autorité à croire le mental qui dit « c’est le Reiki qui a fait ça ». Je m’en tiens à mes 20 d’expérience avec le Reiki, y compris avec le nombre de personnes « mal initiées » que je ré-initie, y compris le nombre de personnes que la médecine à condamnées comme incurables et que j’ai soignées et initiées et qui s’en portent très bien.

X _ Il semblerait que vous n’ayez pas très bien compris mes propos. Je n’ai pas dit que le Reiki était pollué. Relisez le texte, peut être vous comprendrez mieux…

D –oui vous avez raison, j’ai relu votre texte et vous avez écrit :  pollué par un maître reiki….j’ai réagis à votre commentaire car votre langage comprend  autre chose : maître Reiki pollueur = le reiki pollue.

le langage, déformé….et ainsi le vrai devient faux et sème la confusion.

Effectivement il ne suffit pas de passer un stage de maîtrise pour être Maître – Maîtriser le Reiki et les symboles. Nous sommes d’accord. Mais il y a d’autres corporations ou le personnel comme les dirigeants « polluent » – pour reprendre vos mots – alors à quoi bon polémiquer et continuer de critiquer des personnes en manque de puissance intérieure dont la faute serait due à une simple paresse de travail sur soi en profondeur…

X _ Je ne débattrait pas non plus sur vos propos car vous semblez ne pas connaitre du tout l’énergétique.

D – « ne pas connaitre du tout » , vous ne pensez pas que c’est un peu excessif comme remarque ? Un peu agressif même ?
Il y a 3 semaine j’ai initié 2 magnétiseurs, et ce wend 2 radiesthésistes…la qualité de nos échanges est d’une belle équivalence, vous le savez très bien. Et le nombre augmente chaque trimestre.

X _ Je vous renvoi au principe Reiki qui dit : « Juste pour aujourd’hui, ne te mets pas en colère ».

D – Faux !

Désolé, mais je ne peux pas vous laisser « polluer » le Reiki. La phrase que vous citez comme un idéal est une doctrine, non pas un principe Reiki. Elle peut venir d’une personne pratiquant le Reiki et l’ayant modifiée pour l’adapter à ses croyances propres, c’est assez fréquent. Voici mon opinion :

le Reiki est un Qi gong Bouddhiste influencé par le Shintoïsme, le Shintoïsme consiste, entre autre, à communier avec la nature.

Ors la colère est une émotion naturelle, dont on ne peut d’aucune façon se débarrasser, elle est implanté dans le 2ème chakra, le chaudron magique des émotions ( vous semblez ne pas connaitre du tout l’énergétique…lol).

Le principe reiki de Mikao est : « demeure libre de toute colère ».

Demeurer = être libre de ressentir de la colère sans se préoccuper de la morale, ni si ça dérange les autres, être libre sans aucun jugement = RESSENTIR de la colère. Cela ne veut pas dire que c’est bien de se mettre en colère, mais simplement de reconnaître quand on est en colère, et ainsi voir d’ou elle peut venir.

Une fois cette émotion accueillie, il convient de voir si on veut rester avec ou pas, et quelle technique est adéquate pour s’en libérer (principe des 4 vérités fondamentales de Bouddha), et, Mikao en bon Japonais pratiquait aussi le Bouddhisme – le Zen et bien sur le Shintoïsme. D’où l’idéal : demeurer libre. Responsable, jamais coupable.

« ne te mets pas en colère » est une phrase affirmative négative : un ordre : on t’interdit de faire ou d’être. On t’interdit de vivre libre : sois sage, soit poli, ne te mets pas en colère parce que je n’aime pas ça. cette phrase emprisonne = NE PAS = affirmatif négatif.
J’ai même lu ce mois ci sur le site d’un Maître Reiki « juste pour aujourd’hui, ne t’énerve pas »….

Il y a des gens qui passent un stage de maîtrise et sans faire un gros travail sur eux se disent « Je suis maître reiki ».

Car il n’y a pas assez d’amour pour le faire. (Rare Bird, The compassion)

Ps : j’espère que vous n’êtes pas susceptible dans la confrontation….ça serait triste étant vous même dans l’énergétique….

Septembre 2013

la Dilution du Reiki et le 2ème chakra.     septembre 25, 2013.

« la vie n’appartient pas aux mains rapaces qui la vendent, la violent, la manipulent et la dominent.
Elle ne se donne qu’aux yeux ouverts  qui la contemplent. »C.Singer.

Selon certaines sources, il y aurait des mauvais Maîtres Reiki… !?!
à mon avis, les « mauvais » Maîtres Reiki font juste partie du grand miroir, le reflet des lacunes de notre société.
Le 2ème chakra est le chakra du partenariat et le 1er est le chakra de la famille – famille = la nation.
Le 1er degré Reiki agit sur le 1er chakra, le 2ème degré agit sur le 2ème, 3èmes et 4ème chakra.
Le 3ème degré agit sur le 6ème, 5ème et 2ème chakra. La Maîtrise agit sur le 6ème et 7ème et 1er chakra. Chaque degré de manières différentes et augmentatives.
Si on pratique le 3ème chakra se libère en douceur !

Je reçois souvent des mails de personnes initiées à un ou à plusieurs degrés de Reiki, mécontentes de la façon dont se sont passées les initiations, manque d’informations sur les symboles, symboles incorrects, ou ne correspondant pas au degré passé, techniques des enseignements traditionnels et réactualisés qui leurs sont inconnues ; on ne leur a jamais apprises, insuffisances de suivi après  stages et bien sur, tarifs très fantaisistes….je lis souvent des manuels que ces personnes m’amènent lorsqu’elles viennent refaire un stage, des exigences de la part des enseignants qui relèvent plus de la prise de pouvoir que de l’éthique Reiki…je trouve ça bien aujourd’hui…et je voudrais partager mon opinion…

Je suis fréquemment amené à parcourir le net à la recherche d’un Maître Reiki fiable suite aux demandes de personnes éloignées et il m’arrive de  lire sur certains sites des critiques sur les « mauvais maîtres » et cela me fait sourire aujourd’hui, après m’avoir peiné bien souvent.
Bien sur l’enseignement du Reiki peut se diluer dans la retransmission et c’est tout à fait normal. Passer la Maîtrise de Reiki sert avant tout à approfondir le travail sur son ego afin qu’il devienne un allié, un ami, et non plus un alibi pour prendre aux autres ce qu’on ne peut se donner à soi. Mais il faut reconnaître qu’une introspection en profondeur n’est pas chose facile, même avec les outils des 4 degrés voir 3 degrés supplémentaires Karuna, et plus encore avec des outils de développement personnel collectionnés. Il faudrait, comme l’a si bien écrit Louis Calaferte, descendre dans les basses fosses sexuelles pour y dénicher les insuffisances de l’enfance tapageuse et râleuse et les mettre en lumière douloureusement pour se voir mis à jour de la manière la plus positive et libératrice. Et la plus divine car la sexualité est la part divine en nous qui mérite aujourd’hui d’être proclamée jouissance sacrée. Elle découle du 1er et du 2ème chakra là ou se cache notre vraie personnalité et non pas celle imposée par…l’éducation. L’énergie sexuelle alimente en énergie créatrice le chakra de la gorge qui est le plus important des 7, car il est le centre de l’expression et la créativité. Et le centre des choix – choisir est le plus beau cadeau de la vie !
Transcender l’énergie sexuelle en énergie créatrice commence par la libération des besoins de l’ego au niveau de la reconnaissance de soi – 1er degré Reiki ; enracinement et confiance.  Cette foutue reconnaissance de soi que tout le monde cherche sans savoir ou la chercher ni comment. Et bien il suffirait d’appliquer dix fois par semaine les techniques Reiki enseignées en stage, et en particulier les Maîtres nouvellement formés, ceux qui veulent enseigner, devraient s’y atteler pour acquérir peu à peu la reconnaissance de soi.
Car ces techniques sont bel et bien efficaces, mais il conviendrait de les appliquer abondamment avant de les enseigner.Bouddha-respect-communion-sexualité

Jamais je ne les blâmerais de ne pas s’engager à fond, c’est un chemin difficile, même si au bout c’est le plus beau. Il faut du courage et de l’obstination pour y marcher droit et sans broncher lorsque surgit une émotion fermentée depuis l’enfance voir de plus loin. Et pourtant….ce n’était qu’une émotion… Encore faut il avoir été correctement initié et pas qu’à la Maîtrise mais dés le 1er degré. C’est idiot, on pourrait dire qu’il faudrait être très malade ou accidenté pour être « obligé » d’utiliser à fond les techniques Reiki et se rendre compte à quel point elles sont miraculeuses et font grandir en conscience, mais tant que tout va bien….on se prélasse, on attend. Et on rouspète. Je le sais, je l’ai fais aussi, paresseux…mais paresseux diplômé.

Ou est le mal…nos dirigeants seraient ils malhonnêtes, montrent ils un exemple à suivre déplorable, axé sur la rentabilité – bettencourt sarkozy et ainsi de suite depuis Charlemagne – fixation sur la propreté et l’hyper sécurité, pas du tout sur l’amour des autres. On pourrait appeler ça ; manque total d’éthique de partenariat – je reçois des SOS de stress en entreprise…en plus de le lire dans la presse – partenariat ou communion – commun  union, union commune : respect considération partage répartition générosité bonté don libéralité compassion indulgence tolérance écoute et curiosité de savoir qui est l’autre, d’où vient sa voix…ne sont pas les slogans de la république. Ni mis en avant dans les soi-disantes-savantes-écoles-de-l’éducation-nationale. Hélas.

Ainsi, il y a des mauvais hôtels des mauvais chirurgiens mauvais fruits croissants restaurants garagistes des mauvais services internet, des vêtements de basse qualité alors que les couturières sont capables de faire bien mais ça ne serait pas rentable alors on les force à bâcler et les ourlets se défont, l’immobilier et la banque n’en parlons pas – l’argent est pour eux une marchandise aux dépend des autres – le téléphone idem et même pire, on nous pousse à être bio écologistes et c’est bien, mais on laisse les industriels nous submerger d’emballages plastiques inutiles sauf comme antivols à l’étalage. Par le manque de partage équitable on encourage le vol….ect….ect.

Conclusion : tout le monde est pressé, y compris les Maîtres Reiki qui vont trop vite et oublient l’importance de Hszsn et du Divin. Dommage pour eux, ils se privent du meilleur. Et en privent ceux à qui ils.

Nous sommes des mécontents ! Le Reiki aide à mieux voir le monde tel qu’il est et nous aide à mieux choisir. Une personne soit disant mal initiée est pour moi une personne ayant été mise en contact avec le Reiki et un jour ou l’autre la graine semée, même de travers, va la conduire vers un autre enseignant Reiki, lui permettre de mieux choisir. Il en est ainsi pour tout et pour tous, le choix ! Le Chakra de la gorge !
Ne nous plaignons plus, nous sommes éduqués à produire et non pas à penser et à choisir avec le cœur. Nous devons nous rééduquer et nous réorienter afin de trouver notre vraie place dans le monde. À commencer par notre vraie place en nous même. Alors faites vous initier par qui bon vous semble, amis dans le pire des cas ; pratiquez.
C’est gratuit, mais ça, pratiquer, ça paye !


Written on septembre 25th, 2013 ,

Questions Réponses est un échange.
Les Questions Réponses, c’est un échange avec les praticiens Reiki Usui Karuna et Komyo reiki- Kai.

Les Questions Réponses

Tout’ ces questions dans ma têt’
Machine sourde et tempête….

Questions = Réponses.
Nous ne sommes ici que pour apprendre, pas pour réussir.
Et c’est idiot vraiment de punir les erreurs et les fautes dans les écoles et dans la vie car c’est grâce à elles que nous apprenons. …mais tandis qu’on enseigne et pratique la voie de l’unité d’autres exigent la réussite à tous prix.  C’est le culte de la réussite qui est à blâmer, pas l’échec.

Mai 2016….

soirée-partage-reiki-juvignacClic sur « Le Slam Reiki« 


Mai 2016

Travailler l’Ancrage

Yv. – Est-ce que tu peux me donner des recettes pour travailler mon ancrage stp ? Je me fais une séance de Reiki chaque matin, et une le soir aussi. Plus un à deux rééquilibrages des chakras comme tu nous l’as expliqué lors du stage. Merci d’avance pour ta réponse.

Dom – pour travailler l’ancrage il convient de travailler avec les cinq idéaux, chaque matin et chaque soir, afin qu’ils deviennent des réflexes conditionnés tout au long de la journée. Cela aura pour effet d’accepter la réalité telle qu’elle est, la réalité du présent mais la réalité du passé également. La famille la petite enfance et adolescence, le monde tel qu’il est, toi comme tu es… etc. Ceci concerne l’ancrage du chakra racines.

  • Tu ne dois pas oublier de pratiquer les 5 idéaux de Mikao au quotidien; il y a les deux feuilles que je donne lors du stage en japonais avec des traductions et explications en français, et il y a aussi dans le livret du stageManuel de reiki – un paragraphe pour chaque ; tu peux en lire un par exemple– pour t’en imprégner – avant une séance de Reiki.

Également tracer le plus souvent possible CKR sur chaque chakra en commençant par le bas ; avec cette pleine conscience qu’il réunifie ton esprit et ton corps et la confiance en l’univers et en la terre. Et ne pas oublier de le tracer sur les reins, protéger les reins et y penser ; vider la vessie avant un soin. urine = eau= émotions.

Il convient aussi de faire un ancrage dans le corps causal. Ça concerne le chakra de la gorge. Représente l’expression de toi ; assumer tes choix, devenir confiante en ton intuition et tes ressentis, tes idées tes opinions ta façon d’être ta confiance dans l’avenir. C’est un chakra que l’on commence vraiment à travailler au troisième degré Reiki. Mais il est nécessaire d’en assurer les bases pendant le premier degré, puis de faire le nettoyage pendant le deuxième degré.Tu devrais également travailler l’ancrage en suivant un cours de Qi Qong hebdomadaire afin de faire les exercices chez toi. Le Qi Qong est très complémentaires au Reiki.
Estime de soi et arthrose
X…  – je suis initié au premier degré Reiki depuis un mois ou deux par toi, j’ai de très bons résultats en donnant des soins – je suis thérapeute  – mais voilà ; je suis un peu ennuyée, un peu déçue et triste: la semaine dernière, je reçois une femme que j’ai souvent vue en soins dans mon cabinet,( arthrose, solitude, souriante et dynamique), très contente d’un premier reiki qui l’avait beaucoup détendue et soulagée. Mais cette fois j’avais l’impression de lui envoyer de l’électricité: je suis restée peu de temps et seulement sur tête et dos. Elle avait de petites secousses et la séance l’a fatiguée, moi je me sentais bizarre. Pas de détente, et elle m’a dit s’être sentie vidée deux jours durant. A priori aucun bénéfice dans les jours suivants.

Dom –  il se peut aussi, et surement mm, que cette personne avait besoin de recevoir le reiki de cette façon ce jour là. Pourquoi ? parce qu’elle a de l’arthrose – sous estime de soi – solitude = manque d’amour de soi dans le féminin intime – et malgré « ça » souriante !!!…elle compense ses vides intérieurs par de la sur-activité pour se prouver qu’elle existe…..donc : explique lui cela en lui disant que le reiki l’a secouée parce quelle devait être secouée. Et que le reiki lui a faite remarquer qu’elle devait se reposer…. explique lui que grâce à ces symptômes que le Reiki à activer avec bienveillance c’est une chance pour elle de mieux se connaître et d’entamer un processus curatif. Dis lui qu’un médicament ne lui aurait pas permit de se connaitre plus en profondeur…..dans ces cas : il convient de continuer les soins reiki au moins durant 4 jours….

x … – je me sens mauvaise, pas mauvaise thérapeute mais personne mauvaise. Que tous mes défauts mes mauvaises pensées paroles…etc …sont la cause.

Dom – impossible ! Sauf si tu dégageais une volonté à vouloir la guérir ou lui faire du bien, par ta volonté – donc ton énergie – au lieu de lâcher et laisser faire le Reiki. car le reiki est TOUJOURS JUSTE.

X… –  je suis triste  pour elle, je n’ai pas fait de reiki depuis, sauf sur moi et une de mes aînées qui me le réclamait. Ma fille aussi a eu de petites secousses et m’a dit ressentir comme « un courant électrique » mais elle se sent beaucoup plus détendue depuis et n’a presque plus mal au genou. Mais quand même, je pense à cette dame. cela me fait un peu peur.

Dom  – ta fille n’a pas les mm symptômes que la dame. rappelle là, explique lui ma réponse. C’est ton devoir de thérapeute praticienne reiki, et pour toi et pour elle et pour l’âme du monde.
La liberté d’être

Dom – Ma liberté d’expression, ma façon d’expérimenter l’enseignement du Reiki.
j’ai toujours considéré important d’offrir un partage à chaque stage ou séminaire. Ça me manque lors de la pratique hebdomadaire comme un cours de judo de musique ou de danse, de sculpture peinture écriture…Au Dojo Planète Reiki il est bon à chaque fois de se retrouver de se réunir, de faire un symposium. Partager un thé avant la séance et un repas après la séance, en atelier et bien entendu en stage.
Autre chose, concernant la liberté de mon enseignement – les plus – je Considère que dans un groupe les autres font parti de soi, le flux et reflux extérieur de ce qui est à l’intérieur de soi. Et c’est dans ce sens que je prends en photo quelques situations lors de vos stages, afin qu’au-delà du visuel vos âmes se sentent rattachées les unes aux autres. Pour moi c’est aussi ça, l’esprit Reiki. L’esprit Komyo.

…et liberté suite à la pratique Reiki… 

R – Pour une fois j’ ai réussi a appliquer une notion abordée en pnl ; d’habitude j’ai tendance a en faire trop et me fatiguer pour très peu de résultat; à peine quelques jours après le premier degré de Reiki dans la yourte avec toi, cette fois 20% d activité et 80%  d’efficacite !

Dom – Excellent ! En fait je suppose que tu as été à l’essentiel, un peu à l’image de CKR, tu as rassemblé tes énergies qui s’éparpillaient en satellites, grâce au Reiki tu as pu rester centrée rassemblée au lieu de contrôler et de t’éparpiller. Bravo !

R  – ex : je travaille sur le non dit depuis des années ;je viens de comprendre une nuance c’est sur la notion de liberté ; être libre de. Pas au sens « humain » mais un peu comme l’amour universel ;la liberté universelle ;je ne sais pas si cela fait écho en toi ;j ai beaucoup ressenti cette notion en stage et tu as répété je ne sais combien de fois le mot libre; le choix; si ca vous convient etc…

Dom – C’est exactement ça. Remarque : la notion de l’esclavage, la soumission, l’emprisonnement, s’applique également à la loi de la liberté universelle ; la prison la soumission l’enchaînement à son maître, c’est l’être lui-même qui le fabrique qui le crée.  Ce que j’ai appris dans mon cheminement pour acquérir la liberté c’est que longtemps on se trouve dans une prison, d’accord, mais en y regardant de très près on se rend compte que la porte n’est pas fermée et qu’il n’y a pas de cadenas… donc qu’il n’y a pas besoin de clé… Il suffit d’ouvrir et de laisser entrer la lumière la chaleur la simplicité et la fluidité… et de respirer…de l’air libre. C’est ça. C’est ça ; on inspire le Reiki et on lui demande de nous montrer comment aller là où on veut aller.

R  – meme lorsque la guepe, tu l’as laissé libre de se poser sur ta joue…

Dom  – C’est lorsqu’on commence à mieux se connaître et à savoir comment on fonctionne, qu’on commence à savoir et à comprendre comment fonctionne le monde. C’est par le symbolisme que l’on peut comprendre ça le plus facilement possible. J’ai compris ça lorsqu’à l’école ou au catéchisme on nous a montré les saints dans l’arène ; ligotés à un poteau et lâcher de lions ou de taureaux et ceux-ci venaient leur lécher les mains et ronronner à leurs pieds. Pour en arriver là il suffisait d’avoir la foi nous disait on. « Ceux qui auront la foi pourront jouer avec des serpents et des poisons sans être nullement inquiété… » depuis l’école j’ai médité là-dessus toute mon existence parce que je me trouvais un peu martyr moi-même mais je sentais qu’au fond de moi je voulais devenir l’ami des lions et des taureaux et être à l’abri de tout empoisonnement….lol.

Et c’est quoi qui nous empoisonne le plus ? La peur. Avec le Reiki (les symboles du deuxième et troisième degré) j’ai décortiqué la peur comme on décortique un artichaut pour atteindre le cœur. Et par le symbolisme la guêpe vient donner le feu pour réveiller l’esprit si l’être en a besoin. Sinon, elle n’a aucune raison de piquer et elle ne le fera pas. C’est aussi simple que ça et c’est pour ça que c’est difficile à accepter…parce que c’est simple !!! lol… et des tracteurs ou les philosophes de comptoir diront « oui mais c’est un peu trop facile ça ». Le diront avec beaucoup d’emphase et d’orgueil car au lieu de rechercher ce qui est simple ils tournent tout autour en compliquant les choses en compliquant la vie en compliquant le monde, en perdant du temps. Le symbole, le symbolisme est une concentration et sa spirale ramène au centre de toutes choses.

Si c’est pas simple ça…

R  – en tout cas cela a été mon interprétation; autre image les papillons ils ont la mauvaise image de butiner un peu partout je n’ai jamais compris pourquoi l’homme se sert de ce fonctionnement pour imager un de ces mauvais fct ;le papillon n’a que peu de temps pour apprendre et remplir sa mission prendre transporter donner; et il ne pique pas ; a méditer ??

Dom  – J’adore le papillon !

C’est le symbole qui a été pris pour le nouveau paradigme. La véritable liberté c’est de vivre par soi-même et non pas par rapport aux autres, surtout ne pas vivre pour plaire aux autres, surtout ne pas vivre avec la peur de déplaire aux autres !

Et le symbolisme spirituel du papillon ; c’est son vol ; Insaisissable !

L’oiseau file droit, le papillon lui va dans tous les sens, zigzague, on a l’impression qu’il est saoul. Comme il vole dans l’air il représente un aspect des pensées et nous indique que nous devons suivre nos pensées au lieu de suivre la pensée dogmatique des pseudos philosophes et instructeurs qui prétendent savoir comment la vie doit être ; l’ E N (éducation nationale).… Lol…

R  – merci ;ta réponse décrit exactement ce que je recherche ;guérir de mes peurs transmises  et acquises  pour vivre mes pensées en toute liberté; pour la petite histoire, j’ ai choisi ta formation en fct de qui émanait de ton site internet Planète Reiki ; évidement lorsque j’ai vu que tu venais au salon bio à Nimes ;je me suis empressée de vérifier mon choix en allant te rencontrer ;mais tu étais en conférence à laquelle ,j’ai assistée ;ce qui a fait le déclic c’est de faire  chanter au public dans la salle de conférence le son OM , de proposer de chanter m’a un peu bluffé je me suis posé la question ;pendant les dix secondes ou  tu l’a annoncé je me suis dis  « va t–il vraiment le faire ? oui ! il a une sacrée dose de liberté, car ce n’était pas un stage de yoga mais simplement le public d’un salon bio énergie bien-être fruits et légumes bio etc. etc.
Protection en soin reiki

L… – J’ai reçu dans mon atelier de soins une femme qui souffre de partout, en mi temps thérapeutique, me dit qu’elle est passeuse d’âmes, que toutes les personnes avec lesquelles elle commence à se lier d’amitié meurent…dans sa famille aussi beaucoup de décès…j’avais l’impression que ma pièce était chargée d’un  air lourd. Un instant j’ai regretté qu’elle soit venue (je sais c’est nul ) Plusieurs fois des amis thérapeutes m’ont parlé de « personnes toxiques » ou « négatives« … cela m’a parcouru l’esprit mais je ne suis pas d’accord. Je pense que les autres sont…comme ils sont, c’est tout. Il n’y a pas de toxicité à craindre et que de toutes façons notre protection infaillible c’est notre amour. Même en admettant qu’une personne ne soit pas gentille, si on s’occupe d’elle avec amour, rien ne peut être négatif. Qu’en penses tu? c’est naïf ?

Dom  – rien à craindre en effet. Je suis d’accord avec ton propos, ta définition est très belle. À mon avis, cette personne vit des coïncidences qu’elle prend pour de la médiumnité. Personnellement j’opterais pour un point de vue symbolique, je me permets d’y voir que des parties d’elle meurent et que le message que je lui donnerais serais « prends de nouvelles façons de voir de vivre de penser ; renais !!!! » Car c’est universel, une mort annonce toujours une naissance. De tt façons : protège toi avec CKR sur les chakras avant chaque séance !!!!! c’est bon pour le mental et l’émotionnel.
Les 21 jours d’auto traitement 

M… – je voulais juste te faire partager la joie de mon premier reiki « officiel » après ce beau stage premier degré Reiki à Juvignac : une dame (76 ans, une merveilleuse personne) que je vois depuis une dizaine d’années, ponctuellement puis plus régulièrement. Maux de dos, syndrome de Parkinson puis maladie. La réflexo l’aidait bien jusqu’à ce qu’elle prenne les médicaments du neurologue contre les tremblements. Ce sont toujours des obstacles à l’auriculo mais là…plus rien. j’étais si triste de la voir souffrir avec le moral si bas. Je lui ai proposé du reiki en mode « on peut toujours tenter, on verra bien » …j’avoue très perplexe car l’osteo non plus ne la soulage plus…

Deux jours après, elle me téléphone, la voix joyeuse me racontant ses exploits comme une chipie toute fière de me dire qu’elle est partie se promener en ville la veille pendant plus de trois heures (il m’en faut moins pour être morte!)  puis a passé l’aspirateur chez elle…. »oui c’était peut être beaucoup pour mon dos » tout en riant…Voilà! quel bonheur de l’entendre heureuse. Je la revois cette semaine.

Les 21 jours d’auto traitement se terminent et je voudrais savoir s’il faut arrêter ou continuer l’auto traitement Reiki journalier ? Je t’embrasse, merci, je suis super heureuse!

Dom  – je suis heureux aussi. Je le suis professionnellement. Professionnellement heureux de t’avoir transmis le Reiki et la quintessence du Reiki, l’esprit du Reiki Usui pour guider le tiens afin d’aider les autres dans ton office de thérapeute. Et ce qui m’enchante c’est ce que tu as dit à cette personne ; la façon dont tu lui as proposé du Reiki en mode « on peut toujours tenter, on verra bien » c’est une bonne posture qu’il est bon d’avoir lorsque l’on fait du Reiki ; oser poser les mains lâcher prise et sourire, ne rien attendre… pas d’attentes pas de déception. 

Il est toujours bon de dire ça « si ça marche c’est bien si ça marche pas c’est bien aussi, il se passe exactement ce qu’il doit se passer » et le faire en étant rempli d’amour ou dans un état de conscience proche de l’amour…
Tu en verras d’autres des miracles je te le garantie. Des tous petits et des grands aussi. 

Puisque tu en parles, je me permets de te préciser quelque chose d’important.

Je te conseille vivement, de continuer de te faire le soin Reiki tous les jours et de ne pas arrêter au bout des 21 jours d’auto traitements après le stage, pour répondre à ta question de savoir s’il fallait arrêter le Reiki au bout des 21 jours après le stage Reiki. Ça serait ordinaire d’arrêter. Les 21 jours servent aussi à prendre l’habitude, la bonne, celle de se donner du Reiki tous les jours. Quelque part ça fait peut-être aussi parti de ton rôle de thérapeute ; de rester chaque jour et chaque nuit remplie de cette substance curative du reiki et de maintenir autour de toi aussi son énergie dans la couche mystérieuse qui t’entoure – l’aura – afin d’être pleinement au service des autres sans ne plus te poser de questions puisqu’en agissant ainsi tu en fait partie. Du Reiki ! De ce mystère qu’est le Reiki.
Lorsque nous pratiquons ainsi nous sommes Reiki.


Avril 2016 
C…- Il se passe des choses extra ordinaires dans ma vie; C’est magnifique. Je suis en train d’épurer les mémoires : ça fait grandement du bien et surtout comprendre plein de trucs.
Dom – je te l’avais « promis » lors de ton initiation, non ? Le Reiki, lorsque tu n’as pas peur du changement….t’ouvre la voie de la nouveauté en toi et ton environnement – ta vie – ressemble de plus en plus à ton épanouissement intérieur..


effectivement je comprend pourquoi les gens ne pouvaient pas me décrire le reiki Karuna et me disaient plutôt « il faut le faire pour savoir ce que c’est ! ». C’est vraiment impressionnant les ressenti même pendant les auto soins !
X… – Déjà tu peux m’inscrire au niveau 2 Karuna…Depuis l’initiation Karuna 1 , je me sens enveloppée d’une immense bulle lumineuse , qui se déplace avec moi et dans laquelle je vis , je marche , je conduis , etc…c’est très particulier comme sensation  et très agréable. Je vais avoir besoin de me relier à cette Lumière , car la rencontre avec  » la partie sombre de moi même  » , est troublante , heu… pas très belle …. mais comment fais-tu pour nous guider dans cette méditation ???  C’est extraordinaire !!!!! 

Dom – Faut refaire la médit souvent, prendre l’habitude de parler en méditation avec elle, l’intégrer, car elle a beaucoup à t’apporter.

X… – J’ai encore beaucoup de chemin à parcourir …….les archanges et les rayons de couleurs… c’est pas encore arrivé jusqu’à moi … je dois « bloquer « quelque part !

Dom – Continue le cheminement et la pratique, tu verras la progression est toute aussi belle. La lumière est au bout du chemin….

X… – Merci encore pour ton enseignement et tout ce que tu m’apportes et me fais découvrir.

Dom – c’est du partage !


bonsoir Dom…J’ai beaucoup apprécié cette harmonie gentillesse et calme. Je suis revenue sur un petit nuage qui dure encore, car pendant cette initiation j’ai ressenti que chose d’indéfinissable. C’est un mélange de paix ,de joie  et je dirai d’amour. Samedi après midi ,je me suis remise à la peinture que je n’avais plus exercée depuis plusieurs mois. Je suis donc très motivée pour passer le 2eme voir le 3eme niveau…….si tu penses que je le peux.    encore merci pour ce que tu nous donnes

Dom – ce n’est en aucun cas à moi de savoir si tu peux passer le niveau 2, sauf cas extrême évidemment. Mais c’est toi qui te sentira appelée, et toi seule qui décideras.

Z…- Je souhaite savoir dans le Reiki Komyo ; l’auto traitement doit il être pratiqué tous les jours ? 

Dom – Il est fortement conseillé de se donner du reiki chaque jour. Evidemment c’est toi qui décide du temps que tu accordes à ton bonheur….surtout pour la tt et la gorge…puis le corps

Z…-  Lorsque je m’adresse a l’énergie du reiki je sais pas vraiment comment le faire ou du moins quels sont les mots juste a utiliser?  

Dom – Sois simple, imagine comment tu parlerais à l’énergie si tu étais une petite enfant, c’est cette innocence là qu’il faut réinstaller en soi ; la pureté n’est rien d’autre que l’innocence. Ensuite, une fois entraînée, tu peux t’inspirer, pour les mots, de cette prière chamanique que j’ai adoptée et et que j’utilise pour faire les initiations :

Je m’élève pour recevoir la guérison pour mon plus grand bien et celui du tout.

Ou bien / Reiki élève mon cœur et mes intentions pour canaliser la guérison, pour le plus grand bien de …. « la personnes concernée »….ou bien «  et pour le plus grand bien du tout ».

Z… – Je pratique essentiellement le soir, plus particulièrement dans le bain c’est le moment ou je lâche prise …

Dom – C’est parfait dans l’eau ! tu traites surtout le coté émotionnel.

Z… – Je te présente mon rituel : Position Gasshô :  J’essaie de tenir 3 minutes plusieurs positions des mains, puis ; Tête, ventre, pieds en grande partie .

Dom – N’oublie pas la poitrine, région du cœur.

Z… – Pour activer l’énergie je chante les principes  » kyodakewa… etc. etc. ». Si je traite une zone bien précisé j’utilise à la fois le reiji, le symbole komyo « Z U « . J’ai pas pris mes notes volontairement pour rédiger ce mail, car mon but et bien sûre de l’exercer naturellement . Depuis le stage, mon pied va de mieux en mieux ..je ressens un peu moins de colère intérieure.

Dom – Tu vois, faut pas arrêter, tu posais la question ; tu as toi mm la réponse ; continue les auto traitements.

Z…- Cependant je passe par des phases de bien, de moins bien. Les émotions sortent parfois , s’accompagnent par des pleurs lorsqu’il s’agit de moquerie sur mes points faibles . Je ne supporte plus . Mes proches « mon frère  » par exemple est surpris . 

Dom – C’est un symptôme de guérison ; pour donner l’écoute à ton enfant blessé, apprendre à oser dire ce que tu ressens. C’est ça Grandir ; c’est dans la confrontation avec les autres qu’il faut utiliser le Reiki pour être à l’écoute des ressentis, qu’est-ce que tu ressens dans le corps lorsque quelqu’un en face de toi te dérange, ou est-ce que ça te touche, quelle est cette émotion. Et ensuite trouvé qu’elle est la méthode Reiki la plus adaptée pour transformer cette émotion.

Z…- En bref, j’aimerai travailler sur la confiance en moi, la prise de parole avec une communication fluide et claire .

Dom – Viens à l’atelier sur le chakra de la gorge vendredi 25 Mars

Z… – Je suis allée voir une kinésiologie , je n’ai pas vraiment ressenti d’amélioration. 

Elle a soulevé des points que je savais . Ce rdv peux t’il stopper ou perturber l’initiation au reiki ? 

Dom – Absolument pas ! Tu es initiée à vie quoi qu’il advienne. Seul le mental pour x raison, peut éventuellement bloquer l’énergie, en fait la refuser ou la ralentir. Mais ce mm mental peut aussi facilement la relaisser circuler. Mais aucune intervention d’une tierce personne ne le peut. Et encore -1 quelconque autre système énergétique. C’est impossible.

Z…- Je souhaite savoir comment je peux travailler sur ce qui est refoulé ? 

Dom – Je te donnes l’adresse d’une personne impeccable : Marie Claude Granget / 8 rue clairette / montpel / 04 67 41 21 55, tu peux l’appeler de ma part.

Puis, le jour où tu te sens prête, il y a le stage du 2ème degré Usui ; de belles techniques appropriées pour l’introspection et les « outils » pour réparer le passé. Et particulièrement celui que j’ai mis en place en juin sur 4 jours au lieu de 2 justement afin de mettre en pratique, en immersion durant 4 jours, avec des nocturnes pour des soins guidés.

Z…- Par quel processus parallèle en sachant que la méditation m’apporte sérénité ? 
Dom – La sophrologie est efficace, demandes au Reiki à être mise en relation avec une sophrologue d’envergure. Tu écris sur un papier « je suis maintenant guérie grâce à des séances de sophrologie avec une personne d’envergure qui me correspond parfaitement. En accord avec les lois de l’Univers », le tout entouré par les symboles Reiki auxquels tu es initiée. Tu mets ça sous l’oreiller et tu t’endors en récitant doucement ta prière, alternée avec, doucement, 3 fois de suite le symbole du cœur… En te visualisant guérie.Je t’envois également un autre texte sacré, (en pièce jointe) tache de le lire tous les soirs avant de te coucher, ou le matin, à voix haute jusqu’au bout. Il est terriblement fiable et efficace si tu le fais ts ls jrs pendant 21 jrs. C’est la puissance du verbe.


Y… – Je viens tardivement te remercier pour ce bel enseignement que tu nous a transmis sur le reiki Karuna. C’ est une belle énergie, très forte mais aussi  enveloppante…ce groupe était bien sympa et homogène. je pratique tous les jours et suis tes conseils pour bien intégrer ces symboles…je continue la grille ,les marathons….je travaille sur moi….je viens de trainer 8 jours avec une bronchite asthmatiforme…..je cherche ce qui m étouffe…..etc….

Dom – merci pour ce beau retour….mm si ça tousse un peu…..moi aussi j’ai cherché un mois ce qui m’étouffais car j’ai hébergé dans ma gorge une trachéite, elle sied bien plus MA squatté pendant un mois et demi. Mais c’est quoi un mois et demi dans une vie ? Si cette parcelle de temps m’a aidé à mieux comprendre mon moi intime grâce à ce que les ancêtres appelés maladies et que j’appelle moi « mal éducationnel » ?

Le Reiki, et encore plus le Karuna nous aide à accepter le mal pour nous faire évoluer, grandir.  Chaque jour on vit un évènement, une initiation qui fait évoluer, des petits riens qui font un beau fleuve d’amour en soi….à un moment on sait qui on est, et là,  on ne souffre plus. Plus de « ça ».


X… – Je passe mon oral d aide soignante le 10 mars je m envoi un soin pour que tous se passe bien ?

Dom – exact ! tu peux commencer l’envoi à distance dés aujourd’hui !!!!! tu recharges ts ls 3 jrs !

X… – Ok super merci je vais le faire alors ! C est vraiment génial le reiki et le 2 degré au top je vois vraiment le changement mes priorités et vois les choses différemment et avec gratitude

Lors de la deuxième session de Reiki que nous avons fait en janvier concernant entre autre un retour sur les « petit papiers » demandant à nos guides de nous soutenir dans le choix d’un changement. Le mien était d arrêter de fumer . 

je dois avouer que deux jours après la formation j’ai fumé deux cigarettes et je peux te dire que je l’ai regretté car toute la nuit qui a suivie, j ai été malade à « crever » de honte avec moi même pour ne pas avoir respecté mon engagement vis à vis de moi , de mon être …. ( mal au ventre , cogitation avec mon âme ) …depuis …je n ai plus touché à une cigarette ni même eu l envie d entre reprendre une .

Et meme lorsque je suis en soirée avec des fumeurs je n en ai pas envie ! Donc , je voulais profiter de ce mail pour te dire : M E R C I !

je ne sais pas si pour les autres « ça  » a marché mais en tout cas pour moi oui et j’ai compris une chose : TOUT EST DANS LA TETE , et cela pour TOUT ! je continue le reiki sur moi et j en propose maintenant à d autre personne qui son hors de mon entourage. 

Le 21 novembre 2015 14:33, B…a écrit :

B…- J’ai fait quelque recherche sur Internet mais j’ai pas trouvé quelque chose de concret au sujet du soucis que j’ai depuis 15 jours. Il s’avère que la sciatique que j’ai eu été du à un déplacement de la hanche droite. Du coup évidemment cela a coincé direct le nerf sciatique. Est ce que tu sais s’il y a un problème direct au niveau énergétique ou émotionnel qui a fait que ma hanche s’est fait la malle ?

Dom – souvent c’est du à de l’indécision ; peur d’aller de l’avant et de prendre une décision, car l’inconscient peut avoir peur des conséquences de cette prise de décision, peur de perdre une liberté…
Voici une recette Planète Reiki :

1 – accepter les conséquences si on prend une décision ; avec SKSK

2 – HSZSZN + SHK pour apaiser l’émotion et le mental.

3 – 1er idéal Reiki ; au lieu de s’en pré occuper, s’en occuper. voir ce qu’il convient de faire pour que les conséquences possibles, de la prise de cette décision, soit – deviennent gérables…. 

Le fait que , comme tu l’EX PRIME (ex = extériorise)…. « la hanche se fasse la malle », veut dire que : face à cette décision tu te fais la malle….

La sciatique est souvent due à une peur de manquer, à un sentiment d’insécurité. Tu peux prendre conscience de tout ça. Puis trouver quelle est la situation dans laquelle tu créais ce stress , l’identifier , la nommer la peur de décider – dans cette situation précise – et bien entendu le plus facile restant à faire : un traitement mental, avec la phrase qui convient, plus un quartz et papier !

B… – Ok merci pour toutes ces infos Dom! Je vais rassembler tout cela trouver la décision qui me bloque et me faire une phrase en fonction ! C’est puissant le corps quand on veut pas comprendre quelque chose…lol…


C… – après le niveau 2;faudra t-il pratiquer 21 jours d’affilée comme on a du faire après le niveau 1??
Dom – Bonjour C…oui, si tu le désire dans ton cœur bien sur. fais fructifier le sacré des initiations 21 jours après passages de chaque niveaux Reiki. ça marque ton intention de changement de ton monde intérieur et intime. C’est une des façons de changer le monde extérieur et relationnel….en plus d’augmenter ton taux vibratoire et les surprises dans ta vie….surtout si passé les 21 jours tu continues à pratiquer ts ls jours pendant des années !!!

L.. – depuis une semaine g des aphtes dans la bouche. G aussi mal à une oreille et à la gorge, ça empêche d’évoluer. Je fais des soins Reiki 2 à 3 fois par jours, ça me permet de dormir assez bien, mais je sens que j’ai besoin de comprendre pour pouvoir être totalement libéré. Tu as un avis là-dessus, j’en suis sur.

Dom – les aphtes dans la bouche viennent en général de se sentir repoussée par la personne avec qui on voudrait vivre une relation intime et sexuelle… (bouche + baisers/sensualité). C’est représentatif de frustration et de tristesse , voir de colère remâchée…. vis tu cela ?

les oreilles = écouter/entendre….que voudrais tu entendre ? Que ne veux tu ou ne sais tu pas entendre ?

La gorge = parler, exprimer….sinon râler, tousser, quelque chose à dire qui est resté coincé…

continue tous les jours 1 h de Reiki…..et pratique les techniques apprises en stage.

En cas d’urgence contacte de ma part ton médecin traitant.


Merci pour ta lettre de nouvelles Reiki local qui fait toujours du bien et merci pour le mot d’Amma qui correspond à ce que j’ai pu ressentir après les attentats : ne pas se laisser submerger par des émotions négatives mais s’accrocher à l’amour et la lumière et les cultiver en soi et autour de soi…
Je pratique toujours le reiki au quotidien, j’ai aussi fini ma formation en géobiologie, j’ai commencé à pratiquer et le reiki m’y sert parfois. Je continue donc d’avancer sur mon chemin…

De mon Ami, mon Frère….

B… – Salut mon Dom
Comment vas tu mon frère ? Mon ami..

Pour ma part j essaie de sortir tjs de mes soucis ,et c est pas gagné…
On espère que bientôt le carnage cessera…
La santé très mauvaise aussi ,, rein gauche dead aorte bouchée 50%
Pbl cœur sûrement op. Bientôt..
Stres stress stress …
Séparé de C…. depuis 10 mois presque…
La je retrouve enfin un peu le sourire
Avec un petit loft atelier que je viens de louer…
Tu passeras ,????
Dis moi pourrais tu me passer le texte ou il y a les idéaux a suivre. ..
J en ai besoin j ai donné la mienne et je n ai plus souvenir …
Des bisous
On se voit quand ???

Dom – Salut B…. tu m’inquiète…..j’espère que tu vas trouver aussi un énergéticien, une sophrologue pour libérer le mental des ruminations des soucis…. enfin des soins parallèles pour te soulager ; va la voir avec ceci : les reins sont liés à une peur concernant la survie….les besoins de base…..et aussi à des personnes dans l’entourage qui nous empoisonnent….et la survie en dépendant de quelqu’un ça peut être une cause de mal-être…. et celui de gauche, coté du corps ou il y a le cœur, l’affectif ,donc il y a une peine qui est ajouté…. L’aorte c’est la mère nourricière du corps, celle qui nourri et oxygène l’organisme. te sens tu désabusé et révolté que malgré tes efforts tu sois obligé d’admettre la défaite… ton corps est ton allié et te dis qu’au niveau des pensées il y a des pressions à désemplifier. afin que le sang et l’oxygène se refluidifie , pour une vie plus souple…. et l’aorte est elle aussi à gauche. tu un sensible mon ami, comme moi, mais c’est simplement un message pour réveiller le Yang, le mâle intérieur, le guerrier, le viking en toi quoi !!! en ce sens la sophrologue va t’aider , suffit des fois d’un bon ménage. la prière je te la mets par mail, au cas ou je te mets les 2 prières. et oui, je vais passer à X…… te voir ! donne moi ton adresse.
Je viens te voir le wend prochain.
je t’embrasse mon frère, prends soin de toi.
*********************************Un slam reçu suite à un stage !

j’adore ! Je vous le laisse découvrir.

Une rencontre inopinée
Et l’esprit se languit
Bientôt d’être éclairé
Au sujet du reiki

Un symbole qui danse
Et voilà l’énergie
Exaltation des sens
Vibrations l’âme guérit

Découverte d’une clé
De mon petit paradis
Passions acides libérées
C’est l’extase qui grandit

Mains jointes Ô silence
Vient l’heure du repli
Un instant de transe
Méditation sur la vie

Mais persiste une pensée
Alors je te le dis
Vénérable Sensei
Vraiment un grand MERCI !!


Nous ne dirons jamais assez merci.

Tu nous remercie mais je pense que c’est à nous à le faire! donc je te remercie pour ce stage, pour ta gentillesse, ton humilité, ton écoute, ton humour, pour tous ces échanges, ces partages, ces confidences aussi…j’ai passé un très beau week end ! un peu fatigant mais tellement enrichissant…Merci, merci, merci…je t’ai dit avoir changé depuis quelque temps…je suis de plus en plus positive et je vais par conséquent de mieux en mieux et ce week end m’a apporté encore et encore; je savais que ce week end serait « le week end » mais j’étais tout de même loin de la vérité! 

V…- bonjour dom question très personnelle d’une amie médecin très ouverte au reiki  son mari viens d’être hospitalisé pour un oap et eczema géant elle à reçu un SMS il y a quelques jours de son neveu la menaçant de tous les malheurs  (pb d’héritage ) et depuis son mari accumule les pbs de santé  (j’ai essayé le Reiki à distance sans grande efficacité )donc sa femme de pose bcp de questions si on leurs avait pas envoyé un mauvais sort ? ( leurs chien est mort d’un oap l’année dernière à la même date )  quand penses-tu  et que faire ? Merci V…

 Dom – l’œdème est généralement du à un sentiment d’être limité pour aller de l’avant, pour réaliser un projet, pour sa carrière, pour déménager….ect.

c’est le sentiment d’être limité qui est signifié par le liquide ds ls poumons. le liquide indique que c’est d’ordre émotionnel ( 2ème chakra/lymphe/reins/urine..tout ce qui est eau) et les poumons c’est la vie ! Vivre la vie à plein poumons !
un problème aux poumons indique de l’abattement. Et l’exéma signale une sensibilité à fleur de peu ; la crainte ou le refus d’exprimer ses émotions ( en l’occurrence le sentiment d’être limité ( de se sentir limité) sont concernés les 3 chakras : sacré/émotionnel -solaire/la peau (être bien ds sa peau – et cœur/prendre la vie à plein poumons !

 REIKI : il lui faudrait un soin d’une heure tous les jours, ou au moins d’une demi heure.

selon l’endroit ou il demeure il y a peut être quelqu’un qui peut s’en charger…

à distance : demande la guérison émotionnelle et l’expression des sentiments retenus (de la manière la plus puissante la plus positive et la lus divine)
pour éloigner les mauvais sorts : porter un oeil de tigre et en disposer ds la maison d’assez belle taille, surtout en sphère (5 à 10 cm diamètre).
« élève à questionsssss »…lol… mais vous le savez : j’aime les questions.… Lol. 

G…– Pendant le stage, nous avons chargé un cristal, mais sans écrire sur un papier. Nous devions le porter sur nous et dormir avec la pierre sous l’oreiller. Mais je ne me rappelle plus quelle était la trame générale de la demande. Etait-ce une demande liée à la santé ?

Dom  – tu peux charger un cristal avec du Reiki et les symboles sans aucune intention et le porter sur toi ou/et dormir avec pendant 4 jours comme une batterie Reiki pour le plaisir. c’était ça le but de l’exercice.

G…- Quand on a un nouveau cristal, il faut le nettoyer et le charger mais quel est l’ordre exact ?

Jaki Kiri Joka  puis  le rituel de préparation 2eme degré   puis    recharge du cristal    ou bien

le rituel de préparation 2eme degré   puis   Jaki Kiri Joka    puis   recharge du cristal.

Dom  –c’est pareil, l’un comme l’autre sont valable et parfois on le fait sans s’en rendre compte…à force. la logique voudrait la 2ème formule….

mais aussi : Conseil de Maître  : Ecriture Prière – puis….SHK mains/aura/espace – JKJ – et rituel R2 – et charge……(tu décodes ?!!…lol)

Jaki Kiri Joka est bon pour libérer les pierres des énergies stagnantes, s’il y en a. J’ai fais plusieurs formations de litho-thérapie ; il suffit d’en vérifier le résultat au pendule. Il y a des personnes qui ont peur de cette technique vis-à-vis des minéraux….Lorsqu’on fait jaki Kiri Joka sur un objet qu’on tient dans la main, inévitablement on se fait aussi la technique sur la main, n’est ce pas… ? Alors ? en avoir peur, c’est bête non ? Car nous avons aussi de la silice dans les celulles de la main….me font marrer les gens et leurs peurs !!!

G…- Lorsque l’on recharge un cristal ou des cristaux, qui sont en cour de traitement, (C’est le cas de nos cristaux que nous avons chargé pour la 1er fois dimanche avec toi) est il nécessaire de faire le rituel de préparation 2eme degré avant de visualiser les 4 symboles ?

Dom  –oui ! et pas les visualiser mais les tracer dans l’espace avant de commencer – tu visualisera après le  temps d’intégration.

 G…- Pour purifier les cristaux en page 33 (tu l’a également mis en page 59) , tu nous donnes l’astuce d’aller sur Youtube. Mais je n’ai pas trouvé les vidéos. Je sais je suis un peu manche …. Peux-tu me donner un lien ?

Dom – tu cliques « Jaki kiri joka » sur internet et tu chois dans les tas de sites qui font les démos….

G…- En page 34, tu évoques l’énergie bloquée. Pour moi (formation Tuina) une énergie bloquée correspond à une douleur physique. Est-ce bien ça ?

Dom  –ça peut aussi être une simple gene, un picotement récurent, une tremblement chronique alternatif, mais bien sur douleur aussi….ds ts ls cas de souffrance l’énergie s’écoule mal, en stage de 2 jours on dit « énergie bloquée » c’est un racourci, ensuite ds la pratique on aprend à discerner, à relativiser…et à me demander ! merci !!!

G…- En parallèle en page 41 tu proposes une méthode « en cas de douleur »

Comme ce n’est pas le même soin (Symboles différents) que page 34, quelle est la différence ? Je suis carrément perdu.

Dom  –là cette méthode permet de ne pas réfléchir ; on la fait systématiquement chaque fois que la personne a mal (douleur). il y a des gens avec zones corporelles ou l’énergie est bloquée sans douleur aucune….(mais ça gène) donc on fera la 1ere. et les 2, alternativement pour les DOULEURS

G…- Avant ces 2 soins doit on faire le rituel de préparation 2eme degré ?

Dom  –non, …Seulement CKR ds les mains/aura/espace………comme ds ls urgences.

Mes-opinions-surLundi 16 Novembre 2015
Trop c’est trop 

QUESTION / C – Je suis dans un mal etre énorme depuis le début de la semaine. J ai beaucoup pleuré notamment en me faisant du reiki a moi même. Peux tu me dire a quoi c est du? Ce que je peux faire. J ai l impression d être en phase de régression comme si quelque chose ou quelques un m empêchait d avancer.
Dom – peut être en rapport avec un envoie à distance pour toi ds la grille…!?!…ça ressemble à une purge émotionnelle : une mémoire remonte et demande à être comprise. Tu pourrais voir un sophrologue et lui demander de t’aider à comprendre. sinon je peux te donner le phone d’une amie médium assez douée..
C -Merci beaucoup. Je comprends mieux maintenant. J’accepte le bouleversement puisq ça me nettoie. Je voulais aussi savoir s il y aura besoin de cristaux pour la maitrise en decembre ? Si oui peux tu me les fournir ou je les achète ici?
Dom – juste tu amène ton cristal maître, et un ou 2 autres si tu le souhaites pour qu’ils s’imprègnent de la haute vibration des 3 jours et des intentions du stage « passage de la maîtrise ».
C -En tous cas, il faut que tu saches qu a chaque fois que je charge ma grille je pars en méditation profonde!!!
Très très bizarre, tu ne trouves pas?
Dom -c’est peut être pas nécessaire d’entrer en méditation lorsque tu recharge ta grille, tu devrais peut etre méditer avant, et charger la grille après. ou bien avoir une grille pour toi et tu médite à ton souhait en la chargeant. et une autre pour les autres en faisant juste un Reiki activation.
être et faire en pleine conscience éveillée est la façon Reiki.


Trop en faire..
–  j’avais une petite question à te poser: Hier j’ai donné deux soins Reiki et je trouve que cela m’a vraiment fatiguée.. Du coup est ce normal..,? j’aurai pas du avoir plutôt un regain d’énergie..?

Dom – il est possible que durant le soin tu te sois laissée embraquer par des pensées de vouloir la soigner, lui faire du bien, du « pourvu qu’elle ressente le Reiki, pourvu que ça marche, pour vu que… ». possible aussi que tu trouvais ennuyeux, le temps long, les postures fatigantes, le mental trop vagabond…..du coup, au lieu de lâcher prise tu t’es fatiguée à « penser »…..sinon il est possible que le Reiki te dise « tu vois, tu manques de repos, tu en fais trop, pose toi et re pose toi ». Car dans 99,99% des soins on a l a pêche après en avoir donné !
t’as qu’a regarder ton riz !! (riz traité au Reiki dans un bocal durant 20 jours suivre le lien : https://www.facebook.com/photo.php?fbid=10206291359097876&set=pcb.10206291360217904&type=3&theater

Dom – lors d’un soin ; tu te dois de lâcher prise, tu fais le rituel, tu visualise le symbole à chaque position des mains, chantonner, visualiser de belles lumières, la connexion avec le ciel, avec la terre, réciter la prière ésotérique du symbole….respirer calmement et se détendre. Tu peux mm te laisser aller à rêver…mais….Surtout : ne rien attendre !!!


Encore merci pour tes conseils du jour et ce beau moment passé avec le groupe. J’ai compris des trucs surprenants sur la fameuse loi d’Attraction couplée à la loi de résonance suite à notre échange. Tu es un maître éclairé, et je suis très heureuse de te connaître. J’espère avoir l’occasion de participer à un autre atelier chakra bientôt pour continuer à apprendre.


Le Reiki Usui est la base et l’origine de tous les « REIKIS ».

Le système, la structure, les fondations, la bâtisse Mère du Reiki.


Nettoyer les lieux

M – pourrais tu m’aiguiller sur comment faire pour « nettoyer « une maison d’abord à distance mais aussi sur place avec le Reiki (2 pour moi). La maison de mon chéri présente des nrj plutôt basses ki ralentissent sa vente et rendent apathiques et négatifs les personnes ki y vivent. Moi même quand j’y séjourne plus de deux jours je me sens déconnectée démotivée et pleines de pensées négatives. Merci d’avance.

DomAssure toi d’être seule pendant 1/ h sur le lieu. et suis cette façon de faire le nettoyage ;

– rituel complet ds une pièce avec CKR sur les chakras devant et derrière/prends ton temps : tu es en mission.

– puis SHK mains/aura/espace

Et tu fais, dans toutes les pièces, couloirs, placards, wc, cave, grenier, jardin, cabanes, puits…ect

– CKR dans les angles/sol/plafond/centre

– puis SHK en grand sur les murs /sol/plafond/centre
– Idem sur les portes et fenêtres: CKR ET SHK

– – à l’extérieur :

– CKR ET SHK sur les portes et les fenêtres.

– SHK sur les murs

– puis, tu tiens l’angle de la maison de ta main non dominante et tu fais Jaki Kiri Joka.

– et enfin tu visualise un immense HSZSN qui traverse la maison de haut en bas et la soude au cosmos et à la terre avec une lumière Divine, tu visualise cette lumière Divine remplir toute la maison, toutes les pièces.

enfin tu visualise un immense SKSK dans la maison, un gros qui la rempli d’Amour.

Un plus : Mets des tourmalines noires dans les angles des pièces / une pierre jaune dans l’entrée / un quartz transparent de belle taille que tu rempli de Reiki et de symboles dans la pièce principale ainsi qu’un rose et une calcite miel.

– si ça passe pas, je connais un radiesthésiste qui peux déterminer si la maison n’est pas construite sur un nœud négatif. Dans ce cas, la solution est : déménager.


Se nourrir c’est s’aimer

Le 9 novembre 2015 10:43, J N  <0@hotmail.fr> a écrit :

Bonjour Dom, Je voulais te faire part de mon ressenti pour la journée d’hier, C’est un groupe ou je me suis senti moins bien qu’avec celui du mois d’octobre « cercle émeraude ».

Mais surtout depuis hier soir je suis bloquée au niveau du sacrum je ne sais pas pourquoi ! je n’ai pas pu aller bosser tellement la douleur est intense. Je ne sais pas si cela à un rapport à la journée d’hier ou si c’est autre chose, grand mystère. te tiens au courant !

Dom – je comprends que d’un groupe à un autre on puisse avoir des ressentis diffèrent, c’est assez normal. Surtout que le groupe précédent était plus  intimiste avec juste 6 personnes.

Quand à la douleur ; es tu sure que c’est localisé au le sacrum ?

Alors si c’est bien ça, s’est la réaction de guérison en rapport avec la mise en route du changement de processus concernant ton choix sur l’atelier de ce stage Reiki 2 ; la nourriture ! Tu entame la guérison « je change nourriture en pensant d’abord à moi avant de contenter la gourmandise des autres ».
Le chakra sacré est en lien direct avec :

– la nourriture

– l’argent

– la façon dont on prends soin de soi

– et les rapports qu’on a avec les autres .  

Ors, tu es en train de passer de « servir les autres  » à « penser à toi ».

Petit conseil ; accepte – avec SKSK – que ça soit douloureux, difficile, et continue avec SHK le traitement mental, fais confiance au Reiki.

Le mal est l’ami du bien

Merci beaucoup pour ce moment de partage intense et joyeux
Merci Reiki pour toutes les bonnes choses qui arrivent à chaque instant, et les moins bonnes qui refont surface ( on se demande pourquoi ? ? ? ?  ) et que je vais pouvoir guérir maintenant, car maintenant je sais faire  !

Dom – Parce que le Reiki n’est pas un antibiotique ni un anxiolytique, son énergie va à la source du problème, donc parfois il bouscule un peu, comme synthol ; ça fait mal là ou ça soulage ! Nous appelons ça « symptôme de guérison« . Et le Reiki fait remonter à la surface ce qui dérange afin de s’en occuper et le guérir.


Un jour, quand tu seras prête, la porte s’ouvrira

Bonjour dom, Je prends ma plume pour la première fois de ma vie pour dire ce qui est dans mon cœur, et c’est pour toi, pour un être d’exception qui m’a fait connaitre Reiki voilà un peu plus d’un an. J’étais pleine de colère et de haine et recouverte d’une carapace de protection que tu  as fissurée avec la magie de reiki particulièrement ce weekend. Au fils des mois vous m’avez appris à accepter et surtout à pardonner, chose qui me semblait impossible pour moi en septembre 2014. He ben toi tu y es arrivé et pour ça je voudrais te faire un cadeau virtuel mais important à mes yeux : c’est le premier morceau de cette carapace qui se trouve au niveau de mon cœur. Je te remercie de tout ce que tu as fait pour moi. Les niveaux 1 et 2 de  usui et komyo ont été fort en émotions mais le niveau 3 usui a été une explosion de bonheur et d’amour partagés avec tout le groupe. J’espère avoir encore besoin de toi pendant très longtemps. Encore Merci Merci Merci…….


V – depuis hier matin, des angoisses me remontent… (notamment liées à mes dépressions d’il y a des années). je suis d’habitude assez sensible aux angoisses mais là c’est un niveau au dessus. j’ai du mal à faire la part des choses entre ces émotions « habituelles » et ce qui pourrait faire partie des évolutions d’après initiation. Quoi qu’il en soit, c’est probablement pour moi le moment de dépasser certaines choses (dont certaines que je croyais déjà dépassées…). Est-ce que ça peut faire partie des symptômes des 21 jours ? As-tu des conseils pour les gérer ? Pour l’instant, je tâche de les accueillir sans trop m’y accrocher, et en prenant du recul et en posant mes mains là où je ressens le malaise. Mais puisque je suis une angoissée de nature, forcément ça me tracasse un peu. Merci de tes conseils !


Dom – oui, ce qui t’arrive est normal….appelle le « symptôme de guérison ». le reiki te montre des angoisses. les angoisses ne sont pas des émotions mais des signaux. Elles te signale qu’il y a une peur que tu ne vois pas. Accepte l’angoisse et avec l’aide du Reiki, du Symbole, du 1er des Idéaux ; demande à VOIR quelle est la peur ? De quoi as tu peur ? Et accepte cette peur, elle est légitime.

Une fois cette peur reconnue, acceptée et nommée, tu peux aller consulter une sophrologue ou un acupuncteur. le tout en continuant le Reiki, en commençant par la prise cosmique 15mn ts ls jours jusqu’à apaisement. Et je te conseille d’écrire tout ce qui te fais peur, dans le but de le sortir. En cas d’urgence si tu te sens submergée, appelle de ma part ma praticienne associée : Kat Massié.Praticienne Reiki Usui niveau 3 avancé et Karuna niveau 2.Massage aux huiles essentielles/Shiatsu/Fleurs de Bach
06 74 03 77 87   /   katerine971@hotmail.fr

…..elle a comprit, continué les auto soins et c’est un peu apaisée puis a appellé Kat qui lui a fait 4 jours de soins Reiki mixés avec les fleurs de Bach. Aux dernières nouvelles V, était beaucoup mieux.


Je ne cherche pas a l’expliquer juste a témoigner.

Hier soir au coucher tristesse que j’accepte je me laisse le droit de
ressentir cela et le droit de verser ma larme.
Mini séance de Reiki sans rien demander à mon « ange gardien » et ce
matin je repense à ce qui me rendait triste hier plus rien plus de
douleur plus de ressentis ni bon ni mauvais.
juste un sentiment de paix.
C’est fabuleux!!!!
Merci Reiki.


Et voili !

Un patient a 19h ce soir celui de l’opération du cancer de la prostate. Je fais comme tu m a conseillé et je me prépare avant comme tu m a appris….

Après la séance il y avait comme une atmosphère d’amour fraternel….

Il m’a serré fort et ma dit merci bon je suis croisée avec une madeleine alors j’ai versé ma larme et j’ai remercié le monsieur et reiki….

C’est fort. Merci



Jeudi 24 Septembre 2015


Question  – Je ne pensais pas avoir des questions sans réponses aussi vite après le stage mais…J’ai vraiment ressenti une grande connexion, très belle lors du stage. J’ai poursuivi à la maison, avec moins d’intensité mais cette même sensation d’apaisement. Problème, aujourd’hui c’est la colère qui ressort, et pas une petite colère. D’un point de vu très logique, j’ai beaucoup de stress en peu de temps (préparation des examens et pas assez de temps pour bosser,  un ado qui s’affirme et notre chambre, que je considère comme un havre de paix qui est inondée pour la seconde fois donc gros travaux en perspective). Mais cette colère me semble venir de plus loin, elle est quasi irrépressible. Je retrouve un sentiment que je connaissais lorsque j’étais ado, une montée de colère sans raison apparente et violente. Je la ressens également au moment de faire le Reiki, je suis donc obligé de faire un effort de volonté. Je préférerai que ce soit plus fluide mais je ne sais pas comment faire, ni comment  » guérir » cette colère…Y a t’il un lien avec le stage ? Une résistance ? quelque chose à comprendre ? ou je prends de la valériane et je vais me coucher ! lol…    Merci d’avance de ton attention.

Dom, réponse – bonsoir S…..je te réponds vite…avant que tu ne te mette en colère contre moi….lol…mets ceci en pratique ;

1 – Prise cosmique / 15mn ts ls jours…et…

2 – L’intégration : au coucher : un soir cheville gauche sur droite (poignets l’inverse) et le lendemain soir tu inverses.

bon, c’est plutôt de la rage que de la colère ( vois la différence sur le net ) je te passe ce lien vers un site précieux à mon travail : http://www.redpsy.com/guide/colere.html

il s’agit sûrement de mémoires accumulées, accumulées depuis la petite enfance. Des émotions entassées les unes après les autres, des non dits, des « ça me gonfle » non dégonflées, refoulées, détournées…..la clé est l’acceptation. ça génère une grande force spirituelle de transformation. mais ça ne suffit pas bien sûr. trouve des moyens de l’évacuer ; va crier dans la foret, dans la voiture, au bord de la mer. De vielles mémoires, anciennes vies, qui viennent cette année pour être libérées et préparer ton avenir !!!! Accueille et bénis la vie !!!! tu vas apprendre quelque chose de Grand. Ecris sur tout ce qui t’irrite, t’agace, te mets hors de toi et en écrivant ne retiens pas tes mots ni tes émotions ni tes larmes….l’écriture libère. Le Reiki te montre qu’il te faut évacuer le trop plein de l’asthme, évacuer ce qui t’étouffait. Dis merci à ta colère, dis lui « je t’aime merci ». Et vas y aussi avec les tisanes, ça aide et c’est bon. Tiens moi au courant.

L’horreur ! 

Question – Le 9 juin 2015 22:32, P…. <P…@free.fr> a écrit :

Alors que je m’étais endormie la fenêtre ouverte et les rideaux tirés, j’ai été réveillée par le bruit des rideaux que l’on déplace. J’ai ouvert les yeux et j’ai vu un homme accroupie sur le rebord de la fenêtre qui s’apprêtait à rentrer dans ma chambre. J’ai crié, ce qui l’a fait fuir. Je ne te dis pas dans quel état de choc je suis ! J’ai fermé tous les volets mais je n’ose plus aller me coucher. Quelle froussarde je suis.

Dom, réponse – quelle horreur ! j’aurais crié tout autant….tu es au rdc ? t’es sure que c t pas un rêve ? de toute façon ; c’est un Bon signe ! ça prouve que tu es protégée. Pourquoi ? Parce qu’il ne t’est rien arrivé du tout. Tu n’as été ni agressée, vi violentée…(…sic) ni blessée, ni volée….Le Reiki, avec la protection CKR c’est comme s’il t’avais montré  « vois, tu peux vivre pleinement, tu ne risques rien je suis là ! Je suis CKR. la seule chose que tu risques c’est une bonne frousse. Mais ça, vous humains vous aimez ça. » Qui a permis qu’il y ait assez de bruit pour te réveiller ? Le Reiki. Crois tu que si tu avais eu besoin de vivre une agression (citée ci haut) le Reiki aurait permis que tu soit réveillée et que tu puisse crier ? Non, sûrement pas. Or, ceci prouve que tu n’as pas a vivre ça, donc, tu ne le vivras pas. Tu es Initiée P…, ne pense qu’à ça et active le plus souvent possible CKR.


Q – Bonjour Dom, depuis hier matin, des angoisses me remontent… (notamment liées à mes dépressions d’il y a des années). je suis d’habitude assez sensible aux angoisses mais là c’est un niveau au dessus. j’ai du mal à faire la part des choses entre ces émotions « habituelles » et ce qui pourrait faire partie des évolutions d’après initiation. Quoi qu’il en soit, c’est probablement pour moi le moment de dépasser certaines choses (dont certaines que je croyais déjà dépassées…). Est-ce que ça peut faire partie des symptômes des 21 jours? As-tu des conseils pour les gérer ? Pour l’instant, je tâche de les accueillir sans trop m’y accrocher et en prenant du recul et en posant mes mains là où je ressens le malaise. Mais puisque je suis une angoissée de nature, forcément ça me tracasse un peu. Merci de tes conseils ! Bises, A bientôt,

Dom – oui, ce qui t’arrive est normal….appelle le « symptôme de guérison ». le Reiki te montre des angoisses. Les angoisses ne sont pas des émotions mais des signaux. Elles te signalent qu’il y a une peur que tu ne vois pas. Accepte l’angoisse et avec l’aide du Reiki, du Symbole, du 1er des Idéaux ; demande à VOIR quelle est la peur ?De quoi as tu peur ? Accepte cette peur, elle est légitime. Une fois cette peur reconnue, acceptée et nommée, tu peux aller consulter une sophrologue puis un acupuncteur. Le tout en continuant le Reiki, en commençant par la prise cosmique 15mn ts ls jours jusqu’à apaisement.

Je te conseille d’écrire tout ce qui te fait peur, dans le but de le sortir. L’écriture libère et informe sur soi. 

En cas d’urgence appelle de ma part ma praticienne associée : 
Kat Massié. katerine971@hotmail.fr 
Praticienne Reiki Usui niveau 3 avancé et Karuna niveau 2
Massage aux huiles essentielles/Shiatsu/Fleurs de Bach
06 74 03 77 87   elle se déplace à domicile !


Q – Après mon tsunami d’émotions négatives, vendredi ça a commencé à aller beaucoup mieux : ouf!

Dbonjour A…  je savais que ça ne durerait pas, mais je suis soulagé pour toi !!!

Q – J’ai vu Kat cet après midi, qui m’a fait un soin, ce soir, du coup je peux dire que ça va bien. Merci de m’avoir orientée vers elle, elle m’a bien aidée et elle est rayonnante !

D – je l’apprécie et la conseille aux cas d’urgences….!

Q – Cette semaine était très très chargée pour moi avec des déplacements, beaucoup de réunions et a posteriori, je me dis que j’aurais surement attendu un moment plus calme pour faire le stage si j’avais su qu’il pouvait se produire ce qui m’est arrivé.

D – non ! tu as fais le bon choix. souvent c’est dans le chaos que l’univers veut nous faire comprendre qu’on doit se prendre en main !

Q – Ceci dit, je ne regrette rien, cela m’a confrontée à cette épreuve certes difficile, mais riche d’enseignements et que c’était surement le moment pour moi de m’y confronter.

D – tu es courageuse…l’univers le savait !!!
ha ! les autres ! Grrrrr

Q – Je voulais te parler de qqch qui m’a fait dresser les cheveux de la tête. Je viens de terminer ma formation de massage lomi lomi et lorsque je l’ai apprise au niveau de la tête il y a les mains à poser sur les yeux, ils racontent qu’on fait du Reiki!!!!

D – je sais…..dés qu’on fait du bien aux autres, qu’on se fait du bien, les gens disent Reiki. C’est parce qu’ils ne connaissent pas le mot juste qui pourrait parler de ce qui se passe lorsqu’ils font ça. Alors Reiki, c’est un mot tout cuit, prêt à servir. 
Q -A la fin j’ai discuté avec la formatrice qui m’a dit qu’elle avait fait du Reiki à sa mère tous les jours. Elle lui posait les mains sur différentes parties du corps mais ne sait pas trop ce qu’elle faisait….
D – c’est du magnétisme, mais chuuuuuttttt ! douceur et lâcher prise…on ne peut pas conquérir le monde.
Q -Elle m’a dit qu’elle n’a jamais été formé au Reiki !!!!
D – lorsqu’on masse beaucoup, lorsqu’on fait beaucoup de Qi Gong on a une belle énergie qui circule par les mains et qui soigne, souvent autant presque que le Reiki. Bien sûr c’est pas correct de dire que c’est du Reiki, mais ce sont des gens qui ne savent pas ce que c’est que le Reiki puisqu’ils n’ont pas fait l’initiation. mais toi tu sais, alors SHK et humilité. Travaille ce qui te dérange. Ainsi tu pourras le retransmettre lorsque tu enseigneras le Reiki…
Q – Je trouve quand même un peu déplacé de parler comme ça du Reiki ou alors mieux, j ai entendu des pers dire qu’elle pratiquaient du Reiki pendant les massages sans avertir le massé…
D – idem, si la masseuse n’est pas initiée au Reiki, c’est pas du Reiki, donc l’énergie qu’elle leur donne ne fera pas les mm effets que le Reiki, elle n’ira pas à la cause, elle traitera juste le physique, pas l’émotionnel, donc pas besoin de prévenir.

Cher Dom,
Je remercie tous les jours l’univers d’avoir fait croiser nos chemins.
La personne que j’étais, qui voulait sauver le monde a fait du chemin depuis bientôt 5 ans. J’ai en effet compris qu’il fallait me guérir avant de vouloir soigner les autres. Petit à petit les nœuds se sont dénoués, les liens sont devenus plus souples les larmes ont beaucoup coulé et coulent encore…….Mais quel bonheur de se sentir libérer, de sentir ce poids qui m’étouffait se retirer. Je respire enfin !!!! Comme tu le dis en stage, avec le Karuna les épreuves sont devenues des expériences. Oh combien d’expériences remplissent ma vie !  Douloureuses mais aussi merveilleuses !!!
En écrivant ces mots qui coulent tout seul je me repasse le film de ma vie. Je n’aurai jamais pensé atteindre cet état de paix. Un jour décembre 2010 …… Sur mon chemin ….. J’ai croisé un merveilleux maître enseignant reiki Karuna. Il est parfois direct mais surtout il est humble et rempli d’amour.
Merci DOM de m’avoir initiée.
Merci REIKI de m’accompagner.
Merci les ANGES Karuna de veiller sur moi.


Q – Le 1 juillet 2015 09:12, <sandrine……@xb….fr> a écrit :
Coucou dom,
Aujourd’hui j ai le cœur rempli de tristesse:(la raison, le manque de correction des gens qui m’entourent qui on toujours une bonne excuse) j’essaye de faire preuve de compréhension, mais ou se trouve la limite…mais je me suis dit « qui mieux que dom pour me tirer un sourire….
ton humour et ta gentillesse  me réchauffe le cœur » .

D – Je te comprends Sandrine……. j’ai connu la tristesse toute ma vie, comme un clown bipoilant ; rire et tristesse. Un jour, de la comprendre suite à une rupture, elle m’a sauvé la vie. Aujourd’hui je ne suis plus triste. Sauf parfois, les gens qui souffrent trop…mais la tristesse est devenue mon alliée, l’alchimiste du deuil. je te passe ce lien, jette y un œil   http://www.redpsy.com/guide/tristesse.html

Mon opinion ; vois dans l’ADN de ces gens qui « te dérangent » ; leur programmation n’est pas celle de ton ADN en train d’être reprogrammée grâce au Reiki, tu as un niveau élevé maintenant, Reiki 3….songe que la réincarnation des âmes et des âmes est une succession….non une formation ou tous ensemble on apprend les mm choses en mm temps. Ceux là apprendrons plus tard, p’tr’ lors de cette vie, dans une autre ou dans d’autres vies….En vertu de ce principe ; travaille sur toi sur « ce qui te dérange » : où est ce que ça te dérange ? d’où est ce que ça peut venir ? et trouve la technique Reiki adéquate pour guérir la cause.
Le dérangement = la conséquence.
Une pensée négative, ou une mémoire négative = la cause.
La cause engendre la conséquence.
Et la conséquence peut s’aggraver, devenir maladie, accident, névrose, révolte colère et pire…

Acceptation et passez muscade

Q – Je suis bien rentrée mais avec pas mal de péripéties… La dernière ce matin a l’aéroport. J embarque ( la dernière alors que ce n est jamais le cas) et la, la nana me refuse et m oblige a mettre mon sac a main dans ma valise car valise et sac ça fait 2/bagages a main. Si je ne le fais pas la valise partira en soute et sera facturée 55€.
Là,  je fais appel au symboles ; distance, mental et ce beau symbole du cœur Reiki pour garder mon calme ( merci Reiki) et je prends tout mon temps car je sais que ca ne passera pas. Au bout de qqs min, la nana furieuse me dit : bon c est bon, allez y comme ça, vous n allez pas retarder l avion, les hôtesses ferment les portes….
Merci Reiki !!!!

D – bravo ! Désormais l’idéal de Reiki n°1 « ne te préoccupe pas » est amplifié par les symboles du  stage que tu as fais !!!

Pipelette dans la tête

Ce soir j’emmène ma fille chez son père et c est un vrai moulin a paroles. On discute et je lui dis, si tu parles autant c est pour telle et telle raisons …. Et donc c est une mémoire qui pourrait être enlevée . elle me dit d accord et me répond « mais je suis aussi comme toi !!! » Et là, la réponse me vient : « oui mais si je parle autant ce n est pas pour les mêmes raisons ». Le Reiki intervient et j entend : « tu parles bcp parce-que lorsque tu étais petite, tes parents ne se parlaient pas et donc je parle pour briser ce silence qui m a toujours dérangé ». Moralité : 1 mémoire du passe a transformer en moi.
Merci merci Reiki et merci dom pour ce stage magique car des ce soir je commence le nettoyage de mon enfance. Cette réponse m’ apporte les larmes car j ai compris la façons dont je devais écouter mais surtout entendre ; à l’intérieur.

D – et voilààààààà…merci CKS !

Et tu peux remercier ta fille ; elle a joué « à l’extérieur de toi » son rôle pour que tu entendes la voix de ta fille « intérieure ».

ce n’est pas pour rien que tu as laissé ici ton cordon…..de rechargement de ton mobile à communiquer !!!
je te l’envoie, donne moi ton adresse


Q – … – Par ce mail je viens te demander si tu n aurais pas trouve une boucle d oreille que j ai certainement perdu vendredi lors de la soiree partage. Soirees qui sont tellement  pleine de partage de joie etc;;;;
je rends grace tous les jours d avoir mis le reiki  et toi Dom  dans ma vie, celle ci se remplit d amour de lumiere  merci merci merci……
Une véritable thérapie!!!!   moi l assoifee d amour  , de calins de tendresse j ai enfin pris conscience du pourquoi , je me regarde enfin  et je m aime telle que je suis. Merci de cet amour de cette joie de cette lumiere  qui emane de toi .
merci pour ces  beaux stages pour ces soirees. A…

D – C’est le but, l’un des multiples buts du Reiki ; se laisser remplir, d’amour, de joie, de compréhension du mal pour l’éduquer et enfin ne plus juger, ne plus jalouser, juste observer ce qui « avant » dérangeait et rayonner.

ça va mieux….

Nouvelles de notre doyenne Praticienne Reiki 1 initiée ce printemps, 88 printemps…

Grâce à l’autosoin Reiki les gestes quotidiens qui me semblent moins dérisoires (« à quoi bon »? )

D – la pleine conscience qui re-germe en toi, l’unité avec le tout qui se reconstitue

Ma marche est un peu plus assurée, moins inégale,

D – aller de l’avant est le seul but de l’univers

Plus de calme intérieur tout au long de la journée.

D – j’en suis divinement heureux pour toi….


Q – en cour d’une soirée Reiki j’ai appris une technique d’intégration, mais par manque de temps on n’a pas trop développé sur ce sujet. Donc je suis allée sur le internet je suis tombé sur un site qu’ils parlent que s’est bien pour les personnes qui ont du mal à s’exprimer ( c’est mon cas) et sa me pose beaucoup de problèmes à mon sujet. Je suis au niveau du 3e degré Reiki. Je le pratique depuis mercredi tous les soirs dans mon lit mais je sais pas ce que je doit prononcer comme phrase et quel signe, pour le moment je fais les symboles SHK DKM CKR . Donc je viens à vous pour que vous m’en disiez davantage et que me conseillé vous. C’est un gros handicap. pour moi j’en souffre énormément. Merci pour votre aide

D – Bonjour…suite à votre question…l’intégration est simple :
Sur autrui :

1 – Le patient est allongé sur le dos.

2- Sa cheville droite sur la gauche.

3 – Ses bras croisés sur sa poitrine (ses mains sont proches de ses épaules).

4 – Nos mains de praticien sont posées sur les cotés du dessus de sa tête.

5 —————–Traitement de l’Esprit avec tous les symboles  selon le niveau de votre pratique  = 20 minutes……

6 – Changez les croisements des chevilles et des bras (inversez)

7 – Continuez 20 minutes ce traitement Reiki.

 ———-  Plus vous chanterez les Kotodamas, plus votre soins sera efficace.

Sur soi : 1 – On croise idem ; cheville l’une sur l’autre, nos poignets, croisés à l’inverse des chevilles – sont sur notre tête, 20 minutes.

2 – On décroise et on inverse, 20 minutes.

pas de phrase à prononcer exceptées les mantras des symboles dans cet ordre (selon le niveau de votre pratique) : HSZSN – SHK – SKSK – CKR  – DKM   – 3 FOIS LE MANTRA DE CHAQUE  SYMBOLE !

et bien sur, vous vous faites un envoie a distance durant 63 jours avec par exple cette prière :  « je m’exprime librement et joyeusement ».

si un jour vous passez par ici, je vous initierais au symbole de la gorge et vous guiderais pour neutraliser puis transmuter le blocage de communication. 

Bonne volonté

Q – …. »bonjour, après des années de questionnement, j’en suis arrivée à me dire que la bonne volonté et la sincérité ne suffisent pas à changer ce qui en nous nous conduit à commettre des erreurs. Il me semble indispensable de bénéficier d’une aide pour sortir du labyrinthe. Encore faut-il qu’une telle aide croise notre chemin. Pour cela, j’ai cru comprendre qu’il fallait que notre intention soit authentique mais si no us sommes en pleine confusion comment avoir une intention claire et donc trouver cette aide ? C’est le poisson qui se mord la queue ».

D – Bonjour…pour tenter de répondre à votre commentaire laissé sur le site…Tout dépend ce qu’on va appeler « bonne volonté ». Je dirais volonté de comprendre ce qui fait faire et refaire les mm erreurs. Comme vous l’exprimez vous mm, il faut une aide. Oui mais l’aide d’une personne d’envergure ! voilà ce qu’il faut souhaiter, demander, exiger de L’univers. Exiger dans le sens « décision ferme de changer ». C’est cette façon de demander et d’obtenir que j’enseigne en mm temps que le Reiki.
Quand à la confusion, elle se dissout avec la pratique du Reiki et des 5 idéaux combiné à l’activation de CKR, du symbole (Saint bol…avoir du bol…lol…!…) dés le 1er niveau Usui ou Komyo pour aller dans l’infinité. Plus tard (3 mois) avec les outils et symboles du 2ème degré Reiki, pour des outils plus performants afin d’aller dans la profondeur.
Et savoir que chacun a un rythme de changement et de résistance au changement qui lui est propre….mais si on pratique, ça change en dedans et autour de soi, c’est absolu.




Jeudi 14 Mai 2015         Punition dénonciation trahison

B : Je me trouve face à la prise cosmique qui m’appelle, colère et peurs, voilà ce qu’il me faut…. Et bien oui, une histoire de mon enfance revient à la surface et correspond à ce que j’ai vécu hier. Un grand merci pour l’aide que tu m’as apporté hier.

En classe de 5ème j’ai eu un professeur de maths qui venait de prendre sa retraite de l’armée, avant de pouvoir nous enseigner il faisait son cours pour lui par manque d’expérience, toute la classe s’est ennuyée ce qui fait que nous avons décidé d’enregistrer un de ces cours (sans le prévenir bien sur, le but était de lui faire écouter le lendemain afin qu’il se rende compte combien il ne nous apprenait rien) et je me suis portée volontaire pour apporter le magnétophone de mes parents (sans leur dire bien sur !). Ce fait remonte à la même période de l’année, au mois de mai. A la fin de ce cours , une fille (Laurence Baumann) de la classe est allé lui dire, de là, ce professeur est allé à la gendarmerie pour porter plainte comme quoi nous étions des espions !!!! La directrice du collège m’a convoqué et m’a mis des heures de colle…. Je ne peux pas décrire la peur dans laquelle j’étais face à mes parents, et aux  adultes du lycée. Comme d’habitude à la maison aucun mot de réconfort, par contre la directrice m’ a supprimé mes heures de colle en voyant dans l’état dans lequel je me trouvais, je pense que la « punition » a été et est encore aujourd’hui face à la situation d’hier de faire mon chemin de conscience, j’ai tous les outils nécessaires pour cela, EXISTER et prendre ma place sur cette terre….

Merci et belle journée

Dom : une émotion remonte à la surface, submerge, et ça créait une crise. En effet la prise cosmique est idéale et va calmer la crise. Par contre, pour guérir la mémoire du traumatisme vécu « dans le passé », ça coule de source ; tu fais la technique « guérison dans le passé »…tout simplement ! Il conviendra que tu la fasse 5 ou 6 fois – étalée sur 2 semaines, elle prend 3 minute à peine – sur les 5 ou 6 événements tels que tu les décris…jusqu’à ne plus ressentir d’émotion dérangeante.

Infection pulmonaire

V : Je viens de me guérir d’une infection pulmonaire et comme tu me l’a expliqué j’ai compris que je me suis laissé infecter par mes proches, ma famille, ma sœur plus exactement. Je voudrais me faire un envoie à distance pour ça et je ne trouve pas la phrase qu’il faut. Tu comprends je veux me guérir mais je ne veux pas que mes proches en souffrent, tu peux m’aider s’il te plaît ? Merci.

D : quand tu dis « je ne veux pas que mes proches en souffre » c’est comme si tu disais « je préfère souffrir à la place de mes proches ». Ça veut dire « je n’ai pas ma place dans ma famille, je ne la mérite pas » alors ils viennent te le rappeler en t’envahissant et comme tu ne t’autorise pas à leur dire « NON PAS MAINTENANT », tu te laisse infecter par peur de ne plus être aimée.

En Qi Gong les poumons représentent la famille et la protection c’est le tigre blanc.
Tigre = agressivité – blanc = qui est libre de toutes obligations terrestres.

Avec le blanc, il y a une correspondance avec le chakra de la gorge ; la liberté d’expression.

Agressivité blanche = Non, pas maintenant, merci = Fermeté et douceur, le meilleur antiseptique !!!

L’amour, s’aimer, c’est et ne peut être qu’inconditionnel !

C a d   « je me libère inconditionnellement de toutes pensées incompatibles à la libre expression de mes sentiments et de mes vrais désirs, dans ma vie en général et dans mon entourage familial. J’en suis rayonnante de joie et de générosité nouvelle. Merci « .
Et n’oublie pas de mettre CKS, Gnosa et Iava en avant !

Reiki et protection physique

S : j’ai fais un soin à une dame qui souffrait d’une sciatique. Dés le début du soin j’ai senti une pression au niveau du chakra du cœur qui ne m’a pas lâché.je lui en ai parlé après et elle m’adit qu’elle avait un blocage de ce chakra. Je lui ai donc fait un rééquilibrage des chakras et la pression a peu à peu disparu. Existe t il une méthode pour que je ne ressente plus ce genre de douleur ou est ce normal ?

D : La méthode existe oui ; révise le cours du stage, relis le paragraphe dans le manuel Reiki 1er degré de Planète Reiki !
C’est un soin quantique le soin Reiki ; vos énergies, vos chakras sont mêlés avec la patiente, une fusion émotionnelle d’amour et de compassion inégalable. Et la compassion se tisse avec l’empathie, inévitable. Vous venez en stage pour aider les autres, le Reiki vous apprend la compassion par le ressenti. Il convient d’être présent en pleine conscience lors d’un soin Reiki, être à l’écoute des sens, des sensations. Et des Signes !
Ce que tu as ressenti est un Signe. Un message non verbal que ton corps t’a adressé « écoute S…, cette personne ressens ‘ça’ : un blocage au chakra du cœur ».
Si on n’écoute que le mental, on s’affole et on se dit « haaaa, j’ai choppé une douleur dans le cœur » et ça, ce n’est pas de la compassion, c’est de l’apprentissage.
La vie de l’apprenti   sage   en devenir.

Donc, à l’avenir, accueille les sensations et dis toi « tiens, c’est peut être ça que le personne ressens. Je vais m’occuper de cette zone sur elle » et tu verras, ça disparaît de suite.


Le pied !

Question : j’ai une douleur au pied, comme une épine dans le talon  gauche.
Dom, Réponse : Le talon ; ta structure, la base de ce que tu es, d’ou tu viens, c’est sur ça que tu t’appuie pour marcher et avancer.
à gauche : cœur = une peine de rajoutée (à ceci ci dessus).

Q : Ce soir, je rentre du travail, encore une entorse à la cheville toujours à gauche.

D : entorse = ligaments : liens, engagements, ce qui te retient…

à la cheville : te sens tu retenue dans un engagement ? Dans un ou des principes ? Alors que peut être tu préférerais avoir du temps pour toi…
gauche : cœur = une peine de rajoutée (à ceci ci dessus)

Q : J’ai un problème de pied récurrents…..

D : Pieds : compréhension de soi et des autres pour avancer.

Q : Reiki depuis 30 min, ça n’a pas l’air de gonfler plus On verra demain.

J’ai du mal à marcher? avancer?  Je m’arrête moi-même?  Je ne sais pas trop ce que je dois comprendre.

D : Ce sont des principes inscrits dans ta mémoire, des liens tissés avec quelqu’un, ou avec l’employeur…tu dois te retenir surement au lieu de lâcher et d’aller de l’avant, écouter son cœur ; aller vers ton but.

Les mains sèches.

Q : Quelques mots pour te donner quelques nouvelles ! Ce week end d’initiation a été pour moi très intense et très fort plein de résonances ! Une véritable philosophie de vie qui correspond à mes attentes spirituelles. je pratique le Reiki depuis au quotidien sur moi si bien que je n’arrive pas à ma lever le matin. Est ce normal ? J’ai aussi pratiqué sur des proches autour de moi et ça à l’air de fonctionner puisqu’on  m’en redemande !
Le seul problème c’est que j’ai les mains qui sont très très sèches.

D : pour l’instant, le Reiki fait rejaillir ce qui a besoin d’être vu ; peut être un manque de sommeil à rattraper, peut être en fais tu trop (faire faire faire) et besoin de prendre le temps de se détendre, ou bien peut être un manque de motivation pour se lever chaque matin, quelque chose en toi effondré qui serait à remonter….ce sont des suggestions…
Quand à la peau sèche elle peut traduire un sentiment de crainte d’être jugée sur ce que tu fais, que tu touche, que tu manies (manipuler =main)…

Et n’oublie pas ; bois un grand verre d’eau après un soin.


Q : Le Reiki peut il faire qu’à une amie à qui j’ai fais un soins ait des douleurs plus fortes pendant ses règles ?

D : et oui, des fois le soleil peut mettre en lumière des zones d’ombres !….les menstrues représentent la féminité à assainir, à nettoyer, à harmoniser….et les femmes en France ont du mal avec « ça »…..alors le Reiki vient « déranger » pour les aider à mieux comprendre. Système du travail et de la production, toujours aller vite, là encore, manque de connaissance du symbolisme.
solution : continuer les soins Reiki sans relâche durant 4 jours ou plus, jusqu’à résultat. Guider la personne si possible vers quelqu’un qui l’aidera à mieux assumer sa part féminine.

Menstruations bis

X : Je pratique le Reiki en auto-traitement, régulièrement depuis 6 mois. Je souhaite vous faire partager mon expérience du Reiki face à la douleur ! Un exemple, J’avais  d’intenses douleurs lors de mes cycles menstruels! De fortes doses de médicaments Antadys et piqure de viscéralgine forte étaient mon lot!

Depuis que je pratique le Reiki, je ne prends plus que très rarement voire très peu de médicaments! Dans les moments d’intenses douleurs, il me suffit de positionner mes mains sur mon ventre. Dés le 1er contact, je ressens déjà une apaisement. La douleur s’affaiblie, je crois qu’elle est bientôt partie, mais elle revient, je reste un moment en répétant CKR, et je demande à l’univers de me faire vivre, l’apaisement de la douleur et qu’elle cesse définitivement!

Au bout de 20 minutes, je ne ressens qu’un souvenir de cette douleur. Mon ventre est paisible et doux. Je peux vaquer à mes occupations, tandis que toute douleur à disparue. Ainsi, je voulais vous dire que de 6 ou 8 Antadys par jour pendant 8 jours, il peut m’arriver, aujourd’hui d’en prendre qu’un tout au long du cycle !!! Je dis GRATITUDE AU REIKI! MERCI A MOI MERCI AU REIKI. NAMASTE!!!!!!!

Rétention d’eau

Q : Le 12 mai 2015 05:31,  <chris@….> a écrit :

Bonjour Dom quel est le soin le mieux adapté pour une personne qui fait de la rétention d’eau ? Merci d’avance pour tes indications . A bientôt fin M… pour stage Reiki 2. Bonne journée. C.

D : Bonjour C. Les problèmes liés à l’eau concernent le 2ème chakra, donc les émotions. Cette personne retient ses émotions.  à quel sujet ? Pourrait elle préciser ? Quelle partie du corps est touchée ? C’est cette partie du corps qui indiquera ou se situe la cause. la rétention n’est que la conséquence. il y a peut être une peur d’exprimer, peur de dire…
Personnellement Je travaillerais en soins Reiki sur l’esprit ; toute la tête et la gorge ; 30 mn.
Puis 6 à 9 mn sur le chakra du cœur et sa région.
Et terminer sur le bassin/bas ventre….Ce traitement au moins 4 jours de suite, jusqu’à résultat quoi !
Q : Juste pour vous remercier de l’échange en fin de soirée partage sur la crainte que mon petit papillonna virus revienne me titiller, et bien depuis je suis en attente de mon frottis donc physiquement ça va pas mieux ,mais moralement je vais très bien. Le fait d’en avoir parlé j’ai entendu vos conseils, donc beaucoup réfléchi sur le problème et dans la nuit du vendredi au samedi, j’ai rêvé que Dom ouvrait un bouquin et me montrait le nom de ma maladie « le syndrome d’A… et un nom suivait imprononçable!!! j’en ai conclue en me réveillant qu’il fallait que je bosse sur mon mental et j’ai commencé la guérison du passé pendant mon auto traitement, j’ai des outils maintenant à moi d’en faire bon usage. Encore merci pour votre générosité et votre gentillesse. A….

Je pratique l’auto-soin régulièrement, j’utilise les symboles régulièrement dans la journée…. SHK est devenu mon nouveau meilleur ami!

Au début, j’ai ressenti beaucoup de tristesse et ensuite j’ai enfin ressenti ce sentiment de joie et d’être « guidée », et ça fait un bien immense.

J’ai programmé également 4 cristaux ; j’ai obtenu de bons résultats sur mes réactions face à l’incompréhension des autres….je me sens plus sereine…
Les animaux 

Q : Comment fais t on pour donner du Reiki à un animal qui a une maladie ?

D : pour le traitement d’un animal c’est pareil que pour un humain ; l’esprit d’abord, donc toute la tête et la gorge – les animaux ont aussi des chakras et une aura, penser à traiter l’aura et les chakras !! et le corps ensuite….et on s’adapte aux postures de l’animal …


Q : Mon fils à de l’acné, puis l’aider avec le Reiki ?

D : l’acné vient d’une abjection de soi….tu traite le visage 15 à 20 mn…..plusieurs positions sur le visage….et si tu peux ; traitement complet, sinon : tête / cœur / bas ventre. et ce, pendant 4 jours d’affilé voir plus si nécessaire.

et tu photocopie l’estime de soi du livret Planete Reiki 1er degré,  et tu lui donne à lire : à voix haute chaque soir avant de dormir pendant 21 jrs…de ton coté prépare toi à accepter que ton fils va changer suite a ces traitements Reiki.

Médiumnité « la chasse aux sorcières ».

X : Il est important pour moi (que ce soit les Ateliers ou les initiations) que cela se passe dans un certain cadre : le respect du protocole (sinon ça part dans tous les sens).

D : De quoi s’agit il, pour vous, lorsque vous évoquez « le respect du protocole », pour vous…?!

X : Que le Maître Reiki soit capable de guider les gens en stage, que ce soit au niveau des réponses aux questions posées ou aux émotions qui peuvent jaillir en cours, par exemple.
D : Je suis animateur depuis plus de 20 ans et je ne sais pas faire autrement que d’être connecté en permanence à Mes Guides Reiki quand j’anime, sinon j’aurais aretté depuis longtemps. Etre canal, c’est la merveille du Reiki.

X :J’ai noté ceci : « Les ateliers ont lieu le vendredi, le prochain est consacré au chakra Ajna, le centre du discernement, le 3ème oeil, le vendredi 24 Avril, de 9h30 à 17 h »
= c’est très lourd de sens pour moi. Je m’explique. Depuis trois quatre semaines environ, j’ai la sensation qu’il se produit chez moi, au niveau du 3ème œil, quelque chose de nouveau … exemple : une personne se met à côté de moi, je ne la connais pas et je me mets à lui parler de son anniversaire et du gâteau au chocolat qui allait accompagner cette fête. Et comme par hasard, son anniversaire va effectivement avoir lieu dans les 48 h, et elle est en train de cogiter sur le fait de faire un gâteau au chocolat … idem, la semaine dernière, une personne approche sa main de la tête d’une autre (y), et tout d’un coup j’ai des pensées de problèmes de santé relativement à la personne (y). Quand je ferme les yeux et que je regarde la zone du 3ème œil, je vois un œil au milieu et il est à chaque fois différent (je ne voyais pas cela avant).
Pour l’instant, je mets cela sur le compte de l’intuition … mais je ne sais pas encore.

D : je m’interroge depuis plus d’un an car ces « phénomènes de médiumnité » sont de plus en plus fréquents, y compris d’autres cas ;  les personnes « envahies par des entités négatives« , ou celles qui voient des « fantômes » ou des « revenants« , entendent des voix, ressentent des choses….etc…de plus en plus nombreux.
Certaines personnes mal avisées, qui ne pratiquent pas le Reiki c’est sur, prétendent que le canal Reiki facilite l’entrée d’entités dans la personne initiée au Reiki…c’est impossible ; le Reiki c’est de l’amour inconditionnel. Les entités ne peuvent entrer que chez les personnes ayant des pensées très négatives. Et le Reiki est idéal pour rétablir les pensées et « chasser » d’éventuelles entités.

Par contre, ce que je pense, c’est qu’entre 1643 et 1644, le pouvoir des médecins et des pharmaciens était menacé par des gens comme nous ; médiums, herboristes, rebouteux, guérisseurs, liseuses de cartes et de filtres, les chamanes françaises….on les avait nommées sorcières car ça dérangeait le pouvoir. Et ça dérange là ou va l’argent, toujours. Ce pouvoir là. Ce fut un tragique et regrettable génocide ; « la chasse aux sorcières ».

Aujourd’hui, après 400 ans de terreur, nos âmes peuvent enfin « revoir clair ». Comprenez vous ? Le 3ème œil est moins voilé par la peur de la mort infligée violement. Car ce qui, entre autres choses, empêche l’ouverture du chakra frontal, ce sont les peurs obsessionnelles, comme la peur de mourir brûlé, écartelé, assassiné, peurs inscrites dans l’ADN. Et, grâce au Reiki qui agit sur l’ADN, son énergie d’Amour dissout le voile. Et aujourd’hui, le problème vient du manque de connaissance puisque à l’Ecole Nationale On n’enseigne pas la médiumnité…..donc, lorsque ça leur arrive la plupart de gens en ont peur.


février 2015 Demandez, je réponds

Un grand Merci à toi de prendre le temps de nous lire et de nous répondre avec sincérité et un grand Merci également pour ton intervention sur mes poumons en souffrance lors de la soirée partage! Très bonne soirée et semaine. Amour, Paix et énergies positives made in my heart!!!

Cristal de roche et Reiki

Question  – Je vais commencer un auto traitement à distance longue durée et  je voudrais savoir s’il faut que je nettoie mon quartz à chaque fois que change de tranche d’âge.

Dom – non, tu n’as pas à nettoyer le cristal puisque tu n’y mets aucune autre intention que les symboles. Simplement fais SHK dessus avant de commencer pour renvoyer les basses vibrations éventuelles à la terre, puis CKR. Ensuite laisse le reposer le temps juste de faire ton papier, et vas y, charge le de ton amour et des symboles.


Q –   J’ai beaucoup de colère en moi-même alors si, en plus de mes auto-soins reïki, tu peux me conseiller sur la voie à suivre pour l’apaiser, je suis plus que preneuse et motivée!

D – Fais la prise cosmique 15mn tout en récitant tranquillement les 5 idéaux et tu finis les deux mains sur le chakra du cœur…..7 jours de suite et chaque soir tu lis la prière de Luis « estime de soi » a voix haute (les 2 pages) avant d’éteindre la lumière et dormir. C’est une vraie alchimie ! Elle se trouve à la fin de mon manuel de praticien Reiki 1er degré que je donne en stage.
Colère, encore….
Q – ce weekend end je me suis sentie très en colère contre moi, contre beaucoup de choses en réalité, je n’ai pas réussis à pratiquer le Reiki pendant 2 jours…puis j’ai compris, à travers la pratique du Reiki et certains échanges lors de discussions que j’étais en colère contre un sentiment de culpabilité que j’ai et que je n’arrivais pas à exprimer et à m’avouer, et tout durant ce weekend end m’a amené à cela…..(j’ai donc appliqué le désolée, pardon, merci, je t’aime!) merci à la vie pour cet apprentissage !!!

D – c’est aussi de cette façon que le Reiki nous préviens qu’on a quelque chose qui cloche ; en nous y mettant bien dedans, comme ça on le Voit ! et on s’en occupe.
Q – « Les événements que nous ressentons comme mauvais sont ceux dont nous ne comprenons pas encore le rôle dans notre formation » nous dit le Maitre Wingate Paine […..] Quoi qu’il arrive dans ma vie je ferai face. Par faire face j’entends: je vais en tirer un enseignement, cela va me faire progresser, je vais trouver une façon de l’utiliser pour enrichir ma vie. » dixit Susan Jeffers dans la Vie à bras le corps.(le fameux livre retrouvé!).
Colère, rage, agressivité….

Q – Depuis quelques jours, j ai l impression de régresser, je suis agressive avec mon partenaire que je n arrive plus asupporter.
D –  le Reiki agit sur la cause profonde. Si il détecte une rage refoulée, enfermée par convenance, le Reiki va la mettre en lumière pour que vous la voyez et puissiez la guérir.
cette agressivité était en vous, quelque part dans un placard de la conscience. à mon avis elle est dirigée vers le père de la petite enfance (quand ??? le 2ème degré permettra de le retrouver) et non envers le compagnon, qui lui joue le rôle de déclencheur….le comprenez vous ?

Q – qu’est il advenu de ma patience et de ma tolérance?..je suis pourtant quelqu un de humble , qui aime mon prochain et qui ne recherche pas les conflits.

D – ne pas les chercher, les conflits, est un fait, les fuir, les éviter alors que parfois (pas tout le temps bien sur) parfois ils sont utiles pour résoudre un non dit et avancer dans la paix et le bonheur…..si la communication est non violente dans un conflit (et c’est possible grace au Reiki) l’idéal est que les eux conjoints fasse le Reiki ensemble.

Q – Longtemps , je me suis écrasée, je me suis effacée, je n osais m affirmer et dire les choses ; le stage m a apporté l assurance qui memanquait et dans mon travail c’est plutôt positif;

D – il n’y a pas d’affect dans le travail ! donc l’assurance de soi est  la bienvenue.

par contre dans mes relations privées (mon partenaire avec qui ça n allait déjà plus)

le Reiki va directement à la cause de ce qui n’allait plus pour la guérir.

Q – c est le désastre :une incompréhension totale ce qui aboutit à des conflits et des agressions verbales.

l’agression est de la rage, CaD le résultat des colères non exprimées, les non dits accumulés.

D – aujourd’hui derrière cette agression se cache peut être de la tristesse qui n’est pas exprimée. et surement des frustrations non exprimées.

Q – Difficile d en parler par mail car la situation est complexe . Je pensaisqu avec le Reiki et mon éveil naissant, mon désir profond de paix et d amour…

D – oui, c’est le but….mais pour y parvenir vous devez guérir une colère qui dormait en vous.

Q – …, je parviendrais justement à éviter les conflits;

D – on ne doit pas éviter un conflit, on doit les affronter calme, posée, et surtout en mettant toute la volonté à bien écouter l’autre, veiller à ce qu’il est le temps de tout dire ce qu’il a a dire sans l’interrompre, avec le plus d’amour possible cette écoute, et faire l’effort de le comprendre au lieu de se protéger et de vouloir avoir raison….alors a son tour on poura posément expliquer son point de vue.
tant qu’on ne sait pas le faire, on fuit les conflits. Mais voilà, un jour ils nous rattrape et nous fracasse ! C’est pour nous purger de vielles mémoires en nous.
je bénis le Reiki qui nous réveille et nous éveille.

demandez au Reiki de vous aider à vous exprimer calmement lors des confrontations, demandez lui d’exprimer vos sentiments au fur et à mesure et ne plus les refouler.

c’est ce que j’enseigne au 2ème degré, mais dèja entrainez vous à demander au Reiki ce que vous avez besoin.

Q – j ai tendance intellectualiser les choses et je sais que j ai des progrès à faire dans le lâcher prise ; je viendrai aux soirées partage en janvier sinon que me conseillezvous?

D– de faire beaucoup de Reiki, de demander pardon a votre compagnon, de lui expliquer que vous êtes en période de nettoyage et que de vielles mémoires demandes à être guéries, qu’elles viennent surement de la petite enfance et qu’il faut laisser le temps au Reiki d’agir……

S’il peut l’entendre ; lui aussi porte cette raisonnante en lui ; des non dits avec la mère de l’enfance mais il ne suffit pas d’en parler, il faut nettoyer……il faut des outils pour ça, ou consulter une spécialiste.

la relation amoureuse ne sert qu’à ça ; transcender (aller au-delà de la vie ordinaire) les blessures de l’enfance remontent en couples pour qu’on les voient et les guérissent, avec le Reiki on y met l’amour qui convient.


IPE – Intervention psycho énergétique, technique Reiki étudiée et pratiquée en atelier lors du stage niveau 3.

suite au stage reiki 3 de ce wend et à la tecnique de l’IPE que j’ai reçu pour mon hernie discale je n’ai plus mal du tout au dos. Tous les matins au réveil, quand  je tousse, me baisse, me lève d’une chaise je m’attends à avoir mal, mais plus rien……..C’est génial et je n’arrête pas de remercier.


Table de massage commandé sur Ebay ! Merciiiii de tout cœur pour ces précieux renseignement !
Une femme va venir me voir lundi pour une dépression !
Px tu me conseiller pour le soin ?

D – Tout est noté dans le mon manuel de Praticien Reiki 1er degré que je donne lors du stage ! Relis un peu, cheche ma chère M….

Ouiiii j’ai vu ! lol
Mais c’était juste si tu avais quelque chose à rajouter !!! 😉
J’ai déjà fais un soin à une personne en dépression, elle ne sortait plus de chez elle et broyait du noir, sans emploi et sans logement qui lui est propre et depuis le soin, ouahouuuu, elle sourit, voit positif et sort !!!! C’est magique !
J’ai fais un soin complet et la prise cosmique !
J’adoreeeeeeeeeeee le Reiki !!!!!!!


la fatigue

F – je suis bien pris par mon travail qui me fatigue physiquement et spirituellement lol.

Je vais être obligé de décaler ma formation niveau 2 pour l’année 2015 pour faute de disponibilité le week-end que j’avais réservé. Je m’excuse d’avance si ça te porte préjudice.
Amicalement. F

D – la fatigue n’est souvent due qu’à de la démotivation, peut être face à la somme de travail à « faire » et que « c’est pas com’on voudrait ».

Tu as le pouvoir d’y remédier, en faisant de temps en temps dans la journée :

* un auto-rayonnement sur les chakras, puis, *tantôt 1 position à la tête, 2 à 3 mn, puis une a la poitrine, et une au bassin…..*et le merveilleux idéal de Mikao ; juste pour maintenant, ne te préoccupe pas….occupe toi…..et * « juste pour aujourd’hui gagne ta vie honnêtement : mets y tout ton coeur et toutes les ressources que la vie t’as apprise, ce privilège là… les idéaux aident à recadrer nos pensées, le Reiki nous mets en stage dans des situations ou on a besoin d’apprendre à recadrer nos pensées, nos façons d’embrasser ou de rejeter les situations difficiles ou qui nous dérange. ces situations sont des professeurs, ne l’oublie jamais ! et donc :

*  juste pour maintenant, honore tes professeurs ( les situations ou tu t’y distords).

* chante le Kotodama du symbole, en boucle comme un mantra, le son égaye les cellules comme lorsque ta maman te chantait des chansons pour te voir sourire.

* et bien sur le plus de Reiki possible en auto-traitement le soir ou le matin tôt….compense le manque de repos et de sommeil. ces outils de changement du 1er degré sont déjà un merveilleux et puissant cadeau, il serait dommage qu’un homme de ta valeur les néglige (si c’est le cas bien entendu, sinon, oublie mon conseil et soutient). Les outils du 2ème niveau Reiki sont encore plus puissants puisqu’ils vont agir dans le passé et dans le futur pour un meilleur présent par une pleine conscience ……sur la conscience et le coeur….Tu seras le bienvenu à la date que tu choisira pour le Reiki 2ème niveau et qui te conviendra au mieux.

F – Merci pour tes mots qui font toujours du bien. Disons que je préfère venir avancer sur mes niveaux de Reiki l’esprit tranquille et le coeur libre. J’ai aussi beaucoup de mal à méditer en ce moment et à garder l’esprit focaliser sur un point. Forcément ce que je craignais arrive. A moi de faire face à ce nouveau test que la vie me demande de passer. Ce n’est pas par hasard qu’on me replonge dans cet enfer ! 🙂 On me demande très clairement de faire face à mes anciens démons que j’avais préféré fuir.
la fatigue

J’ai besoin de tes lumières quant à un soin que j’ai fait récemment. Je t’explique… Il y a quelques jours, une amie m’a contacté pour que j’y fasse un soin. Elle se sentait pas bien du tout, très fatiguée et toujours avec l’envie de pleurer sans raison apparente. Cette personne a un don de soigner avec ses mains, travaille les énergies, possède beaucoup d’intuition et a la faculté de voir les défunts. Je lui ai fait un soin, d’abord le scanner avec fuite au niveau de la gorge et plexus que j’ai comblées, et arrivée aux positions gorge, cœur, et plexus, elle se sentait vraiment pas bien, oppressée, elle avait du mal à respirer et des émotions sont ressorties sous formes de larmes. Quatre cinq jours après, elle m’envoie un sms me disant qu’elle se sentait à nouveau très fatiguée. Ne pouvant pas aller la voir en direct, je lui ai dit que je lui enverrai un soin à distance le soir même. Lorsque je l’ai fait, elle travaillait sur elle-même en même temps sans le savoir mutuellement et elle a ressenti le Reiki que je lui envoyais. Pendant que j’envoyais le soin avec Kotodamas, j’ai demandé à mon guide pourquoi elle se sentait si fatiguée, j’ai eu en réponse que c’était une attaque. Après le soin, j’étais pas très bien, j’avais mon plexus qui me brûlait. Le lendemain, elle me contacte et me dit qu’elle avait eu très mal au plexus elle aussi et qu’elle pensait que c’était une entité qui était accrochée à elle car elle avait vu physiquement à côté d’elle une forme brumeuse.
Je l’ai revue hier et je lui ai fait à nouveau un scanner avec encore une grosse fuite au niveau du plexus. Pendant que je travaillais sur elle, elle me dit qu’elle sentait que c’était passé dans le dos. Je lui ai demandé de se mettre sur le ventre pour que je regarde et effectivement fuite aussi au même niveau dans le dos. J’y travaille dessus, plus rien mais cela s’était déplacé au bas des reins, puis c’est remonté au plexus, puis épaule gauche ( à ce niveau elle a eu mal quand je travaillais sur son épaule) puis épaule droite puis plus rien.
Alors franchement je me suis demandé ce que cela pouvait être pour que ça se déplace comme cela. Mes sensations dans les mains sont les mêmes que pour les fuites énergétiques. En revanche, elle m’a dit que ce n’était pas la première fois que cela lui arrivait, que d’autres thérapeutes lui avait dit la même chose. Qu’en penses-tu ? As-tu vu ce genre de choses sur quelqu’un toi aussi ?
J’ai prévu de lui faire une IPE+ soin complet lundi prochain, est-ce la bonne solution pour la soulager ? Et ma plus grande interrogation, si c’est réellement une entité accrochée à elle comment je peux faire pour l’aider ? L’IPE sera-t-elle efficace pour cela ?

D – la fatigue vient généralement d’un manque de motivation réelle. Il faudrait qu’elle parle de tout ce qui l’ennuie, la dérange, lui pèse…la fatigue ! ou l’écrive. Ensuite qu’elle se remotive pour faire ce qu’elle a a faire. l’IPE est très bien pour ça.
Pour les entités ; avec une baguette de sélénite blanche ; faire des mouvements dans l’aura : les symboles, des 8, des cercles, des triangles…ect   tout autour d’elle.
il me semble que cette personne soit très mentale et fasse circuler en elle les énergies dures à son insu…..qu’elle en fabrique car elle doit avoir des peurs non conscientisées.

Q – Je viens te donner des nouvelles suite au soin donné hier. L’IPE a très bien fonctionnée, cela lui a permis de faire sortir ce qui la pesait. Je lui ai fait également le dégagement d’entité, sur le coup elle perdait d’équilibre mais tout est rentré dans l’ordre après le soin complet. Merci encore pour tes conseils. Sinon, j’aimerais savoir s’il te reste encore de la place pour passer la maitrise sur Cabrière à la fin mois et si bien sûr je pourrais m’y inscrire ? Si oui, peux tu me donner l’adresse exacte que je puisse réserver un hôtel au plus vite.
Q – Petite question un peu personnelle…..Que peut-on faire comme soin Reiki pour problème de fissures anales et hémorroïdes ?

D – les hémorroïdes sont dues à des restes de colère du passé, aussi à une peur des échanges….le sentiment accablement….

Fais la prise cosmique 15 mn par jour, et si tu as encore de la place ; traitement complet…..ensuite ; ça concerne le chakra racine…..donc 3 à 15 mn par jour les 2 mains sur le chakra ( chakra et anus) en récitant la phrase : « je me dégage de tout ce qui ne ressemble pas à l’amour. J’ai du temps et de la place pour tout ce que je veux faire ». et porter une hématite ( on en trouve des petites, parfois plates ) , colée avec un pansement sur la fesse….ou sur le chakra la nuit….et dans la journée un grenat, en pendentif ou/et dans la poche pour le toucher souvent.

Aujourd’hui j’ai vécu une drôle d’expérience grâce au Reiki….Les jumeaux de presque 4 ans, que je garde le soir et le mercredi apm, ne voulaient absolument pas faire la sieste. C’était colère et toute la suite…Les ayants isolés chacun dans une chambre, je me suis attardée avec un des deux. Je lui ai posé la main sur la tête en pensant et visualisant fortement CKR, puis sur le plexus solaire. En peu de temps, je pense 5 mn maxi, il a commencé à se frotter les yeux, paupières lourdes, et il s’est endormi. N’entendant plus le second je suis rentrée dans sa chambre et lui aussi s’était endormi presque en même temps que son frère…..Voilà !!!! J’en suis restée agréablement surprise.

Energie et énergie
Q – Lors de la formation que nous avons terminé le 1er module de formation en allant visité les ruines d’une ancienne chapelle du 12ème siècle dans le but de s’entrainer avec les baguettes. Dès le départ, avec une autre fille (qui pratique aussi le Reiki ), nous ne sous sommes pas senties très à l’aise à l’intérieur de l’enceinte de la chapelle… J’y ai ressenti une énergie assez forte mais ça m’a perturbé.  D’après notre enseignant, ces cours d’eau, souvent recherchés pour implanter des lieux de culte, retire notre force vitale quand nous sommes au-dessus… Et pourtant, dans les lieux de culte, ils auraient l’effet de modifier notre état de conscience et de nous rapprocher du divin… !!! De cette expérience, j’étais un peu perturbée : y-a-t-il dans la nature des énergies négatives qui pompent notre force vitale ?

D- A mon avis il n’existe absolument rien de négatif sur notre planète, ça serait contradictoire avec les lois d’Amour de l’univers. ce qui existe, se sont les mémoires qui sont inscrites dans l’humain. Certains lieux, même des animaux, des objets et bien sur des humains vont jouer le rôle de déclencheur ; vont réveiller ces mémoires car ils ont choisi ce rôle avant incarnation. Mikao lui mm nous a enseigné que TOUT est esprit avant manifestation.
Ce lieu t’a attiré à lui afin que tu saches que tu as une faiblesse au niveau de tes énergies….et….L’amie avec toi…vous avez toutes 2 les mêmes résonances et vous vous êtes attirées l’une à l’autre pour vous retrouver à cet endroit et vivre la même expérience. je trouve cette leçon très ludique. Certains nœuds de Hartmann font baisser l’énergie mais il s’agit juste d’un point et dés qu’on en sort nos énergies remontent de suite….peut être y avait il à cet endroit un gros nœud …??…toutes les autres personnes l’auraient ressentie comme vous ?
tu es « débutante » en Reiki, avec une faille à réparer, et pour cela il convient de faire un soin chaque jour et de tracer une à plusieurs fois/jours le symbole sur les 7 chakras, et ceci durant au moins….10 ans pour arriver à la maîtrise. C’est pareil dans tous les domaines.
Quand je  vais dans ces lieux je n’y vais JAMAIS sans faire mon rituel de préparation complet et y avoir envoyé du Reiki à distance pour moi.  Transcender est notre devoir sur la terre.

Q – ok merci Dom pour ta réponse. Pour la prochaine fois, je m’enverrai du Reiki à distance et j’essaierai de prendre un peu plus de recul par rapport à mon ressenti…

D – Ressentir : qu’est ce que je ressens ? ou est ce que ça me touche ? Que puis faire avec le Reiki ? Est ce que j’ai peur ? si oui ; de quoi ?
Spondylarthrite ankylosant 

Q – Merci pour ce stage Reiki 3 d’amour et de partage ! Ceci dit, une question… Ma maladie, Spondylarthrite ankylosante , qui m’a laissée en paix depuis un an s’est réveillée hier ; une forte poussée difficile à supporter. Penses tu que c’est en lien avec les initiations du degré 3? Un conseil?

D – il me semble bien que le Reiki et les symbole du Reiki 3 viennent réveiller ton enfant intérieur ; des choses à EX-primer, à dire, à sortir. GRANDIR QUOI !!!
la Spondylarthrite ankylosante, si elle se situe dans les lombaires est due à de la dévalorisation de soi avec besoin de soutient affectif ( d’ou être touché par le tableau du Dojo qui représente le cœur uni à l’esprit père divin). La Spondylarthrite ankylosante, si elle se situe dans les sacro-iliaques et le sacrum est due à de la dévalorisation de soi sur le plan sexuel et y compris « votre sexe et votre sexualité. Questions à te poser :

z’aurait on préféré avoir  un garçon ?

M’a t’on dit que j’étais nulle ?

Aurais je compté sur le soutient des proches et ne l’ayant pas obtenu je me sens sans valeur….?

Solutions Reiki : L’autotraitement + 1 rééquilibrage des chakras/semaine + les 3 méditations Reiki 3.

+ la guérison du passé longue durée !

+ des guérisons dans le passé !

et contacte les personnes du groupe Reiki 3 pour qu’elles te fassent des IPE ! A… est décidée.

Q – Merci Dom.
C’est tout ça ! sacro iliaque et lombaire !
Mère persuadée jusqu’à ce qu’on me mette dans ses bras que j’étais un garçon puis élevée comme un enfant de remplacement ( avt moi fausse couche d’un garçon ..)comme un garçon
Grosse déception désillusion affective.
J’ai déjà beaucoup travaillé dans le passé je pensais en avoir terminé …Merci pour tout ces précieuses indications

D – charge papier quartz un gros 1/4 d’h, laisse infuser une nuit et mets le ds la grille :

Un cristal pour : avant la naissance ! (charge/laisse infuser une nuit/mets ds la grille)

– 1 autre pour la grossesse !

– 1 autre à la naissance.

– 1 autre de 0 à 3 ans…………………au fur et à mesure tu les laisse ds la grille….


Q – Je voudrais savoir quel soin apporter a une personne pour l amélioration du fonctionnement de la glande thyroïde ? Puis je le faire ? je ne suis que Reiki 1 depuis une semaine, Merci.
D – Bien sur que tu peux, je t’ai correctement formé pour soigner les autres ! Je ferais 15 mn à la gorge après un bon scanner, ts ls jrs jusqu’à sentir un changement. Bien sur après ce 1/4 d’h de soin, l’idéal, si tu peux ; faire le traitement complet. Mais ce n’est pas obligé ds la mesure ou tu traite chaque jour.
la personne devrait porter une lapis-lazuli, ou une améthyste au cou, voir les 2 et une pierre de lune.
Les problèmes de thyroïde viennent souvent d’humiliations qui engendrent le sentiment de ne pas arriver à se réaliser et que c’est la faute à.
Un Chaman vient faire une formation là ou je travaille au mois d’avril suivit par des soins . Puis je la faire ? Cela ne va pas « contrarier » le Reiki ? Merci pour ces réponses à bientot C.

D – La formation chamanique, il n’y a pas d’incompatibilité avec le Reiki si il y a quelques jours entres deux formations.

Mais chaque jour fais CKR sur toi et surtout sur ts ls chakras avant de commencer, un bon ancrage.

Et…. méfie toi car souvent les chamanes dénigrent le Reiki en essayant de faire peur, que c’est dangereux……bien sur il s’agit de ceux qui eux mm ne savant pas ce qu’est le Reiki  puisqu’ils n’ont pas fait la formation…..

Celle là elle est terrrrrible !!!! j’adore !

Q  – Je voulais te poser un question concernant le traçage des symboles dans les mains, et oui j ai eu un gros doute pour la main gauche je pars de la gauche, mais pour la main droite je sais pas si je dois partir du côté gauche ou du côté droit? je te pose cette question car notre ancien maître Reiki m’avais expliqué que qd on tapait ds les mains il fallait que les symboles soit fait ds le même sens pour qu’ il fusionnent sinon sa marche pas.
J espère que sa te paraît assez clair?!!!

D – ça me parait surtout assez con de dire des trucs aussi insensés !!!!
Trace les symboles sur tes mains exactement comme si c’était des feuilles de papier ; tu pars toujours de la gauche….en frappant des mains les symboles sont imprimés dans les chakras des mains dés le traçage et tu peux y aller, frappe !!! ça MARCHERATOUJOURS, et ça marche avec tous les symboles. Et si tu fais les symboles à l’envers, la tête en bas, et bien ça marche aussi. Et si tu les visualise seulement, frappe, ça fonctionne très bien.
Je te souhaite un merveilleux wend à l’envers et à l’endroit ou tu sera le mieux TOI !!!…lol.
R 3 de fevrier 066   Février 2015  VOS retours de stages

1000 fois merci pour ce magnifique stage. Avec Angélique on a été ravies. On s’est appelées dans le week-end pour échanger… Ça a répondu à nos attentes. Personnellement je trouve que l’on a été hyper bien reçus, c’était un vrai moment d’échange et de partage. Cela apprend à aimer les autres et à nous aimer dans cette démarche. Merci…
MERCI pour ce stage Reiki 3, je suis littéralement transformée, j ai déjà bcp de demande reiki ( 5 pers depuis que je suis rentree). Mon ami radiesthésiste m a senti remplie de lumière avec un taux vibratoire relativement élevé.
Juste pour te remercier et te dire que cette soirée partage était vraiment réconfortante, apaisante et enrichissante !
Revoir les « bébés Reïki »  du stage 😉 et découvrir de nouvelles et belles personnes lors de la soirée partage est un cadeau inestimable qui existe grâce à toi et la belle personne que tu es…..nous faisons le reste et cela donne de très belles connexions et énergies! Merciiiiiiiii   ****************************************
Un grand Merci à toi de prendre le temps de nous lire et de nous répondre avec sincérité et un grand Merci également pour ton intervention sur mes poumons en souffrance lors de la soirée partage! Très bonne soirée et semaine. Amour, Paix et énergies positives made in my heart!!!
Je viens par ce mail te faire un petit retour de mes premières semaines de pratique du Reiki (ayant fait mon stage le 23 et 24 septembre). J’ai suivis ton conseil de continuer pendant plus de 21 jours la pratique quotidienne de cet « outil » et cette philosophie, dans l’idée d’une continuité de stage et pour le coup…cela devient une évidence de tous les jours!!! Aussi, je ne cesse de relire ton petit livret qui m’accompagne partout, que je trouve très bien et qui m’est d’un précieux secours en cas de doute ou questionnements! Je tiens vraiment à te remercie pour ton enseignement.
Aujourd’hui, après 20 jours de pratique de cette belle découverte que fut le Reiki, je me sens rééquilibrée, un peu plus apaisée et….je dirais disponible à moi (étrange!) et du coup beaucoup plus aux autres et au monde qui m’entoure ! J’avoue avoir fais de belles expériences ces derniers temps et avoir su….je dirais: attirer ou/et laisser venir et surtout apprécier les bonnes choses….j’apprends à avoir du recul sur les choses et du lâcher prise (c’était mon premier objectif en venant à ta rencontre et celle du Reiki) et à faire confiance aux énergies, à l’instant, à mes ressentis et en la vie.
Mmerci pour cette invitation à cette soirée partage ! je ne sais pas ce qui m arrive ; après mon stage niveau 1 ( en novembre) , je me suis sentie en pleine forme, sereine et HEUREUSE !
je voulais te remercier encore pour ces 3 jours de Maîtrise Reiki enseignés et animés avec une main de « Maître » ! simplicité, écoute, présence, amour     … merci…La voie est maintenant tracée, dans la lignée et dans ton sillage

Merci pour la générosité de ton enseignement et merci pour les photos de ces moments si  précieux en stage


Il est des lieux magiques

Déconnecté pour mieux se connecter.

Il est des des rencontres

Il est des âmes

Il est des rires 

Il est des regards

Il est des partages

Il est des échanges

Il est des enseignements

Qui apportent à vos journées 

Des étincelles de lumière

Et il y eu ce wend le stage de Maîtrise Reiki

Alors je sus…….. 

Merci à vous tous de m’avoir accompagné durant ces quelques jours


merci pour ces initiations à la maîtrise de la semaine dernière, je me sens vraiment bien avec Le symbole de Grand Maître Tibétain, c’est très serein (enfin très souvent…) et c’est le 1er symbole qui m’accompagne vraiment. Je tâtonne vachement sur les 2 autres, mais un peu comme d’hab à chaque nouvelle étape.
ce petit message pour te donner des nouvelles de S……, la nounou des mes enfants qui est venue avec moi lors de la dernière soirée partage Reïki. La nuit qui a suivi la séance, elle a dormi 5h d’affilée, ce qui ne lui était pas arrivé depuis des années. Elle en était agréablement surprise évidemment ! Depuis, elle se sent moins fatiguée, comme si une entrave qui pesait sur elle avait disparu. Je la trouve effectivement plus sereine.
Je me suis régalée pendant ce REIKI 3 ; et appris de très belles choses. Merci, encore pour ces deux jours , avec un groupe très homogène,  tellement EN OSMOSE, que nous ne faisions plus qu’un dès la fin de la première journée.
Je viens te remercier pour ce merveilleux we passé en « mode Reiki, sagesse et compassion »  en ta compagnie ! D’un point de vue personnel, je me sens plus sereine, un peu plus sûre de moi ! je sais que je vais encore beaucoup apprendre en ta compagnie !
suite au stage reiki 3 de ce wend et à la tecnique de l’IPE que j’ai reçu pour mon hernie discale je n’ai plus mal du tout au dos. Tous les matins au réveil, quand  je tousse, me baisse, me lève d’une chaise je m’attends à avoir mal, mais plus rien……..C’est génial et je n’arrête pas de remercier.


Octobre 2014……beaucoup d’eau d’un coup dans le sud est…..

Inondations à Saint Laurent le Minier, vallée de la Vis.

Inondations à Saint Laurent le Minier, vallée de la Vis.



Nous envoyons du Reiki à distance aux victimes afin que l’Univers
leur donne ce qu’elles ont réellement besoin de recevoir,
pour le plus grand bien de tous les êtres.




Polarités du corps inversées.
B – C’est un jeune homme très, très stressé qui faisait des crises importantes d’épilepsie et il y a quelques mois il a été opéré au niveau du cerveau, depuis des acouphènes se sont développés dans ses 2 oreilles. Voilà pour la situation. Ce matin il a reçu sa 2ème séance, un peu mieux que la 1ère au point de vue stress, par contre un effet plus que bizarre pour moi, je ressens l’aide de « guides » et dans le cas présent la sensation que sa droite et sa gauche sont inversées ….. prise entre le doute de mon petit diable mental ou de mon vrai ressenti, j’ai besoin de t’en parler. Que ux-tu me dire ? as tu vécu quelque chose de similaire,  j’ai besoin de repères et surtout de t’en parler.

Dom – Oui ce genre de chose arrive, haut et bas aussi…Continu les soins assez rapprochés.
Fais chaque fois un scanner méticuleux pour renforcer son aura. Trace Ckr sous la plantes de ses pieds et sur le chakra du cœur, puis trace Hszsn dans son aura pour annuler toutes distances avec ; l’univers et lui, lui agité et lui apaisé, avec son yin et son yang ; tu dois émettre cette intention a chaque fois que tu trace les symboles…puis tu trace le serpent de feu sur son aura, lui debout, puis couché, fais le plus souvent possible….après  le serpent trace  Shk et enfin DKM tibet pour la guérison spirituelle ; tous en grand dans son aura ! Et chante les kototamas pendant le soin, assez fort pour pénétrer au cœur de ses cellules. Je pense que cette personne a inversé ses polarités masc/fem pour se protéger ou pour essayer de comprendre ce qui lui arrive….insiste avec Shk…


Reiki à une infirmière

X – Je t’explique, je donne du reiki, je me sens bien avec ça. Dimanche soir, mon épouse qui a traversée un longue période très difficile, m’a demandé un soin. J’ai fait ce soin en demandant que tous ses mots refoulés ressortent elle qu’elle s’en débarrasse définitivement, un bon lacher prise.

D – cette façon de faire est incompatible avec le Reiki. Je ne l’enseigne pas de cette manière, n’est ce pas ….On ne fait pas de demande en faisant un soin car dans ce cas le mental s’en mêle et le Reiki circule moins librement, au risque que le donneur donne son énergie et hélas celle de ses attentes. Un soin Reiki se fait en laissant aller, on active le symbole , on chante le symbole, on récite en boucle la prière du symbole….et c’est tout

X – Elle est infirmière au CHRU, partie hier matin elle est revenue avec de gros mots de ventre hier vers 10:00, pour qu’elle s’arrête, c’est que c’est très très douloureux,..L’après midi elle a fait des cauchemars autour de son problème de rejet dans l’enfance (enfant subie et non désirée, elle ne s’en débarrasse pas, ça revient de manière récurrente avec des effets plus ou moins importants).

D – on peut demander au Reiki, au symbole, au guide spirituel d’aider la personne à comprendre les cauchemars – qui en réalité sont des messages très importants que la personne doit comprendre pour guérir de quelque chose – mais on ne dit pas au Reiki « que tous les cauchemars cesse et que la personne dorme profondément« ……….le Reiki n’est pas manipulable comme l’est l’énergie du magnétisme. avec des séances d’hypnose érikson. la sophro, elle devrait arriver à nettoyer et neutraliser ces souvenirs d’enfance et ces émotions récurrentes….

 X – Hier soir, elle était très mal.  De nouveau un soin de 1:30 dans de bonnes conditions. Ce matin, maux de dos importants, moral au plus bas, découragement….

D – il convient parfois d’aller voir un ostéopathe pour savoir quelles vertèbres sont en souffrance et agir en conséquence, sur le chakra concerné avec la phrase affirmative qui est dans le livret Reiki du stage sur ce sujet et en regardant dans l’un des livres conseillés en stage Reiki afin de faire un travail sur la conscience, avec l’esprit et le Reiki agir sur la cause.

X – Ma question : Est ce que mon soin peut avoir eu cette conséquence ?

D – non ! Néanmoins, peut être que si tu as trop de VOULOIR la guérir….ta force peut « forcer  » quelque chose….qui peut induire une tension…

X – Dois je continuer, à quel rythme, et avec quel type de message.,

 D – continue en ne faisant rien !!! Fais le rituel, au centrage fais une demande à ton guide  » s’il te plait fais en sorte que mon mental soit écarté de Vouloir la guérir à tous prix, et que seules des pensées d’amour occupent mon esprit durant le soin. Merci. » commence le soin par un scanner méticuleux. puis la prise cosmique 15 mn et enfin un soin complet recto verso.

 X -comment réaliser ce travail d’expulsion définitif indispensable,

D – voilà ! les mots que tu as écris et qui sont représentatifs de ta force : « expulsion définitif indispensable » ! Je rappelle que le mal vient d’abord de l’esprit et qu’ensuite le corps le manifeste dans son langage non verbal appelé douleur… Ton épouse est infirmière et la médecine soigne la mécanique pas l’émotionnel. Le Reiki soigne la mécanique l’esprit et l’émotionnel, et la cause. Cela demande un soin d’1 h ts ls jrs, mais aussi un peu de responsabilisation de soi, à savoir ; faire un travail convenable sur le mental, rectifier les pensées qui sont à la base des maux. Quitte à se faire aider par un psychothérapeute psycho-corporel…..

 X – en lui permettant néanmoins de ne pas avoir le moral à 0 ?

 D – avec beaucoup d’amour accompagne là en lui faisant comprendre qu’elle doit accueillir et accepter les messages que son corps veut lui transmettre afin de changer sa vie.


Merci à vous tous pour ces 2 jours! Je suis arrivée au stage, ne sachant pas trop ou je « mettais les pieds », et j’en suis repartie sereine, Heureuse, le cœur débordant d’Amour pour Vous, pour le lieu qui nous a accueilli, pour Tout ce qui a fait de ce stage un moment inoubliable (et au Reiki aussi )
En repartant je m’Aimais et c’est grave à VOUS. MERCI. Je vous embrasse de  tout Mon Cœur



G – mon fils a souvent des migraines en semaine et le  week end,  et doit passer son bac. Le 14 et le 15 juin,  je fais la prise céleste sur lui ,  mais  il a toujours des crises.  Je souhaite le soulager  voire le guérir  afin  de lui dire que je fais du reiki.  Que  dois  je  faire contre cette migraine ? Depuis le stage, je pratique  chaque jour  le soin complet,  c’est devenu  automatique….et je préfère le faire le matin. – avant de faire l’initiation reiki, j’avais des intuitions. Il y a 2 semaines  j’ai  pensé  à la fille  d’une copine  et  pour la 1 ère  fois  j’ai eu  en réponse :  comme un éclair,  des taches noires ……ça  m’a fait sursauté  de peur . A ton avis,  qu’est ce que ça veut dire ?

D – les migraines peuvent venir d’un dénigrement de soi ; autocritique, auto jugement, culpabiliser…ou bien être sous pression et ne pas tolérer d’être sous pression, résister au courant de la vie….parfois aussi cela peut venir des peurs sexuelles… ce qui serait efficace, c’est de lui faire un soin normal, commence par la tête, et doucement le questionner…il ne s’agit pas d’obtenir quelque chose, mais que lui parle, qu’il se décharge de ce qui lui met la pression. Quand aux intuitions, ça effraye au début, il faut accueillir, apprendre à regarder sans broncher, questionne ton guide, le Reiki , le symbole, demande à savoir, à comprendre….des taches noires ; le noir c’est ce qu’on ne voit pas, c’est l’ombre, le recueillement, ça peut être ce que le personne refuse de voir…


Email non corrigé volontairement.

B – bonjour Dom……Merci pour les témoignages que je lis pour comprendre ce qui m arrive…J ai la gorge qui me sert avec impression de gonflement depuis un mois et pensées négatives en boucle dans ma téte.;;;;;;;;;;Un collégue syndical de mon travail m a tenu par ses coups de fil un mois avec des menaces de m engueuler sans jamais vouloir me donner les explications avec le tél du bureau parce que sur écoute;;;Je rentre du cure thermal et méme sur le mont bugarach je n étais jamais tranquille..Je rentre ce mardi..Il vient me voir me parle de c problémes et repart…Il m a déstabilisé sans s en rendre compte sur un moment ou j étais épuisée..J ai été trés fatiguée et méme complétement épuisée quelques temps aprés le stage..Je suis restée en contact avec une personne du stage..Elle ne pouvait pas me venir en aide car comme moi nous avons besoin d un rapel et recommencer tout un wk ta formation du 1er niveau.. J ai compris que la gorge ct la parole non dites…Aprés le stage il est vrai que mon don de voyance a été beaucoup plus loin mais peut étre aussi trop loin..A remuer la m…. c a éclabousse..J ai remets tout cela a l univers mais tout reste dans ma gorge quand méme..Mon kiné m a vu hier et a constater que méme ma machoire est contracté a fond….J ai perdu aussi ma joie de vivre parce que tout me stress..J ai toujours autant de foi ..Et comme dans un témoignage de ton éléve je ne recois plus grand chose au niveau spyrituel…Je reviens sur Nimes vidé.Sans motivation…Je suis consciente de mon état…A bientot Dom de te retrouver en septembre..

D – Porte sur toi un quartz citrine naturel en pendentif la pointe vers le bas !!!!
Les quartzs de citrine ou quartz avec de la citrine aident à se sentir bien en nettoyant le plexus solaire. Mets aussi de l’œil de tigre dans la maison et de la tourmaline noire pour éloigner les mauvaises ondes envoyées par les autres.

IMPORTANT : tu as écris « ma gorge me sert« …..alors rends lui ce service, donne lui du Reiki.

Il y a la phrase du chakra dans le chapitre des chakras sur le livret du stage, utile là avec la technique apprise….ce qui t’arrive est normal. on appelle ça , rappelle toi ; « symptôme de guérison ». le passé a besoin d’être guéri, et ça passe par un certain chaos, accepte le et prends toi en main en faisant l’autotraitement quotidien. Puis, 2 fois par semaine offre toi un grand et beau rééquilibrage des chakras – prends la fiche du stage et suis la méthode qui est si facile ! Pour les angoisses et la dépression une fois par jour fais-toi une prise cosmique 15mn. Et tous les soirs au coucher et tous les matins au réveil récite à voix haute les 5 idéaux. Chaque fois que tu te sens mal, n’hésite pas : chante le Kotodama , le mantra C K R.


Je tenais a te remercier pour le diamant herkimer, que tu m as offert lors de la soirée partage, il m a touché en plein cœur!!! C est magnifique de travailler avec!!!!ne sachant pas si j aurais l occasion de revenir avant la fin de la saison, j’éprouvais le besoin de t exprimer ma joie et ma gratitude d avoir passé mon deuxième degré auprès de toi…bouddha Gautam a dit concernant la confiance en ver un maître: fiez vous au message du maître et non a sa personnalité…dans ton cas le message a fusionné avec la personnalité et ça crée un maître avec une énergie magnifique, alors merci de tout mon cœur de m en avoir fait profiter. Je te souhaite une très belle fin de semaine. a très bientôt. Sandrine.


plus aucune douleur vive

S : je tenais à vous signaler : depuis samedi après-midi, plus aucune douleur vive. un peu de fatigue, mais un grand mieux, plus trop de saignement depuis aujourd’hui dimanche: besoin de tranquillité totale, aucun mouvement (ni sortie, ni activité). aujourd’hui : prise de conscience: « j’accepte » (!!!) (c’est pas trop mon genre pourtant, j »en suis surprise moi-même). grand mieux-être juste après, grande compassion, détachement à la colère et irritabilités …paix sérénité interne, sécurisation, qq chose s’est passé, je ne sais pas quoi, c’est profondément intégré en moi, ça ne partira pas, c’est durable, c’est très stabilisant, protecteur, réparateur je ressens la confiance en toute chose, chaque événement semble avoir trouver sa raison d’être, même les pires, je suis simplement bien. je pense que si moi je ne sais pas, vous, vous le comprendrez. bien fraternellement, je suis de tout cœur avec vous .


je fume moins, je dors mieux etc…

Bonjour Dom, Merci pour le contact de R…..pour des soins Reiki à Lyon, et pour ce week-end précieux de rencontre avec le Reiki 1er degré à Juvignac ! Une semaine après il m’apporte déjà des choses incroyables, ça me rend de plus en plus « boulimique » de reiki !! Je suis arrivée à Juvignac fermée et bloquée… Pour ne rien arranger, j’ai toujours eu tendance à m’effacer et disparaître dès que je suis en présence de plus de 3 personnes…Depuis quelques jours, je crois que les choses sont plus fluides et plus simples, certaines choses se débloquent. J’espère enfin parvenir à m’encrer. Je sens également que des émotions douloureuses sont sur le point de remonter à la surface, mais le calme et la plus grande clarté que m’apporte le reiki me permettront de gérer tout ça, quand il le faudra. Il m’arrive depuis pas mal de « coïncidences », petites et grandes ! Pour l’anecdote, je disais à un ami que mon prochain contrat de travail se termine mi-janvier, mais que j’ai toujours eu confiance en l’avenir pour ne pas m’en préoccuper. Le lendemain je recois une proposition de l’opéra de T….à qui j’ai envoyé un Cv il y a 4 ans, sans ne jamais les avoir recontactés !!! La vie est dingue ! Bref, le reiki m’a aussi énormément détendu pour mes leçons de conduite, plus de stress. J’espère qu’il sera avec moi la semaine prochaine quand je passerai mon permis !! Je crois que mes sens sont un peu plus développés, je fume moins, je dors mieux etc…Beaucoup d’autres choses à découvrir encore j’imagine, en tout cas je suis très heureuse d’avoir rencontré une nouvelle approche qui s’accorde à mon chemin de vie, et une autre manière de compléter le développement de la voie du cœur ! Merci à toi et Isabelle. Et à bientôt pour le 2e degré ou pour une soirée partage. Bonne soirée et plein de belles choses à venir, M…


L – Je t’écris un peu en retard, merci pour les lectures. Depuis ma maîtrise Reiki avec toi en Juin, je me suis ouverte à beaucoup de lecture et de découverte, notre ame , nos guides, Ainsi qu’aux pierres et aux quartz. Tout change, tout est plus fort, l’énergie est multiplié par 10. Je te remercie encore pour ce merveilleux stage, et cette belle rencontre. Amicalement. L.

Dom – S’occuper des autres est une nourriture délicieuse pour notre âme. Initier, enseigner, permettre aux autres de comprendre et de relativiser, leur donner une voie d’espoir de progression, leur retransmettre des « savoir se prendre en mains »…tu comprends pourquoi j’aime enseigner le Reiki ?…voir les gens heureux….


Ho ! Le stage 3e niveau, je l’ai beaucoup apprécié !  J’ai ressenti un effet plus fort et la force du symbole de la gorge je m’en suis   rendue compte le lundi matin, quand très tôt, j’ai transformé à vitesse grand V, une discussion qui s’annonçait sous de mauvais auspices,  grâce à l’imprévu de l’humour (merci Chi Ka So), en bienveillance. Merci Reiki ! Bisous à toi, M.


Des petites news de la vie parisienne bien tumultueuse depuis l’initiation du symbole de Cœur ! Pour imager…. l’océan de ma vie c’est déchainée…. mais j’ai gardé la tête hors de l’eau en pratiquant ce bel outil qu’est le Reiki 2ème degré, et surtout le symbole du Cœur qui m’a beaucoup réconfortée ! Alors Merciiiii


Juin 2014….après les fleurs de l’abricotier en Mars….
…les Abricots !!!


Les problèmes de cervicales.

– C : Bonsoir Dom. Depuis le stage de Reiki fait a Nîmes, j’en fais tous les jours sur des durées variables selon les possibilités. Je m’en trouve mieux mentalement et physiquement. Depuis deux jours j’ai des douleurs très fortes au niveau des cervicales (lieu de mes problèmes de santé) je me pose donc la question : au bout d’un certain temps de soin concentré sur une région bien précise, faut il espacer les séances ? Ou bien ne faire que certain soin et non la globalité ?

Dom : si cette région du corps est TA ZONE DE SOUFFRANCE, le Reiki réactive un message non verbal – appelé douleur – te signale de beaucoup t’en occuper. Au moins un quart d’h tous les jours sur cette zone. le must serait que certaine personnes du stage viennent t’en faire aussi (en échange de soins par exple).
Ça doit prendre le temps que ça doit prendre un tel soin…..regarde aussi au niveau du chakra correspondant – sur la fiche que je t’ai remise lors du stage il ya des indications sur ce chakra – la gorge n’est ce pas, organe d’expression, de réalisation de l’essentiel de soi. Ensuite tu devrais aussi consulter un ostéopathe, lui demander quelles vertèbres ( C N°….?) et avec ça je pourrais te donner des pistes der réflexion…

C : merci de ta réponse, cela me conforte dans le fait de continuer régulièrement le Reiki et pour répondre exactement a ta question ; j’ai un rétrécissement du canal rachidien a hauteur de c4 c5 c6 qui sont soudées entre elles par de l’arthrose, d’ou inflammation ; d’ou douleur.
je vais donc persister pour me soulager déjà de la douleur et a ce propos suffit il de faire le rituel de préparation suivi de la zone a traiter assez longtemps et le plus souvent possible ou bien 1 fois par jour faire le processus complet d’auto traitement.

Dom : si tu peux…le traitement complet en plus du traitement local.
sinon : Traitement local : tous les jours minimum 15 mn et 2 positions à la tête + 1 position poitrine + 1 position bas ventre / le soir : les pieds.
< la région des cervicales est souvent liée à de l’insécurité, de la peur, sentir une menace planer sur soi : sentiment d’avoir une épée de Damoclès suspendu au dessus de la tête, danger qui peut s’abattre à tous moments…
c4 : colère, culpabilité
c5 : ne pas dire, ne pas s’exprimer
c6 : porter la croix de l’autre
< et l’arthrose : traduit souvent un endurcissement, fermeture du cœur ; pensées devenues froides et dures envers une personne, une situation ou la vie en général.

Avec le Reiki ; pour ré-ouvrir son cœur, scanner toutes les personnes et toutes les situations, une à une ou on s’est endurci – durant un autotraitement Reiki par exemple – et demander l’aide à l’Univers, au Reiki, au symbole pour réparer et ré ouvrir.
L’importance de guérir l’esprit. Avec le Reiki chanter le symbole et dire à voix hautes les 5 idéaux du Reiki matin au réveil (sous la douche !!!???!!!) midi et soir au coucher, avec la sophrologie, les fleurs de Bach sont efficaces pour lâcher et comprendre….ect, et tenir un morceau de quartz rose tenu dans la main pendant le chant ou la récitation des idéaux va aider, équilibrer. Ainsi qu’une Rhodocrosite sur le chakra du cœur pour la douceur.
La voix est l’expression de l’âme, le verbe résonne dans l’univers et nous en recevons l’écho. Chanter les idéaux renforce notre pouvoir de guérison.

Faire du Qi Gong/du yoga/du chant et des choses qui permettent de prendre la parole, de dire, de décider.

L : j’ai un petit kyste, je vois le chirurgien dans 15 jours. Mais j’ai l’intention d’utiliser ces 15 jours pour faire du Reiki ! Dans tes doc et dans les notes que j’ai prises lors du stage Reiki 1, il y a plusieurs façons de faire. Tu peux me dire quelle est la meilleure dans cette situation? Merci

– Dom : bonjour L.
la technique laser-Reiki marche bien sur les kystes, c’est pratique cette précision.
Quoiqu’il en soit c’est un traitement local, donc : 15mn ts ls jrs + au moins 15 mn de Reiki sur la tête et le cœur, soigner l’esprit, y compris l’esprit du cœur. Et les pieds pour le retour à la terre des énergies indésirables. Recycler !

L – 2ème question: je fais un soin pour ma fille pour sa période intra-utérine. j’ai déjà réactivé 5 x le cristal. est-ce qu’il y a quelque chose qui m’indiquera que c’est suffisant?

Dom – 5 x réactivé ; donc tu as fais 5 x 4 jours = 20 jrs…..c’est une bonne période ! Écouter ton cœur pour savoir si c’est assez, avec Sksk

L – et ensuite comment on fait pour la fin du soin, comme d’hab? (brûle le papier et nettoie le cristal) ou quelque chose en particulier?

Dom – c’est ça !

J : Bonjour Dom, J’ai eu l’honneur et le plaisir au cours d’un séjour de donner 4 soins à un ami de 75 ans qui était bloqué au niveau du cou par de l’arthrose cervicale. Il est satisfait du résultat et moi de faire connaître l’efficacité du REIKI.
< Notre fils W… dont j’avais eu l’occasion de te parler au cours du stage de REIKI 1 (accident de moto ) est resté à la maison. A notre retour nous constatons côté gauche de son cou que la glande parotide est démesurément enflée. Il pensait que ça venait d’une dent. Hier matin, le dentiste après radio, lui a conseillé de voir son médecin traitant avec la radio et le nom d’un spécialiste à l’hôpital d’ORANGE. Notre médecin étant absent hier, j’ai pris RDV pour 14h30 aujourd’hui. J’ai consulté PATHOLOGIE DES GLANDES SALIVAIRES sur internet. J’ai aussi consulté les ouvrages dont je dispose sur le REIKI. J’attends le diagnostic de notre médecin, je pense qu’il va commencer par des antibiotiques. et si Willy est d’accord, je lui ferais 4 soins complets, plus à chaque fois 20 mn à 1/2 heure au niveau du cou.
Je te remercie humblement pour ton soutien dans le développement de mes capacités spirituelles et de guérison, pour le bien-être de ma famille, de moi-même, de tous et de l’univers ! Merci REIKI, merci Dom !

Dom : Bonjour J…; les glandes salivaires, les parotides, sont représentatives d’une perte de gout de vivre, une perte de saliver devant les plaisirs de la vie, peut être associé avec une colère rentrée, refoulée ( envie de cracher son venin = salive = cracher).
peut être cette personne est elle un peu dépressive, même sans le savoir.
– as t elle perdu le gout de vivre ?
– est-elle heureuse ?
– est-elle triste ?
– qu’est ce qui la rend triste ?
– qu’est ce qui lui provoque de la colère ?
– quel est la chose qui la rendrait heureuse et qu’elle se retient de « savourer » ( de savourer un met, saliver au plaisir de…)
Tiens cette liste de questions près de toi et, fais lui un soin en commençant par la tête, et, arrivé au niveau du cœur, commence doucement à lui poser les questions. le but étant qu’elle se vide, qu’elle se décharge….qu’elle exprime ce qui est comprimé en elle. Rien ne vaut la parole pour ça.

C : bonjour dom, je suis dans le cas ou je vais faire un soin reiki complet, pour une personne qui ne pourras que s’allonger sur le dos. comment dois je m’y prendre pour finir correctement le soin, sans occulter kenoyoku de fin de soin,ainsi que le balayage des energies lourdes.
merci pour ton conseil et ton aide. A tres bientot…….C. (reiki 1 eloquence)

Dom : bonjour C…dans certains cas comme celui ci, on s’adapte ; tu oublie les finitions, tu fais un scan très correct en début de soin pour réparation de l’aura, et un bon lissage en fin de soin suivi d’un remplissage par rayonnement.
Ensuite, tandis la personne descendue de la table de Reiki est debout, une fois à peu près réveillée, LA ! Tu fais Kenyoku dans son dos, et le balayage (plus en douceur évidemment) comme tu peux !


Bonsoir Dom,
Mille merci pour ton aide d’hier au salon sésame. Le soin m’a apaisé et la citrine que tu m’as conseillée et aidé à choisir a été come un baume sur mon ventre.
Aujourd’hui, l’orage est passé… Ta présence a vraiment été un cadeau pour moi
A.M de Nimes
S : Bonjour Dom. Pourrais-tu me dire comment me nettoyer après mes journées de travail en psychiatrie. J’ai la sensation de revenir avec des énergies négatives. On m’a parlé de la douche Reiki. Peux tu me l’enseigner ?

Dom : Bonjour S…tout d’abord, révise les notes du stage reiki 1 sur CKR : avant d’arriver au travail ; trace ckr dans les mains/aura/espace et trace Ckr sur les 7 chakras. pendant ce temps tu t’imagine enveloppée dans une bulle dorée et tu te vois ainsi le reste de la journée au travail. ça te permettra d’être protégée….
< De temps en temps ( disons 4 fois dans la journée/ poses pipi par exple, ou avant d’allumer la cig) isole toi et recommence ; trace un petit ckr sur les 7 chakras, pendant ce temps tu t’imagine enveloppée dans une bulle dorée et tu te vois ainsi le reste de la journée au travail. > Et, en fin de journée, prends le temps de te doucher : la douche reiki :
La douche de Reiki.
1) Tenez-vous debout ou assoyez-vous confortablement.
Fermez vos yeux ou laissez-les à moitié ouverts.
Respirez lentement, naturellement.
2) Gassho (Mains jointe sur la poitrine)
Ecartez les mains et levez les le plus haut possible.
Imaginez que vous recevez une douche de vibrations Reiki et de lumière de la source de l’univers.
En même temps dites fortement dans votre esprit;
– Ckr …ou Dkm.
3) Sentez les vibrations de l’énergie du Reiki.
Baissez les mains devant le corps, les paumes faisant face au corps.
Le Reiki émane des mains, ainsi que la Douche de Reiki qui continu à tomber de l’univers.
De cette façon, l’énergie inutile est nettoyée et les « restes » rendus à la terre
Refaites cette pratique plusieurs fois.
4) Gassho en remerciement pour terminer.
S : Bonjour Dom, Encore un grand merci pour le stage degré 2 de Reiki de ce week-end, très intéressant et très intense:)
Je te contacte car j’ai une question pour laquelle j’ai besoin d’avoir une réponse, concernant la programmation du cristal lors de l’envoi de Reiki à distance pour soi. En fait, lorsque je me centre et me concentre sur le cristal et le rituel, j’ai souvent des pensées que je qualifierai de « parasites » (des pensées, mots, idées qui n’ont rien à voir avec l’instant présent, et qui seraient plutôt des choses angoissantes et négatives) et qui justement viennent me gêner dans ma recherche de concentration.

Dom : ça arrive presque à tout le monde, impossible de ne pas être perturbé en méditation, car l’envoi à distance en est une.
Solution ? Activer et utiliser SHK pour apaiser le mental et dire à voix haute le nom des symboles et une phrase affirmative très positive comme : « énergie de lumière entre et remplie ce cristal de ton amour infini….cette énergie est pour moi….toute la journée je suis entourée de l’énergie des symboles et de l’amour du Reiki tout est bien beau et grand pour moi.. ».ect, avec beaucoup d’amour.

> Puis, peu à peu, tu diras au mental, doucement mais fermement « tais toi, tu n’as rien à faire ici » en ajoutant CKR pour le rassurer.

au bout de quelques temps tu devrais arriver à faire tes rituels dans un calme….tout relatif.

> Fais aussi le rituel de préparation à voix haute ? forte et claire, sois guerrière, de lumière, mais guerrière !

S : Ma question principale est donc celle-ci: est-il possible que ces pensées involontaires se programment malgré moi dans le cristal ? (c’est cette éventualité qui m’angoisse également, à vrai dire), même si je suis consciente qu’il faut certainement un peu d’entrainement et de pratique pour que ce phénomène s’estompe.

Dom : il te suffit : en position Gasho, d’affirmer ceci avant de commencer : « je suis praticienne de Reiki Usui de niveau 2 et je vais remplir ce cristal d’amour et de Reiki et le programmer pour mon plus grand bien et pour le bien du tout. Seules mes idées et mes pensées bienveillantes entrent dans la mémoire du cristal, je suis protégée à tous les niveaux. Merci et…Ckr 3 X fois ».

F : J’ai suivi le stage REIKI 1 des 11 et 12 janvier 2014 et j’aurai un conseil à te demander.

Ma nièce vient d’accoucher d’une merveille ! petite Eva ! et pense déjà à ses premières vaccinations pour lesquelles elle a une certaine réticence. Puis-je l’aider par des séances de REIKI (et comment) pour gommer les effets secondaires éventuels de cette vaccination ?
Je pratique régulièrement sur moi et j’essaie, dès que j’en ai l’opportunité, d’en faire profiter mon entourage. J’ai notamment bien aidé ma nièce pendant sa grossesse et surtout j’ai soulagé sa douleur après l’accouchement.

Dom : bonjour F. l’idée serait de pouvoir faire 3 à 5 mn de Reiki au vaccin avant l’injection….mais le toubib le voudra t il …!!
Sinon, tu feras un soin au BB durant les 3 jours avant, et un soin durant 3 jours après, 10 mn chaque soins ; 3 mn tête/3 mn cœur/3 mn ventre/ 1 mn ou 2 pieds.
bons soins

F : Merci beaucoup pour ta réponse. Je pense que 3 mn de Reiki au vaccin avant injection sera possible.
Une autre question me vient à l’esprit : peut-on faire du Reiki à distance sur une personne que l’on connait bien et à qui on aurait déjà fait une ou plusieurs séances en direct ?

Dom : oui, aucun souci….peut être la prévenir, il peut se passer des choses, même agréables….

F : Parfait, merci beaucoup

A : bonjour Dom ; j’ai fait plusieurs soins à distance et à chaque fois je me sens « vidée »
si j’ai bien compris ce que tu as dit ce n’est pas normal. je ne sais pas quoi faire. c’est dommage parce que dans l’ensemble les résultats sont plutôt satisfaisants
t’as une idée de ce qui ne va pas?

Dom : ça peut venir d’une intention trop importante, un vouloir guérir trop impliqué.
Relâcher, faire la pratique et laisser le Reiki et les symboles faire la guérison.

A : ça c’est fort possible! D’autant que j’ai fait les soins à des personnes proches (la fille de C, ma fille…)
j’essaye de rester présente à mes sensations et à la personne à qui j’envoie le soin. je me rappelle que tu as dit que ce n’était pas nécessaire mais j’ai l’impression que je suis encore trop débutante pour y arriver. Idem pour l’auto-traitement.

Dom : Trop débutante dis-tu !!?!! je pense alors que ça peut être….. le rituel de préparation, incomplet ou fait trop mécaniquement, trop technique quoi ! (révise pour voir…la copie du stage sur le rituel R 2…)

A : incomplet non, je fais le rituel avec la feuille sous les yeux. mais peut-être mal fait. je le connais presque par cœur mais parfois j’ai un trou de mémoire. (faudrait vraiment que le reiki me donne un coup de main pour ma mémoire) c’est vrai que quand je jette un coup d’oeil sur la feuille ça coupe un peu le fil du rituel…
Dom : avec les proches, il convient de se détacher de l’affect, c’est primordial ; s’ils guérissent c’est bien, s’ils ne guérissent pas c’est bien aussi : c’est leur histoire….pas la notre. Leur karma est personnel, secret, intime. On met l’amour dans nos intentions de praticiens Reiki, mais aucune attente, on laisse faire le Reiki entre les personnes et le Reiki.

Le symbole HSZSN, lui seul suffit à te connecter au Reiki, il annule la distance et « il envoie lui même » le Reiki….toi tu es l’instrument dans lequel coule l’énergie, tu n’es pas l’énergie, donc ; tu ne fais rien. Ce qui signifie :
> Tu ouvre le canal ; 1 avec le symbole, 2 avec la prière « je prends la décision d’ouvrir le canal Divin….je pose mes mains en toute confiance… », tu chante si le cœur t’en dit, et le Reiki fait le reste.


Vos retours de Stages !


Merci Dom pour cette belle élévation à la maîtrise ! Merci pour la qualité de ton enseignement et de ton relationnel. Ce stage fait désormais partie des moments marquants de ma vie. Je sens que ma pratique du Reiki va se modifier profondément. J’ai pris conscience aujourd’hui d’une « sphère » de chaleur permanente et intense dans la paume des mains. J’adore ces manifestations sensibles !

Je vais m’inscrire à ta newsletter et initier mes cristaux ensuite !

Bonne soirée et à bientôt, JL.


Bonjour Dom, Je viens de prendre connaissance de ton mail, et viens d’imprimer, tes documents, c’est précieux. Je te remercie encore pour ce très beau week-end qui restera gravé, tout au long, de ma vie, dans la pratique du REIKI 4 !
Tu es un sage, un être de lumière, j’ai beaucoup aimé faire ce stage de Maîtrise avec toi.
Je remercie l’énergie Reiki, et par ma foi le Seigneur, de me trouver sur ton chemin.
J’ai aimé le groupe, l’ambiance, la synergie, et le lieu.


J’ai encore la tête à Cabrières et le coeur dans DKM Tibétain…

Un petit miracle de douceur, de paix et de lumière….

Merci encore pour ta patience…. de maître.


Merci pour les coordonnées du groupe! 😉

J’en profite pour te remercier encore une fois de cette belle initiation, j’avoue que ça brasse pas mal de choses encore une fois surtout sur un niveau émotionnel, je pense que sksk que je n’avais pas reçu et que tu m’as transmis y est pour beaucoup! 😉 même si ça fait mal, c’est libérateur, alors j’accueille !
Je calerai ma prochaine venue à Montpellier pour participer à une soirée d’échange, se sera un grand plaisir d’y participer 😉
Alors merci merci merci!!!!! Très belle journée ensoleillée, À bientôt, P.


Depuis  mon initiation a la maîtrise reiki Usui Tbet, je suis envahie d’une sérénité et d’une paix incroyable. Au bout de quatre jours d »auto-traitement , pour la première fois….. j’aime et  je deal avec mes entités….le tout géré et canalisé par moi…….  Merci DOM…..merveilleux  weekend-
Encore merci pour cet apprentissage de la technique du pardon.  Je la pratique de temps en temps et commence à ressentir cette paix intérieure mais je sais que la route est encore longue.


Bonjour Dom! Tout d’abord à nouveau un grand merci pour ces deux jours formidables et cette fabuleuse transmission! Quel beau moment! Je suis très heureuse que le Reiki t’ai placé sur mon chemin!
Mes anges m’avaient envoyé le message suivant: « nous vous enverrons de l’aide sur Terre sous formes de maîtres et lectures afin que vous puissiez développer vos dons… »
Je les en remercie: te voilà;-)
La route n’est pas finie…j’ai encore du boulot… Et j’espère que tu accepteras de m’accompagner dans mon apprentissage!
…et pour finir, merci pour les contacts;-) A très bientôt!


merci à toi pour ton e.mail,et un grand merci à tous ,pour ce que chacun à apporté au groupe lors de ces deux journées du stage, joie d’echange et de partage d’emotion et d’énergie du Cœur ! …..J’ai moi aussi commence à pratiquer et j’ai eut la chance d’avoir vécu coup sur coup ,dans les 2 jours qui ont suivis, plusieurs experiences  formidables,que l’on pourras echanger j’espere sur Skype ou lors de nos prochaines rencontres à la planete reiki,!!!
…..ces experiences don’t je vous parle, m’ont amenées à m’inscrire des à present au stage reiki 2 des 14 et 15 juin prochain.
….comme ont c’etait promis de s’en tenir informés, çà c ‘est fait.
…au plaisir de vous revoir les uns et les autres ,soit sur Skype ,soit ailleurs….à la planéte reiki ,par exemple,lol
Nous avons la chance d’avoir un Maitre  du Coeur en la personne de Dom, et çà c’est une Bénédiction!!!.(.merci Dom pour l’ecoute, ton enseignement et ton Coeur)
bonne soirée et bon w.end à tous!…..


il est tard , mais je viens de vivre des instants emotionnels tres forts en l’espace d’une heure!!..houa!!…..merci pour la force et la foi avec laquelle tu nous a souligné l’importance du : ICI ET MAINTENANT, l’instant present, ……et de l’ Amour avec un grand A ,don’t tu as commence à nous imprégner!…..voilà, çà c’ est dis.
Pour les emotions, je te les expliquerais de vive voix, ce seras plus facile que sur l, ordi.
A TRES BIENTOT……………merci…pour ton accueil chaleureux,et ta disponibilités envers chacun d’entre nous.






Mars 14. Abricotiers en fleur !
La bête du printemps !

Les Crampes

– Je dois faire une séance de Reiki à une personne qui souffre de crampes à la main. Peux-tu me dire comment je dois m’y prendre ? Mrrci.
Dom – fais un scanner approfondi, en toute conscience, très important, puis : prise cosmique 15 mn puis traitement local sur la main 15 mn….puis 5mn à la tête, idem au cœur, sur le sacrum et fini par le chakra racine….et CKR sous les pieds.
– Avant le soin, discuter avec elle pour qu’elle « ex-prime » ce à quoi elle se cramponne, s’agrippe…qu’est qui est important pour elle et qu’elle ne veut pas lâcher ?…crampe = se cramponner à, s’agripper à….
main = manipuler, les objets et les situations…
Avec Shk (entre elle et toi ) faire en sorte de l’écouter, éviter de proposer des solutions toutes faites….mieux vaut la questionner et re-questionner. Propose lui, après le soin, le lendemain par exple, un « traitement M ». /établir une phrase affirmative positive de ce qu’elle veut à la place de « se cramponner, s’agripper à .. » / et compléter avec un Reiki à distance avec la même formulation positive.

La soirée Karuna…un mot pour vous de notre chanteuse bien aimée…

Merci à toute cette bienveillance hier soir

je suis sur le départ pour jouer… le grain de la voix sera là mais je suis tranquille, accompagnée

biz fabiola
ps: je n’ai pas les mails des participants d’hier soir

Les grandes questions sur les doutes de soi face au Reiki.

– Les bienfaits du Reiki, depuis mon initiation je suis plus en paix avec moi même beaucoup plus sereine, le seul hic est que je doute toujours de moi, j attends toujours quelque chose de concret que mes mains chauffent ou fourmillent etc. Parfois, je me demande si je suis vraiment canal ? Comment le savoir ?  


–  c’est une vue d’esprit que je vous invite à changer ; n’attendez rien, acceptez l’énergie telle qu’elle s’offre à vous pour le moment, ne rien sentir c’est une façon de sentir, avec le reiki il faut poser les mains et laisser faire, ne rien attendre…visualisez de belles lumières entrer dans vos organes, dans vos os, irriguer le sang, voyez vous rayonner de lumière, entourée d’anges….une h de reiki ; une h de bonheur et de rêve.

Reiki à distance pour soi

– Sur un polycop du cours du 2ème degré, tu dis que pr activer un symbole en particulier il faut LE tracer ds les mains etc etc. On ne trace pas CKR ? Je croyais qu’un symbole était activé que conjointement à CKR ?

– chaque symbole est indépendant, on les active en les traçant dans l’espace. P
our augmenter le contact avec son énergie lorsque l’on désire faire un travail en pleine conscience active avec un symbole en particulier ; on le trace dans les mains/l’aura/l’espace.
ckr n’active pas les autres symboles, il active son énergie à lui.

 à distance pour soi 

– Tu peux me résumer qd on brule le papier (ou la photo) ? Tu dis par ex de le bruler après que le rv soit passé (N.M le fait tt de suite après l’envoi). Bref, je me mélange les pédales.

 – de suite après l’envoie pour un envoie  sans quartz.

– après le rdv si envoie avec quartz  pour un rdv, de même pour la journée, ou pour plus longtemps.

 à distance pour soi 

–  Qd tu dis “charger un cristal 15mn”. C’est à faire avant de l’utiliser avec le papier ou en fait c’est lorsqu’on envoie le soin pdt 10/15 mn qu’il se charge ?

– on charge le papier et le cristal ensemble 5 à 15 mn, et après on les laisse ensemble, à l’abri des indiscrets.

 à distance pour soi  

– Est ce que je peux charger plusieurs cristaux pour moi même ou pour autrui : par ex, j’en ai chargé un pr travailler sur les 9 mois avt ma conception (je continuerai avec le m^me crisal pour “les 9 mois de la période utérine “ etc) et un autre pour ma dépendance à la cigarette. C’est ok ? je peux même en charger d’autres pr d’autres prbs ?

–  autant que tu veux !!! pour toi et pour les autres.

Initiations à distance…

– Une personne sur un forum me propose de m’initier gratuitement au niveau 3 (branche traditionnelle où le 3 et le 4 sont fusionnés), mais bon je te fais plus confiance pour la transmission de l’énergie des symboles.

– Les initiations à distance ça ne fonctionne pas du tout. Un autre cas ; les gens qui font ça gratuitement ne s’engagent en rien, ils ne prennent aucun risque ni aucune responsabilité, n’assument aucun suivi en cas de « remue méninges ». En général ce sont peut être des personnes qui ont très peu travaillé sur eux en profondeur les énergies du Reiki 4, déjà ils ne respectent pas l’éthique qui est enseignée lors de la maîtrise. Je le sais car je ré-initie des personnes initiées « gratuitement »….d’autres personnes passent un degré Reiki et se font eux même la maîtrise avec un livre, ça ne fonctionne que dans l’illusion, et idem ; pas de suivi en cas de remontée d’émotion ou de décollage.

énergie ; trop plein ou jamais assez !!??!!

– j’aimerai pouvoir avoir à ma disposition toute l’énergie du Reiki. Est ce que tu proposes juste les initiations des symboles 3 et 4 mais pas les cours ?

– ça ne sert à rien de recevoir des initiations aux symboles et ne pas savoir s’en servir ! et c’est très dommage.
Par contre je fais le Niveau 4 sans la partie « enseignant », ça se fait en une journée, et les symboles sont puissants, car dans cette journée je transmets toutes les façons de les utiliser ; la façon traditionnelle, et celles de mon vécu.

– Je voudrais juste faire mes Auto-Traitements ou des soins avec la totalité de l’énergie. Etre maître ne m’intéresse pas du tout, le reiki est plus pour moi un outil pour mon chemin spirituel (et les soins à autrui en font partie).

– tu viens d’être initiée avec leniveau reiki 2, c’est une très belle énergie, et de nombreuses techniques éprouvées et appréciées dans le monde….faudrait peut être déjà faire avec ce qui est à faire….
Le Reiki n’est pas un enseignement du livre….mais du vivre !
Pour augmenter ton énergie Reiki, va souvent dans la nature, marcher, t’asseoir par terre, te connecter à la source et prier doucement, communier, et faire du Reiki pendant ce temps, dans les bois, au bord de l’eau, sur le sable face à la mer…prends des bains de pleine lune, ça active l’énergie de vie du 2ème chakra…Et si tu peux venir aux ateliers chakras tu bénéficieras aussi d’outils très complémentaires au Reiki. Et, à ne pas manquer ; l’atelier du pardon.




Février 2014 ; premières fleurs d’Amandiers !

émerveillement du retour du printemps

émerveillement du retour du printemps

T : j’espère que tu as passée une belle journée sous cette bénédiction du ciel et ces nuages duveteux qui nous cochonnent telle une douce couette pour nous protéger du froid !!!!!!!! (hihihi le bon côté des nuages, c’est qu’on a des températures douces ! ).
Je voulais partager le fait que ce soir j’ai fait une séance de rééquilibrage de chakra dans le bain ! c’est top ! L’eau devient une grosse bulle enveloppante de Reiki !
Et puis aussi Seb s’en est fait une ce matin dans le train. Nous avons passé un super week end, et sommes très content d’avoir reçu ton enseignement !
Je voulais te demander aussi si tu peux me rappeler comment on fait un nettoyage de pierre avec  le reiki ? je te remercie.

Dom : Continuez de coincer la bulle Reiki ! C’est trop beau, merci du partage.
Pour nettoyer une pierre avec le reiki 1er degré ; on trace le symbole dans les mains/l’aura/l’espace devant soi (au centre de la pièce par exple) puis on place la pierre dans la main non dominante, on trace le symbole au dessus et on « l’enfonce » dans la pierre en prononçant 3 fois le nom du symbole avec cette pleine conscience que l’énergie du ciel et de la terre purifient la pierre.
On peut faire ça avec n’importe quel objet. Au 2ème degré on rajoutera le symbole Mental-Émotionnel, plus la TJR Jaki Kiri Joka-ho : tenir la pierre dans la main non dominante et se centrer sur Swadhisthana chakra/ grande inspir/ passer 2 fois au dessus de la pierre avec la main dominante et s’arrêter dessus au 3ème passage. Ce geste s’accompagne du souffle continu. Suivez ce lien pour avoir une idée…mais je préfère pratiquer en un seul souffle continu.

Le symbole du coeur du 2ème degré, SKSK, qui était nouveau pour moi , m’a surpris ; un effet bœuf !  plutôt comme une bulle de savon au niveau du cœur blup ! ; en application personnel bien sûr. Bien  très bien.

S –  J’ai besoin de toute ta sagesse. Depuis la formation Reiki 1 du 10 novembre, je me sers du Reiki pour soigner ma vésicule qui dysfonctionne. Ça marche forcément car je sens que ça bouge pas mal. Mais ces derniers jours, elle est devenue très susceptible, voire douloureuse. En fait, elle préfèrerait que je ne mange pas du tout, ce qui est incompatible avec ma survie quotidienne ! Tous les soirs, en voiture aussi ! et le matin je lui fais CKR + position des mains. Je suis persuadée que ça l’aide. Mais hier j’ai préféré consulter mon toubib, qui m’a prescrit Radis noir et artichaut en homéopathie + une échographie. D’après lui on se dirige droit vers l’ablation compte tenu des résultats de l’auscultation. Et moi je ne suis pas d’accord. Je l’ai dit au Reiki, mais je crois que je ça ne suffit pas! Peux-tu me faire part de ton avis ? Dans l’attente de ta sagesse, Belle après-m, S.

– Dom : bonjour S. la vésicule est liée à de la colère, de la rancœur ou/et de l’inquiétude…
il serait peut être bon de consulter une hypnothérapeute pour connaitre l’origine de l’émotion.
Je te conseille d’écrire tout ce qui t’as fait vivre de la colère ou/et de la rancœur, ainsi que tout ce qui t’inquiète. Tout en continuant ton auto-traitement reiki et les soins en « traitement local »et de manger selon les recommandations du médecin. je reste à ton écoute. Amicalement. Dom

S  Merci. Je pars en vacances de noël dans ma famille, rassurée, ça a beaucoup bougé en moi, je te recontacte en janvier.

Un peu plus tard…. 

S : Je t’avais contacté avant Noël car j’avais quelques soucis au niveau de la digestion (vésicule). Je pense en fait que j’ai vécu les fameux symptômes de guérison. Dans la nuit du 23 j’ai eu un malaise vagal et depuis tout va bcp mieux, comme si mon corps avait fait un « reset ». C’est un peu étrange, depuis je suis devenue plus sensible, malgré moi, à ce que mon « corps » me dit au sujet de ce que je mange, c’est une expérience intéressante. Merci Dom.

Suite à un décés et la difficulté qui s’en suit…

Dom :Pour supporter le deuil un peu mieux, tu as le droit de décider que la mort n’est pas une disparition mais une transformation. Ta mère se trouve là ou elle doit se trouver, rappelle toi qu’avant tout nous sommes esprit et que le corps nous est confié pour une expérience limitée. En tant que tel, ta mère est en lien avec toi, rien n’est changé, sauf sa forme. Parle lui, d’esprit à esprit.

Prière à écrire sur le papier puis charge le quartz 15mn tous les 4 jrs pendant 21 jrs : « Avec amour je me libère du schéma de pensée qui avait créé cette situation. Mon état émotionnel s’apaise de jour en jour de la manière la plus positive et de la manière la plus Divine. Merci »

Pose toi et ressent en toi ; OU est ce que ça te touche ?

à quel niveau ?

au niveau de quel chakra ?

cela te rappelle t il quelque chose déjà arrivé ?

Souvent ?

dans l’enfance peut être ?

dans le même temps, met tout dans le coeur (avec SKSK pour y aider) et pardonne lui d’être partie, pardonne tout, sans cesse…et pardonne toi à toi de subir ce deuil.

Un Rêve….

V : Slt dom, J’aimerais te faire part d’un rêve et le donner ton avis si possible.
C’ est assez strange comme beaucoup de mes rêves. Ça se passe à mon boulot avec pour commencer un collègue que je croise et qui me parle d’un bruit qu il ya dans une pièce .il me dis c’est….. (Je ne me souviens plus du mot exact) je lui réponds que ça vient du masque de fer.de là, je continue mon chemin et passe devant un résident mort et en fait dans la salle il y avait d’autres patients  .. ..ils étaient tous de cire même le mort.et là flippe jr me réveille.
Qu’en penses tu. Je suis allée consulter le dico des symboles mais difficile…

masque-de-ferDom : à priori cela me semble assez Facile à interpréter…
masque de fer = emprisonné pour qu’il ne prenne pas sa place, se taise et ne soit pas reconnu !

ton yang ; l’action, l’agir….un peu dans la cire, figé comme mort…se tait, ne donne pas , n’affirme pas son avis…ne prend pas sa place…

cire à faire fondre doucement mais surement….

Quelques lignes pour te tenir au courant des résultats de mon apprentissage reiki auprès de toi. Dans l’ensemble, je continue d’aller mieux.

Avec les auto-traitements de Reïki, cela va bien. Si je n’ai pas le temps de faire le matin, je ne me sens pas si bien que les autres jours. Mes énergies continuent de
bien re-circuler, je me recharge bien et il me semble que je ressens beaucoup moins les peurs qui paralysaient ma vie, je reprends goût aux choses simples et je reprends
soin de moi, sans aucune culpabilité, juste pour moi et mes relations avec les autres s’améliorent. J’ai repris doucement mes petits travaux ésotériques tranquillement.

Avec les cristaux, j’ai des résultats au delà de mes espérances. Mon cristal de réparation du mental refusionne mon mental et mon émotionnel si bien que je ne sais pas depuis combien de temps, mais ça a été très rapide, aussi, je ne pense même plus comme avant et le mot parasite « c…e » a quitté mon esprit. Le cristal est toujours en charge et il m’aide beaucoup pour l’estime de moi-même que je semble retrouver et mon manque de mémoire ne me préoccupe plus autant, d’ailleurs, j’ai gardé mes habitudes
de travail avec mes notes et ma mémoire photographique et mémoire de ma main, et avec le symbole SHK à la fin de ce qui est important, ça va bien et j’ai même des facilités…
Aussi, lorsque je charge un cristal, je le prends et avec la pointe comme si c’était un crayon, il enregistre sa mission et cela imprime ma mémoire aussi et me permet d’avoir
un lien intime avec celui-ci.
J’ai maintenant 6 cristaux pour moi dont celui de réparation de vie longue durée qui m’aide beaucoup, car mes chagrins et mes peurs semblent s’estomper tout doucement.
Aussi, j’essaie de prendre soin de mes cristaux autant qu’ils le font pour moi …mais je ne pensais pas avoir un jour une relation comme ça avec des minéraux …
Je les recharge maintenant tous ensemble, mais comme la charge énergétique est répartie sur tous, ils ne tiennent plus 3 jours, je les recharge tous les jours si je peux sinon le plus rapidement possible, car ils ne tiennent pas 48H00 et je suis obligée de tout recommencer.
Avec l’atelier chakra racine, ça va bien. J’ai un peu tardé à faire les exercices énergétiques que tu y enseigne, mais je m’y suis mise. Cela m’intéresse beaucoup et je peux aussi commencer de lire certains livres que j’avais et qui me paraissaient compliqués. Les exercices énergétiques complètent bien le Reïki, même si je ne les fais sûrement pas toujours comme il faut. Pour l’exercice de l’arbre qui s’enracine dans le rouge, j’ai un problème énorme avec cette couleur, d’ailleurs m’est revenu tous les détails d’un traumatisme épouvantable de mon enfance (mais je n’ai pas ressenti trop de gêne émotionnelle, un peu comme si je n’étais que spectatrice, ce qui m’a permis de remettre le film et les détails convenablement c’est le Reïki qui m’aide, alors, j’ai fini par changer la couleur qui est devenue rouge/orangé avec du jaune comme la lave des volcans ! Aussi, mes pieds sont moins froids et moins souvent.

Bonjour DOM, Je remercie le jour où j’ai pris la décision de découvrir le Reiki qui m’a permis de te rencontrer. Je te remercie pour ton initiation au premier et second degré et pense continuer plus loin mais plus tard. Je me laisse le temps d’avoir l’esprit plus serein, ce qui est compliqué depuis plusieurs mois, pour être prête. Je te remercie de m’avoir permis de participer à des moments d’échange, de partage avec toutes les belles personnes des stages et soirées. Je te remercie pour ton enseignement et tes messages qui m’ont permis de passer des épreuves et d’apporter aussi le réconfort auprès d’autres personnes. Je te souhaite une belle année 2014, une excellente santé, beaucoup d’amour et de partage, de beaux moments de vie. A une prochaine rencontre DOM. Bise. N.

A.B : Cher/e/s ami/e/s, Je vous souhaite une belle année 2014 pleine de santé et de bonheur… et de magnifiques expériences reiki en espérant que vous êtes tou/te/s en bonne forme.

Dom : bonjour Annie, je te souhaite à toi et ton Amie Yudit, le meilleur pour 14. Comme pour toutes choses, la vie nous montre qu’en insistant, en persistant, on obtient des résultats. Le miracle c’est ça ; agir. Et le reiki est un miracle dans ce sens, qu’il nous permet d’agir, pour créer nous même des miracles. je pense ce matin après lecture de ton mail, qu’une initiation devrait encore améliorer sa santé. En effet, lorsqu’on est initié, et qu’on pratique un peu régulièrement, et que quelqu’un nous fait du reiki cette énergie est plus forte. La preuve est montrée lors des soirées partage…En comptant aussi sur l’effet des 4 initiations. Si cela posait un problème, je peux lui faire les 4 initiations sans faire « un stage ». Juste l’énergie des initiations. Puisque sur ton mail tu nous souhaite de belles expériences reiki, je suis prêt à tenter celle ci ! Ces initiations seraient particulières, si Yudit est d’accord je pourrais mettre les faire un vendredi avant, pendant, et après la soirée partage.

…et Yudit fut d’accord, je l’ai initiée au canal Reiki, en privé, 4 fois dans la journée conformément au protocole Usui, sans lui donner aucune informations autre que si elle le voulait elle pourrait poser les mains sur elle et sur son entourage, rien d’autre ( si l’on peut appeler ça rien…!)
voici le retour que j’ai reçu par texto : « Bonjour Dom, juste pour t’annoncer la MERVEILLEUSE nouvelle que ce matin Yudit s’est réveillée avec beaucoup moins de douleurs pour la 1ère fois depuis 2006 !
Merci ! Je n’oublie pas le Reiki et tous les amis qui ont œuvré dans le silence. Je vous embrasse. Annie. B

-Dom…voilà ; Planète Reiki, l’énergie du coeur.

Merci pour ce week end
Merci de nous faire grandir
Merci de nous aider
Merci d être la pour nous
Merci pour la lumière
Merci pour l énergie
Merci pour l amour

Merci du fond du cœur

Décembre 2013

– L : Juste 2 questions : Concernant l’Auto Traitement, moi qui ressentais bcp de chaleur dans le corps de suite après le stage, je ne ressens plus rien. Sauf une légère chaleur sur plexus, sacré et pubis et le chakra racine. Cela veut il dire que mon corps s’équilibre en énergie ?

2ème question : 21 jours d’Auto Traitement qui je l’avoue sont ennuyeux à faire bien que j’en profite pour méditer en me concentrant sur mes mains ou ma respiration.  Mais ensuite ? Comme je ne fais pas de soins sur autrui, il faudrait que je continue les AT ou juste quand j’ai un problème de santé, d’énergie etc ?? Merci et à bientôt (Je vais apprendre à tracer les symboles du 2ème niveau avant de venir pour ne pas galérer comme au 1er degré. L

– Dom : bonjour L. l’AT des 21 jours sert à purifier le corps. Et aussi, à prendre l’habitude de pratiquer au quotidien. Le fait de ne plus ressentir ou peu, l’énergie Reiki, peut venir d’avoir pratiqué 21 jrs « parce qu’il fallait » et non par plaisir. Ce qui peut expliquer que tu trouve ennuyeux. Maintenant le traitement au quotidien va entrer dans les couches profondes de la psyché et de l’émotionnel pour les préparer au 2ème degré.
Je crois que tu dois trouver en toi le plaisir de pratiquer, en ressentant ou pas. Le plaisir de donner de l’amour à ton corps, le plaisir du bien être, musique, encens, bougies, calme, huiles essentielles….beauté…cherche de ce coté là.
Je ne suis pas sur que tu es la dernière version du symbole de distance, étant donné que tu es inscrite pour le 2, la voici en pj, exceptionnellement. 

– L : Euh…., en fait je n’ai pas fait les 21 jours…. Inconsciemment j’ai l’impression que je refuse de faire ce qui me fait du bien. Mais je m’y suis remise depuis 3 jours consciencieusement (et avec plaisir) pour être prête pour le 2ème degré.  Merci pour le symbole. J’avais vu le même sur le livre de J.V sauf pour les 2 derniers ptts traits qui ne touchent pas celui du bas. Par contre j’aime bien ton exemple, car il trace le symbole en plusieurs parties et c’est plus facile à mémoriser. enfin c’est vite dit étant donné la complexité du symbole.

– Dom : Evidemment sur un livre les symboles ne peuvent pas être « réactualisés » ! D’où l’intérêt de venir en stage pour être sure d’avoir la bonne calligraphie…et le bon enseignement sur les façons infinies de les utiliser.


– V : j’ai une question a te poser : t’es-t-il déjà arrivé qu’une personne te demande de ne plus travailler à distance ou travailler tout court sur elle car Reiki la perturbe ?! C’est mon cas par rapport à mon compagnon… Je reçois inconditionnellement la réponse de l’univers mais me sens néanmoins « mal » dans mon être intérieur. Je reçois ceci comme une épreuve qu’il m’est demandé d’accepter et de gérer. J’aurai besoin s’il te plait de ton avis !

– D : ce qui serait correct de sa part serait de m’en faire part, de ce qu’il ressent à ce sujet, étant son maître enseignant ça me concerne…qu’il aille au mieux. Et je garde le secret professionnel bien entendu. Tu n’en saurais rien, ça resterait entre lui et moi, normal.
Ensuite il peut arriver qu’entre pratiquants en couple l’un d’eux ressente un besoin de coupure ou un trop plein de fusion et croit qu’il faut arrêter les échanges de soins. Je pense plutôt qu’il y a un manque de savoir poser les mots justes, suite à une difficulté voire impossibilité à identifier l’origine du ressenti dit « désagréable ». Cette origine étant certainement d’ordre émotionnelle, affective, un « quelque chose « qui remonte du fond de soi, du passé » sans doute, et notre culture prouve encore une fois notre INCULTURE émotionnelle.
De toutes façon l’occasion pour ton compagnon de pratiquer sur lui jusqu’à éclaircissement.

Un grand merci pour tes conseils avisés. J’ai transmis à R. En travaillant avec C K S j’ai su trouver les mots hier afin de ne pas rentrer dans sa colère et merci au Reiki pour tous les degrés de conscience que nous cheminons, enfin dans la sérénité.


Questions ; ressentis :

-V : Dans d’autres cours, sur des livres Reiki, ils parlent de lisser l’aura en premier sur une personne, alors qu’en stage tu nous apprends à lisser l’aura en dernier, après un soin.

– Dom : a mon humble avis, lisser l’aura avant de faire un soin à une personne, ça ne présente aucun intérêt puisqu’on va plonger les mains dans son aura, les ressortir et recommencer durant une heure ou plus.

– V : Par contre ils ne parlent pas de “scanner” l’aura pour déceler les “trous”, mais je trouve cela très bien.

– Dom : Le scanner (Biosen pour ceux qui aiment bien « parler » Japonais ; se traduit par « scaner intuitif » en Français)se fait, lui, en début de soin,et cet acte énergétique, aussi subtil soit il, guéri l’aura, donc guéri le corps ; voilà un intérêt. On le constate en stage lors de l’atelier « Scanner » quand des personnes travaillant ensemble le Scanner intuitif, ressentent le passage de l’énergie et ses effets, des guérisons spontanées parfois.

– B : une question ; lors du rééquilibrage des chakras, c’est bien de dessiner CKR sur chaque chakra ? A l’endroit ou à l’envers puisque c’est sur nous donc sur l’aura ?

– Dom : TON DOIGT le dessine sur toi….tu pars EN HAUT, de ta droite, au centre tu descends, en bas tu vas vers ta gauche pour la spirale. En petit sur chaque chakra, en partant du Racine.

– T : Quand j’harmonise mes chakras, je ne ressens rien au niveau du chakra racine alors que c’est celui là chez moi qui a besoin de s’ouvrir…”normal” ?

– Dom : tu ressentira dans certaines situations, sois sans attente et nourri le généreusement, mais sans oublier les autres puisque les chakras sont tous en relation permanente.

– Il faut mettre la main devant au niveau du périnée ou derrière au niveau du coccyx ?

– D : devant, en direction du coccyx, ou sur le coccyx (selon la posture que tu prends)

–  si cela chauffe sur un chakra, il faut attendre jusqu’à ce que l’autre chakra chauffe de la même façon pour les harmoniser ?

– D : ça n’est pas obligé, ça pourrait durer longtemps, mais ça n’est pas interdit non plus. Le mieux est d’être intuitif mais à savoir que pour qu’un équilibrage soit remarquable, il convient dans tous les cas de donner la même durée de Reiki à tous les chakras, sauf au n°4, autant qu’on veut.

– Je ne ressens rien sur les positions de la tête, par contre beaucoup de chaleur à partir du thymus, cœur etc. Normal ?

– D : oui, c’est assez exceptionnel de ressentir l’énergie au niveau de la tête au début de la pratique Reiki. Les ressentis de l’énergie augmentent au fur et à mesure de l’ouverture du 3ème œil, c’est-à-dire au fur et à mesure que notre vision du monde et de nous même devient plus réelle et objective. A ce moment là les perceptions extra sensorielles ( au-delà des 5 sens) deviennent impressionnantes, lumineuses, délicieuses. C’est une des récompenses de l’assiduité à la pratique.

– Problème de dépendance au tabac. Je voudrais savoir si avec le niveau 1 Usui je peux faire qqchose. Je pense que c’est plutôt avec le niveau 2, mais on ne sait jamais.

– Dom : au niveau 1 tu y gagnera en travaillant matin et soir les idéaux de Reiki, ils apportent le calme et la clarté d’esprit. Tu pourrais déjà accepter que ça soit dur, difficile d’accepter de fumer. Au 2ème degré on apprend une technique pour se libérer des addictions, et je la fais réaliser en atelier lors du stage.

– tu me connais, le lâcher prise n’est pas encore pour moi.

– D : travaille les 5 idéaux du Reiki et sois sans attente….ça aide au détachement.

Vésicule biliaire

 – S : J’ai besoin de toute ta sagesse. Depuis la formation du 10 novembre, je me sers du Reiki pour soigner ma vésicule qui dysfonctionne. Ça marche forcément car je sens que ça bouge pas mal. Mais ces derniers jours, elle est devenue très susceptible, voire douloureuse. En fait, elle préfèrerait que je ne mange pas du tout, ce qui est incompatible avec ma survie quotidienne ! Tous les soirs, en voiture et le matin je lui fait CKR + position des mains. Je suis persuadée que ça l’aide. Mais hier j’ai préféré consulter mon toubib, qui m’a prescrit Radis noir et artichaut en homéopathie + une échographie. D’après lui on se dirige droit vers l’ablation compte tenu des résultats de l’auscultation. Et moi je ne suis pas d’accord. Je l’ai dit au Reiki, mais je crois que je ça ne suffit pas !

Que puis-je faire d’autre? Peux-tu me faire un soin ? Dans l’attente de ta sagesse, Belle après-m, S.

– Dom : la vésicule est liée à de la colère, de la rancœur ou de l’inquiétude…il serait bon de consulter une hypno thérapeute pour connaitre l’origine de l’émotion.

 je peux te faire un soin spécifique, oui, j’ai guéri une fois un cas identique, un ramoneur en colère qui souffrait de la vésicule, mais il faudra y mettre le paquet en reiki qu’on te donnera, en plus de tes propres auto-soins.

Je te conseille d’écrire tout ce qui t’as fait vivre de la colère ou/et de la rancœur, ainsi que tout ce qui t’inquiète, tout en continuant ton reiki et de manger selon les recommandations du médecin. je reste à ton écoute.

– S : Merci Dom. Je pars en vacances de noël dans ma famille, rassurée, ça a beaucoup bougé en moi, je te recontacte en janvier.


Novembre 2013

Reiki 3…le guide…

Coucou Dom
J’étais en vacances la semaine dernière bien occupée et cela m’a permis de prendre du recul et de lâcher prise par rapport a mes soucis familiaux tout en continuant a pratiquer
Et tout s’est éclairé le poids s’est envolé les paroles justes ont pu être dites avec le COEUR.
Je ressens un grand soulagement et remercie 1000 fois le reiki,
Merci a toi aussi pour ton aide qui m’est très précieuse.
Ce qui est formidable c’est de savoir que je ne suis pas seule et que dans les moments de brouillard il y a toujours la lumière qui m’ attends et me fait signe. Mon guide me l’a dit et je lui fait totalement CONFIANCE.

Au creux de la gorge, la paresse spirituelle.


I – en parlant de Reiki, j’ai des doutes  en ce moment……tu vas m’étrangler mais j’ai l’impression que ça sert à rien…..pas de résultat….pourtant je pratique…..exple : la j’ai mal à la gorge, toux enfin un peu la crève quoi……et bien pourquoi ça ne passe pas avec le Reiki ? en plus cette mini crève me fatigue et bien même pas ça me donne la pêche…….rien…..en fait je ne vois pas de résultat qui me prouve que ça fonctionne et qu’on peut guérir ne serais-ce qu’un petit truc…….j’attends le miracle pour vraiment dire oui ça fonctionne……je sais par contre que quand on demande on obtient……n’est ce pas…..j’ai pas demandé le miracle de guérir quelqu’un je devrais peut-être…..depuis 9 mois je reikise une mamie – 90 ans – elle ne devrait plus avoir mal à son poignet…..et courir comme un lapin…..elle y met les moyens quand même pour aller mieux et j’ai pas l’impression d’être super compétente…..j’aurais aimé avoir de meilleurs résultats…voilà je me pose des questions sur l’utilité du Reiki…..je sais c’est dur…..surtout de dire ça à un maître Reiki ….surtout que je viens de passer avec toi mon 3ème degré. Je suis déçue…et ça m’énerve.

Dom – Je sais pas quoi dire, des fois ça arrive…..mais je pense qu’il faut lâcher prise…surtout au niveau de la gorge ;sa spécificité est de ne pas avoir d’attentes…. continuer, persister.  reiki et reiki, activer le symbole Cks et accepter ses messages avec Sksk.

I – Bien sûr je continu, parce que je suis têtue…..le problème c’est qu’il n’y en a plus de messages…..j’ai pas de réponses claires à une question…..rien, …pareil pour mon intuition….plus rien, le vide, le néant….
D – accepter de guérir c’est parfois aussi accepter de voir la cause, avec Shk demande au Reiki de te montrer la cause et accepter…avec Cks
I – il me fait la gueule je te dis il ne me répond plus…..
D – c’est peut être un moment de mise à l’épreuve par le vide du au passage du 3ème degré. Parfois l’intelligence universelle nous coupe les vivres non pas pour nous punir, mais pour nous Stopper. Arrêter et observer, voir, perce-voir, percer les ténèbres pour voir clair. Ces événements ne sont pas des catastrophes mais des bénédictions façon Univers ! pour nous faire grandir, ne plus rester en retrait de nous même.
Tousser c’est comme …..un besoin d’aboyer. Par la technique d’envoi à distance, fais comme tu as appris en stage ; il te faut trouver les mots justes pour dire ce qui ne peut pas se dire.

I – ouais après l’univers……je ne sais pas pourquoi je suis là et ni où je vais et ça m’énerve grandement………………..encore le néant……..

D – j’ai 2 questions pour toi. Combien de temps reste tu lorsque tu te fais un soin à ta gorge ? Il s’agit de traitement local, vu au 1er degré n’est ce pas, et il convient de rester 15 mn minimum, puis si possible faire le traitement complet et le faire chaque jours pareil pendant au moins 4 jours.

I – j’avoue que je ne fais pas comme ça, je fais à ma sauce, au ressenti…je reste 5, 6 mn sur ma gorge et je passe au cœur, pareil, et je mets mes mains ailleurs.

D – Donc ; active Cks une fois fait le rituel de préparation et reste 15 mn sur ta gorge.
Pendant ce temps répète la phrase affirmative positive appropriée, celle que j’enseigne au 1er degré avec l’auto rayonnement sur les chakras – il y a une phrase par chakra – tu peux réciter la phrase 3mn, faire 1 mn de silence, puis réciter la prière ésotérique du symbole une fois et recommencer le processus, en boucle pendant les 15 mn ou plus. Puis tu fais l’autotraitement complet. Ceci pendant 4 jours consécutif. Au moins.
Les antibios, c’est 3 fois par jours durant 8 jours, non ? Si on le fait « à sa sauce », ça marche… ?

Peu après….

I – ces derniers temps, j’y mettais un peu moins de conscience, c’est peut-être pour ça que j’ai eu ce petit passage avec bcp moins de sensations…..ça m’a servi de leçon….hier soir, j’ai eu un beau Reiki…..commencé par poser la planche multiple A. sur la poitrine (elle est touchée) et pendant ce temps 15mns Reiki sur la gorge avec ta phrase magique. J’ai ressentis toute la chaleur descendre le long des deux bras en passant par les omoplates (presque une sensation d’être initié), ça a duré un moment, très agréable, à ce point ça ne m’était jamais arrivé. Et après autotraitement entier en terminant par les pieds….. et j’ai passé une bonne nuit.

Fils de lumière.

E – Je suis tristounette ce soir. J’ai eu mon fils au tel et j’ai réussi à lui sortir les vers du nez. En ce moment il me dit tjs qu’il ne fait rien, je pensais qu’il disait cela parce qu’il n’avait pas envie de parler mais non il ne fait rien. Disons qu’il ne voit plus ses copains et qu’il ne sort plus. Il dit qu’il s’emmerde ….en fait je le sens seul et déprimé…..ça me fait souci, ce n’est pas son genre…….j’ai trop les boules en fait, dans ces moments j’aimerai être près de lui……je vais lui faire un envoi à distance. Tu peux m’aider à le formuler stp. Merci.

Dom – Lorsqu’un adolescent s’em…s’ennuie, tout comme un adulte d’ailleurs, il se peut qu’il y ai un manque en lui qui n’est pas formulé, pas exprimé. Si on lui demande « qu’est ce que tu as » il répondra « je sais pas ». Il y a des chances pour qu’on lui propose alors des phrases toutes faites genre « fais ceci, fais cela…ect. », des recettes pour combler le vide, un peu à la manière de la fumée ou de l’alcool ; combler le vide, le manque. Il conviendra de faire un petit effort ; se détacher de la volonté maternelle et considérer ton fils plutôt comme un fils de l’univers – abnégation du « Mon ».
Déformation du langage. «Le langage nous fait mal, et seul le langage peut nous nous en sauver ». Hervé Piekarsky. On ne nous pas apprit à dire ce « qu’on a » ou ce « qu’on n’a pas », on nous a appris à bosser pour produire. Hélas sans jamais demander si l’univers n’aurai pas une autre idée sur ce qu’on fait, ou sur ce qu’on fait faire, ou comment on doit le faire. La peur de l’inconnu, la peur du vide, possédés par « avoir ».
Mais si l’on continu à avoir peur de l’inconnu, alors on risque de faire du Reiki sans conviction. Les ados s’ennuient ? On leur donne un cadeau électronique, une fringue de marque pour plaire…une promesse illusoire.
Le Reiki est créé pour éveiller, pour sortir du conditionnement muet. Avec l’envoi à distance on va demander ce qu’on veut d’une façon affirmative et y croire ! Ensuite on lâche prise et on laisse faire l’Univers, un peu façon…« que sa volonté soit faite, moi j’ai fais ce que j’ai appris… ». De cette manière, ton fils recevra surement exactement ce qu’il a besoin. Au risque que ça soit une parole ou une action difficile à accepter pour un adulte –parents.
Je te suggère de procéder comme suit :

« Avec Amour……pour F…( + le nom de famille)
je demande la guérison totale, psychique, mentale et émotionnelle.
Sa relation avec la vie et les éléments, avec les êtres et les choses s’élève maintenant avec aisance et facilité.    La joie est en F…( + le nom) et autour de lui, une joie spirituellement non causale ; de la manière la plus positive et de la manière la plus divine. Merci « .
Lorsque tu as chargé le quartz avec les symboles et que tu as visualisé les symboles en lui :
tu le visualise joyeux en permanence et tu dis, à voix haute, claire, et calme :
« F..( + le nom)….est maintenant calme, détendu, serein et en paix. Le schéma de pensée qui avait créé cette situation, est maintenant totalement et définitivement dissout et est retourné à la substance universelle d’ou il l’avait tiré. »
Tu coupe en ouvrant les yeux et tu affirme : « Voilà ! Ce processus se réalise maintenant pour moi de la manière la plus positive, de manière Divine…et quelque chose de plus grand encore pour le bénéfice du tout ! Merci. »
Et tu termine comme d’habitude – Reiki 2 – ; tout remettre entre les mains de l’univers.

Si tu as un petit bout de quartz rose, place le dans les mains en même temps, ce merveilleux cristal amplifie les effets des phrases affirmatives.
Tu peux le laisser avec cristal après…c’est bon le cœur des F…

C’est la fête Reiki !

Nous avons reçu notre 1ère table de massage, c’est chouette!
J’ai des changements chaque jour de ma vie. Cela me rend vraiment HEUREUSE! Et tous les jours j’essaie de faire une technique différente. C’est très motivant car il y a un bon retour.

L’IPE du 3ème degré Usui

Ma 1ère expérience en soin IPE à domicile, 15 jours après avoir passé le Reiki 3. 

J’ai passé une excellente journée…..c’était divin.
J’avoue, c’est spécial comme technique….mais je leur ai expliqué grosso modo comment ça allait se passer et que ma respiration allait être bruyante, je les ai rassurées…… comme ça les personnes n’ont pas été surprises…..et donc tout c’est bien passé.
J’ai fait l’IPE sur ma cliente du jeudi. Au début je me suis dit « je suis mal barrée »….lol….il a fallu que je recadre en permanence parce qu’elle ne s’arrêtait plus de parler….le 2ème objet qu’elle voyait c’était le livre qu’elle avait lu le matin….j’ai failli connaître toute l’histoire….. ha ! je m’en souviendrais de ma 1ere IPE… par chance à la 2éme extraction tout est parti, elle voyait un vide et sa douleur du dos disparue !!! ….elle a été bluffée. Et après ; soin complet et méga hug à la fin (j’ai bien pensé à toi et à ce que tu dis sur le Hug qui ouvre le chakra du coeur), elle ne me lâchait plus….c’était super sympa. On n’a pas arrêté de se bizouiller et on se marrait comme des bossus….rire cosmique pour moi.

La dame du rdv d’après. J’ai commencé par l’IPE + soin complet, elle est stressée et elle mange tout le temps et elle veut stopper tout ça. Pour l’ipe ça a été magique, son objet un fauteuil en velours mauve de 45 kg……et qd j’ai fini le souffle et que je lui demande comment c’est maintenant…..elle me répond, il n’y a plus rien, c’est vide…..ça a été super rapide…j’étais même presque frustrée ; pas eu le temps de m’amuser beaucoup….
Je l’ai faite à nouveau cet apèm sur un jeune gars fatigué qui voulait un Reiki, je te laisse deviner..

J’ai dit à tout le monde que pour un résultat optimal et aller en profondeur,  le mieux c’était 4 soins consécutifs….ma  cliente du jeudi veut garder un par semaine, mais une qui fut bien convaincu ; la nouvelle dame qui a prit ses 4 rdv.

Voili voilou et maintenant je vais faire l’IPE sur le « mari »…..je suis au taquet….merci le Reiki 3 !

Sept. 2013

Beau retour de 2ème degré Usui.

I – Merci de faire une newsletter car ça m’aide dans mon cheminement, en fait ça nous aide tous.

Dom – C’est le but de mon travail, assurer un suivi. et partager la vie Reiki des praticiens. 
J’ai la tête trop pleine,

Faut la vider, méditer sur le vide, sur le rien, sur la paix, tu sais, en stage j’enseigne le travail avec les symboles, ok. Mais j’enseigne aussi les méditations, en silence avec les symboles, 20mn…

Première impression du deuxième degré : Je suis tombée amoureuse du Reiki, je l’ai dans la peau, je suis accro….même s’il met un grand chamboulement dans ma vie. La première semaine : J’ai eu régulièrement des nausées.

Plexus solaire !
Respirations, calmer le feu du centre solaire en faisant monter l’eau des reins, c’est-à-dire en accueillant les peurs (reins) au lieu de les combattre. 

Je n’ai pas été sur mon nuage, je n’ai pas plané non plus comme je l’avais fait au premier degré, dommage d’ailleurs car j’avais beaucoup aimé cette sensation. C’était complètement différent. J’étais là sans être là mais belle et bien les pieds sur terre. J’ai repensé x fois à la dernière initiation…..et oui forcément…donc j’avais souvent la larme à l’oeil, des fois un peu plus… J’étais calme, je pourrais dire à l’arrêt même. Certaines clientes m’ont dit que je n’étais pas comme d’habitude….ah bon !!! lol !!!

 Deuxième semaine : mal au plexus solaire accompagné d’un visage bouffi, boutonneux, génial !!! Plus une guerre dans mon couple (pas la guerre des boutons).

Réaction de feu ! boutons = minis volcans = feu de la puissance intérieure qui demande à s’exprimer ( ex = sortir  – primer/comprimée- sortir les non dits qui sont comprimés, compressés…) 

Autrement dit ; les non dits accumulés deviennent de la colère.

L’écriture peut libérer.
Consulter un psychothérapeute psychocorporel ou acupuncture…

Cette semaine : La troisième. Toujours mal au plexus, toujours boutonneuse, et en plus très souvent dans la journée, j’ai des picotements partout, ça passe d’une partie du corps à l’autre….et je me gratte comme une malade….j’ai bien regardé, je n’ai pas de morpions, ni de sansue, MDR. Le Reiki fait bouger des choses, j’en ai la preuve.

Démangeaisons = ça démange de, il me tarde que…agacements…

Encore le solaire ; Respirations conscientes, yoga, qi gong, sport qui ventile, footing et Reiki avec le cœur ! 

J’ai une grosse agitation. Je n’arrive pas à rester en place. Je passe d’une activité à une autre. C’est une horreur. J’ai la tête qui fume à donf. Je veux tellement profiter de la vie pour ne pas perdre une seconde………que je perds mes journées. C’est déprimant. Je pense gérer mais en fait je m’éparpille et je ne gère absolument rien.

Avec les idéaux de Mikao tu vas retrouver le bonheur de te poser de temps à autre, respirer, te poser dans tes racines pour DECIDER de faire une chose après l’autre…. 

Pour ma pratique, je m’éclate toujours autant. Depuis le premier degré, c’est tous les jours 45 mns sur bibi, par contre en ce moment je remets ma pyramide timer car je m’endors toujours, ça me permet de changer de position, et de me rendormir jusqu’à la sonnerie suivante, impressionnant d’ailleurs !!!

le fait de s’endormir beaucoup représente ce besoin de te poser, de calmer, de  t’accorder le droit au vide serein. 

J’allais oublier, ça tombe bien car ça me le fait, je ressens régulièrement un truc sur le dessus de la tête. Comment te le définir….. j’ai comme un air froid, un souffle subtil, comme si j’avais un trou dans la tête, la racine de mes cheveux qui bouge toute seule à un endroit bien précis. C’est quoi ça ?

Peut être le rapport avec le père qui est en train de se guérir (chakra coronal = père céleste/père-charnel/l’homme/le masculin et l’intuition qui se dégage)

Connecte toi avec Hszsn et demande le calme avec Shk, la paix, puis accueille dans le chakra du cœur avec Sksk tes intuitions.

Les cheveux = la force !

Elle vient de l’esprit, de la connaissance par soi même..

Plus l’esprit est calme, plus il est fort 

En sachant que j’ai aussi ce petit vent frais qui vient sur mon visage de temps en temps, j’ai vérifié s’il y avait des courant d’air, ben non pas de courant d’air, et après je suis envahie de frissons, ça ne dure pas longtemps.

C’est une belle façon personnelle de percevoir l’énergie en ce moment. Est-ce que ce vent frais a chassé les boutons !!?!!

J’ai limite assez de cristaux…..1 pour moi depuis ma naissance, 1 pour mon couple pour qu’on retrouve notre complicité et notre harmonie, et les 2 autres je m’en sers pour mes clientes après chacune de leur séance Reiki, je complète avec un à distance et je brûle le papier le 4eme jour….le papier seulement…et vu que je fais 4 séances par semaine en moyenne, et bien il m’en manque….bon, par la suite, j’en ferais encore plus, alors, je vais devoir garnir mon étagère de papiers et de cristaux…

Je vais S h k et ckr tous les soirs sur mon oreiller. Ckr sur et sous mes pieds matin et soir. Je purifie mon appart régulièrement. Derrière le dos de mes clientes de temps en temps, entre moi et une autre personne quand je discute avec elle je fais SHK, ça marche trop fort………….enfin, bref……..c’est un boulot à plein temps. Je vis avec le Reiki du matin au soir, je bouffe du Reiki…..et c’est super bon.

Sept. 2013

Angoisse et Reiki

Bonjour dom

Tu avais dis en stage que tu étais disponible pour toute interrogation après le stage alors j’en profite. Je te remercie pour ce stage ; ton énergie associée à celle du groupe m’ont permis de retrouver une certaine paix intérieure. Paix intérieure qui avait tendance à diminuer fortement depuis ma dernière visite à Amma en novembre 2012. Cependant, cette paix intérieure retrouvée, a été fortement perturbée 2 nuits après le stage par des angoisses assez fortes : angoisses de faire du mal à autrui pouvant entrainer la mort. Cette angoisse a été déclenchée par le fait de que ma fille a cassé un verre en mettant la table et fatiguée par la journée je ne me suis pas assurée que tous les petits morceaux ont bien été enlevés de la table et notamment des assiettes. Si l’un de nous en a avalé un qu’allait –il se passer ?
Cette angoisse a été plutôt forte et je me souviens que quelques jours après la visite d’Amma alors que le darshan m’avait beaucoup apaisée, une angoisse identique (peur d’empoisonner des amis à qui j’avais donné des giroles) m’avait fait passer une très mauvaise nuit.  je suppose que c’est le mental qui se rebelle ?

Dom – Au 1er degré je vous apprends qu’il faut tout accueillir comme « symptôme de guérison », ce n’est pas facile mais il convient de s’y entraîner quotidiennement. Ainsi on arrive a ne surtout pas se « bloquer » sur une angoisse. L’angoisse n’est pas une émotion, mais un message : l’angoisse, comme la panique, tente de signaler une peur. Lorsque l’angoisse surgit, il faut l’accueillir comme une alarme et se dire : « de quoi ais je peur ? » ——-« ha, j’ai peur d’être responsable de la mort de » et… »ok, j’accueille cette peur, elle fait partie de moi aujourd’hui« . et…. »juste pour aujourd’hui, ne te préoccupe pas », donc :  »  « occupe toi »  c’est-à-dire : « qu’est ce que je peux faire aujourd’hui pour diminuer cette peur ? » ou l’apaiser, ou la comprendre… ?
N’hésite pas à poser la question au symbole, au Reiki – son essence-esprit, pense au Shintoïsme abordé en stage…- pose la question à ton guide, ce genre de questions :

qu’est ce que je peux faire aujourd’hui pour diminuer cette peur ? 

Quelle est la bonne technique pour m’en libérer ?

Quel thérapeute peut me faire avancer et grandir ?

Déjà la prise cosmique -Reiki 1 – pendant un quart d’heure 4 jours de suite devrait avoir une action positive.

Il se peut que la réponse t’apprenne d’où vient cette peur de faire mal, peut être un souvenir remontant à l’enfance, voir lors de la vie intra-utérine, la culpabilité inconsciente d’avoir fait souffrir la mère durant la grossesse ou l’accouchement…Au 2ème degré on reçoit les outils permettant de guérir ces chocs vécus dans le passé.


Plus tu avances sur le chemin de la spiritualité plus le mental se rebelle en créant des angoisses fortes ?
Le risque n’est-il pas de tomber dans la folie avant d’atteindre la paix intérieure contraignant le mental à ce taire ? Cela me fait plutôt peur.

Calmer un mental avec des angoisses irrationnelles par une pratique faisant appel à l’irrationnel me parait possible mais qui sera le plus fort ?

Dom – Plus on avance dans le développement spirituel et moins on a d’angoisses et de peurs paralysantes, elles perdent leur pouvoir sur nous. Le but des symboles et de la pratique des différentes techniques et des idéaux du Reiki est d’accueillir, d’écouter, d’énergétiser, de transformer et de s’élever, c’est-à-dire quitter l’enfance tapageuse et insatisfaite.

Plus on « s’attaque au difficile » et ne pas le lâcher, plus la vie devient intense, les broutilles finissent par partir d’elles même.

Toujours se poser la question : J’ai un problème, quelle est la technique Reiki adéquate ?

Bouddha a lui aussi enseigné ça avant tout le reste.

Je te remercie pour ta réponse.

Maintenant tout va bien,  je pratique tous les jours avec beaucoup de joie et parfois des sensations de chaleur et de vibrations très agréables. J’ai l’impression d’avoir réveillé les chakras de manipura, et muladhara,  j’attends avec impatience un signe du chakra du cœur . J’ai le sentiment que le reiki a ouvert une porte sur le chemin de la spiritualité et qu’elle s’est ouverte en beaucoup plus grand que celle ouverte par le yoga. J’espère quelle ne se refermera plus.

Juin 2013

C – « Je souhaiterai te faire part d une experience, que tu dois certainement connaitre.

Ce matin j ai fait un soin complet à I., ma femme. 
En mettant mes mains en V entre son cou et sa poitrine, j ai fait une erreur, sans m’en rendre compte ; j ai utilisé les 4 symboles au lieu des deux symboles CKR et  SKSK. 
Une minute auparavant, elle était très relax, elle avait les yeux fermés et respirait paisiblement. Et d’un coup, elle s est mise à sangloter, puis elle a fondu en larmes.
Bien sûr j ai immédiatement cessé en essayant de la calmer. 
Elle m a dit qu elle se sentait super bien et qu à partir du moment où j ai poser les main en V elle a senti une émotion et une tristesse irrépressible l’envahir.
Je me suis rendu compte immédiatement de mon erreur, On a fait une pause, ensuite j’ai repris le traitement.
A la fin je lui ai fais part de mon erreur. On en a bien sûr discuté, rediscuté, commenté. On apprend de ces erreurs, mais il y a des erreurs surprenantes qui vous confortent dans vos choix, votre nouvelle vision. Qui tord le cou au petit septissisme qui était là dans un coin du cerveau.

Dom – « Tu n’as pas fais d’erreur en activant les 4 symboles au niveau du thymus ; arrivé à ce moment du soin une émotion devait se déclencher et elle s’est déclenchée car c’est le résultat positif du traitement des positions de la tête, avec tes mains et avec les symboles : si une émotion doit avoir lieu il ne faut pas la refouler, ça serait dommage !
il n’aurait pas fallu arrêter, et encore moins paniquer. 
c’est ce que je dis en stages ; on accueille et on continu, on accompagne la personne à exprimer son émotion, pleurs ou rires ; c’est la glace du coeur qui fond.
c’est pour toi juste une question d’expérience dans le temps, plus tu donneras de soins plus tu connaîtra les réactivités, ou les passivités des gens.

en aucun cas il ne peut y avoir d’erreur :

tu peux à tous moments au cours d’un soin activer n’importe quel symbole selon ton ressenti, et sur n’importe quelle partie du corps ; Shk pour aller au delà des résistances mentales, Hszsn pour annuler la distance entre toi le patient et l’univers et bien sur Sksk et Ckr partout en permanence.

Les émotions que vit la personne soignée, et bien elles sont exactement ce que le reiki lui offre de vivre. Si elle résiste, si elle panique, dommage, elle se prive de la libération d’un vieux truc dont c’est le moment qu’elle en soit libérée. mais rien de grave ; ….on peut y revenir plus tard avec un autre soin ; il ne peut pas y avoir d’erreur avec le reiki et le fait d’avoir arrêté et fait une pose n’est pas une erreur, juste un manque de connaissance car ton expérience Reiki date de 15 jours à peine.

et aussi ; une peur ; la peur d’avoir fait mal. c’est humain.

Le Reiki va ainsi nous enseigner à aller au-delà des réactions humaines, d’aller dans l’infinité et dans la profondeur, laisser à l’amour la place qu’il lui revient : à la place de la peur !

on appelle ça Transcender, c’est à dire élever la crainte en un sentiment supérieur. Celui de faire confiance à l’inconnu, à l’invisible ; le KI.

et ainsi, peu à peu, cette confiance s’installe en soi, et devient aussi, par union, fusion du Yin et du Yang, la confiance en soi.
Et plus on fait confiance Au Reiki plus on se fait confiance et plus on se fait confiance plus on fait confiance au Reiki, ainsi grossi la boule de…lumière.
Merci de partager ton expérience.

– Le 5 juin 2013 11:29, C.M  a écrit :

« Bonjour Dom, Pour un soin : abcès à l’anus tu ferais quoi toi…? merci. « – Date: Wed, 5 Jun 2013 12:32:31 +0200
Subject: Re:
From: contact@planete-reiki.fr
1 – Faire un soin sur le chakra racine, si possible la main posée dessus, trés prés quoi, 15 mn, .
(- et si possible une tourmaline aux pieds, pour éclaircir la pensée et ancrer l’esprit,  et oeil de tigre au plexus solaire pour « écarter » le mauvais traitement mental reçu » et renvoi à l’expéditeur).
2 – puis faire rééquilibrage des chakras (- avec un bois fossile sur le foie pour éradiquer la colère et – un  quartz transparent sur le 3ème oeil pour éclaircir l’esprit – et enfin une malachite vers l’abcès pour dissoudre l’infection.
Abcès : pensées qui fermentent suite à un affront, une blessure – pensées de vengeance ou suite à une vengeance (orale ou autre) reçues de quelqu’un…
Anus : point de relâchement, faut laisser aller , digérer et se décharger  au lieu de ruminer.
– « Super, pour le soin c’est que j’avais déjà fait, maintenant vais rajouter les pierres…..!!! merci. »

Le 5 juin 2013 21:22, C.M  a écrit :

Nous sommes les meilleurs…: ai suivi à la lettre tes indications, + quelques vocalises Karuna et  15 mn après le soin l’abcès à lâché, yes!!!!!

Douce nuit étoilée…………

– j’ai fais un soin Reiki à D. il est stupéfait du résultat et moi un petit peu tout de même (je débute quoi !) Coup de cœur pour le REIKI.
Dom.J – le Reiki est miraculeux lorsqu’on l’applique de suite sur coups blessures piqûres brûlures stress…ect.
V – mon fils est très content du résultat de ses partiels. Il peut donc demander Eurasmus pour l’an prochain et avoir des chances pour être accepté ! ! Il vole le fiston !! génial !Pour ma part, ok je me sens beaucoup plus protégée, et tout et tout, mais …bizarre, j’ai une baisse de régime depuis mardi. Voir une baisse de tension (en dessous de 10). C’est rare. Il est vrai que je manque un peu de sommeil. Je sens que mon plexus solaire solaire peine depuis une semaine !! Que veux t’il me dire. Je sens qu’il y a des peurs par là !!
D – puisque c’est le Plexus .Solaire, la respiration abdominale s’impose. Relaxe toi, lâche prise, rien de grave. regarde sincèrement s’il y a quelque chose que tu contrôle ? regarde si quelque chose te fait peur ? as tu peur qu’on voit quelque chose de toi ? Ces questions, c’est durant l’auto-traitement qu’il est bon de se les poser, en état méditatif, relaxée. un peu de Yoga, ou de Qi Gong devrait te soulager. Parfois aussi, l’énergie va nous fatiguer ; c’est sa façon de nous inviter à rester TOUTE une journée au lit, à se reposer tendrement et à nous ressourcer, nous explorer gentiment. le monde social juge ça. Pas l’enseignement Reiki !

N – Bonjour Dom ,J’ai deux questions ; depuis Lundi j’ai de nombreux picotement & sensation de brûlure dans les paumes de la main & plus importante coté gauche !!!! Voulais savoir si cela étais normal !!!!

Dom.J – oui c’est normal, il faut accueillir et remercier, laisser couler, c’est le canal coté coeur, sensibilité, affect qui se libère, cela peut durer assez longtemps aussi il ne faut pas « résister ».
N _
hier soir en faisant Mon repas je me suis brûlée (la main gauche)avec de l’ eau bouillante en manipulant mon auto-cuiseur !!!! Jusqu’à lors quand je me brûlais la douleur passait assez rapidement , voir je ne sentais pas forcément le chaud !!!!! Mais hier soir j’ai dégustée c’étais terrible j’ai fait du Reiki sur ma main mais c’étais intenable !!!!! Donc j’ai capitulée !!!! Bon positivement ce matin tout vas mieux ma main & encore très chaude, mais plus douloureuse. Vais faire ma séance quotidienne de Reiki en intégrant ma main espérant que çà ailles !!!!

Dc’est bien ce que je dis plus haut ; coté affect il y a quelque chose qui demande à s’exprimer.

brûlure = colère – ça bout ça chauffe comme la fièvre = le feu de la colère
mains = façons de prendre en main les situations ! 

donc ; une situation qui te fait vivre de la colère brulante, avec peut être une peine ( coté gauche/coeur) pendant le soin, pose la question au reiki « Montre moi la situation qui créé cette réaction (en pensant à la main brulante/brulée) je veux voir, stp montre moi à voir avec les yeux de l’amour, Merci ».
fais le autant de fois qu’il te le faudra jusqu’à obtenir la réponse…bon wend et bon Reiki
V : Oui OUi Oui, c’est exactement cela ! Tout ce que tu m’écris dans ton message traduit la vérité.  Le mal être a duré 4 à 5 jours.Dans ma vie actuelle, ça bouge dans ma tête un peu côté Job.  qq chose me dit de me préparer à passer à autre chose. Et du coup,  je pense que je cherche à contrôler. OUI …  : le changement !! La vie me test sur le laché prise, ?. je compte bien me mettre au yoga. A 100 m de chez moi il y a un cours en associatif ! Des signes me le disent aussi !!


X – Hier , ma voisine (87 ans ) est tombée dans le hall de l’entrée devant chez moi….émotion….les pompiers….je passe les détails….ma main sur son front l’a peut-être
aidée (je disais CKR en silence ), mais avais-je le « droit » de le faire sans lui demander son  autorisation ?
Dom – dans un cas d’urgence sur le vif c’est ton cœur qui agit et non la raison, donc tu as bien fait et tu as ma bénédiction !
La prochaine fois pose plutôt les mains sur son chakra du cœur, c’est le chakra de l’auto guérison et qui rempli le corps de Reiki par diffusion de l’énergie.
X – Cet évènement m’a troublée .Je viens d’apprendre que cette dame s’est cassé le col du fémur .
D – tu peux la visiter, lui expliquer ce que tu lui a fait et lui en proposer sur son fémur ! Entre voisines !


M –  Je peints des Mandalas. Est-ce que je peux représenter le symbole Ckr dans un Mandala qu’on m’a commandé ?
D – Il faudrait pour cela que le symbole ai du sens pour lui, et il ne peut en avoir vraiment q’en vivant lui-même l’initiation. Sinon, vu sa forme particulière ils pourait être questionné et embrassé par ses proches. Par contre, sur une de tes peintures je vois la spirale – sur le Mandala rose – la spirale seule est universelle, tu peux la représenter, tu sais que c’est la Kundalini, ta force.
M – Je te remercie de ta réponse. Je suis à présent éclairée sur le fait de reproduire ou non le symbole du Reiki. Je trouve très intéressante ta réponse, et cohérente.
En lien, avec ce que tu nous fais savoir : hier matin j’ai dit à un collègue que j’avais fait un stage de Reiki, et du tact au tact il m’a adressé : « c’est du charlatanisme », c’était un peu par provocation, le connaissant, en guise de réponse, je lui ai fait un grand sourire, en lui disant calmement : « pas du tout », et j’ai ensuite mis beaucoup d’amour sur ses paroles et sur lui….Cette anecdote pour te rejoindre, au sujet de l’évocation du Reiki, où il est parfois nécessaire d’y aller avec beaucoup de tact…
D – c’est clair ! Sinon on se vrille pour rien.
tu pratique = tu change. Ainsi les autres sont épatés et t’écoute. Mais avant il vaut mieux se taire, et, à la rigueur « Si un jour tu veux essayer le Reiki ? je t’offre une séance ? Même si tu peur de qqs choses, regarde ; sur moi c’est innofencif , non !! ?… »

Bonjour  dom, Continu,  ce que tu fais, c est petit maol, ces newletters, car  franchement lorsque on les  lis,  perso, je bois les paroles, mon ame ce nourri, j apprend,  je compren encore mieux,  mais voila,  c est pas le mental qui se nourri, c est bien plus, et oui,  comme un enfant qui attend, un cadeau importan moi j attend, avec IMPATIENCE, ces textes que tu nous envoie,  a nous tes eleves reiki.

Si je te le di c est ke je pense que tu as ‘toi aussi  besoin de savoir comment on les percoit, ces textes,  et bien voila moi, c est  mon ame mon spurituel, et mon cheminement, dans cette energie, que ca nourri.
Le meeeeeerrrrrci, serra jamais assez gran.
bises.  F.

Retour de stage Reiki 2

J’apprend vite… Disons que là ce fut le déclic, le déclic Reiki !!!
.. J’ai compris depuis longtemps, même s’il m’a fallut quelques décennies, qu’être incapable de se venger du mal que l’on m’a fait ou être incapable de le dénoncer n’est pas de la lâcheté.
Que le ressasser engendrait un carburant dévastateur pour mon cœur.
Qu’aimer des personnes médisantes, narcissiques, sadiques, qui ont tendance au mélodrame, n’est pas du masochisme.
D’accepter le jugement des autres, cela est beaucoup plus récent, n’est pas de la soumission, ni même une condamnation de leur part, mais un autre regard et donc, une autre écoute de ma part.
De ne pas répondre aux conflits et aux agressions verbales c’est éviter d’être désagréable (de m’être désagréable de ce fait). De tenter de comprendre tout le mal qui se fait, s’est fait et défait les gens, n’est pas justifier le mal…

Par contre ce que je n’avais ABSOLUMENT pas compris c’est qu’en fait il s’agissait du…PARDON!!!
Non mais moi qui m’insurgeais lorsque l’on me parlait du pardon:  » Non je ne pardonne pas: les gens sont responsables de leurs actes ils ont le choix de le faire ou de ne pas le faire et de pardonner cela revient à dire: » Vas y continue,les autres sont tellement rien que tu peux leur faire tout le mal que tu veux!!… »

Mais là, depuis le 2ème degré Reiki une chose s’est révélée que je ne voyais pas jusque là : mes paroles n’avaient rien à voir avec mon attitude: pour ne plus souffrir j’ai pardonné sans le… SAVOIR!! Tout en continuant à me faire du mal, conditionnée à cela.
ET maintenant, merci Dom, j’ai compris une chose essentielle c’est qu’il ne suffit pas de pardonner, mais il faut se pardonner à soi-même du mal que l’on nous a fait… du coup j’ai un besoin irrépressible de passer du temps avec les personnes que j’aime et de m’excuser du mal que je leur est fait, car le mal engendre le mal, mais cela ne m’excuse absolument pas…. Bien au contraire!!
Le verbe est là, toujours, partout, mais nous restons aveugles et sourds à notre vérité que nous portons à bras le cœur!!

Un joli retour que nous font partager une mère et son fils ; Suites du dernier stage Reiki 1, 1er stage de la nouvelle année !

J’écris pour dire que depuis le stage de Reiki je me sens beaucoup mieux. Je ne pensais pas que cela aurait un effet aussi rapide. Dès le samedi soir je me sentais libérer et zen. J’ai repris les cours depuis lundi et je me sens remplit d’énergie positive. Je fais les choses que j’ai à faire petit à petit, sans trop me surcharger et tout coule comme sur un beau fleuve, je ne me laisse plus submergé par une tonne de chose à faire. Je me sens transformé. Je suis bien. Je sens que je dégage quelque chose d’agréable et de positif. Le matin quand je me réveille je me sens de bonne humeur, j’adore cette sensation. Tout ce que j’entreprend à un impact positif et direct (j’ai réussi à vendre ma mobylette dimanche soir, j’ai trouvé un stage dans le cadre de mes études lundi après-midi). Je ne regrette pas d’avoir découvert le Reiki, j’en suis même ravi. Chaleureusement, B…(étudiant, 18ans)
Et bien me voilà partie avec « ton » enseignement REIKI dans mes mains sur mon chemin de vie. UNE NOUVELLE VIE. UN NOUVEAU VIRAGE . Des changements ? Une sensation de me sentir encore plus protégée dans la vie, encore plus remplie de moi-même, plus de lâchés prise et de confiance en la vie. Je perçois beaucoup plus ce que les gens sont et ont en eux : je perçois leurs énergies je pense. Du coup, les personnes que j’ai pour habitude de voir ou de rencontrer sont comme mises à nues devant moi ! Je pense que je vais faire du tri beaucoup plus facilement et plus rapidement dans mon relationnel. Tu te rends compte, je suis mieux guidée pour être plus efficace pour moi même. Oui j’ai mes ressentis plus développés. Aussi, me voilà ZEN, sereine, confiante, en retrait des gens et des choses tout en étant bien là ! ….En tout cas je compte venir au centre les vendredi soir de partage. ENFIN, Demain je fais mon 1er grand soin complet à une amie (en deuil). Sinon, REIKI sur bibi tous les jours et tout le long de la journée ! Réveil 20 mn plus tôt pour Mr REIKI.  Du coup mes mains sont tjs chaudes !!!!! Mais après les 3 claques ds les mains « CKR » je sens que le chauffage chauffe déjà beaucoup à chaque fois. B.. est transformé lui aussi. Tu le sais, il t’a écrit ce soir également. Il a aussi écrit à J-L pour lui faire part de son émotion et de ses ressentis suite à ses confidences en fin de stage. Quel beau MONDE nous avons là. De L’Amour, que de l’Amour. Ça fait vibrer tout ceci ! J’adore. Bon allez, je vais retrouver mes cours de REIKi afin de m’endormir en paix !!! Chaleureusement. V…
Intuition Sucrée

Voici une histoire d’intuition que j’ai vécue il y a quelques temps, au cours d’un jeûne hydrique, dans le lot, à Lalbenque, au centre d’accueil « L’Ermitage » chez Daniel Pasquier. Le jeûne hydrique consiste à se nourrir autrement, d’eau fraîche et de l’amour de la nature exceptionnelle que nous sommes.

jeune-et-Reiki-3emedegreLe soir je m’accordais un thé léger, avec un sachet sortit d’une boite Lypton que j’avais trouvé dans le petit buffet de la cuisine de la borie. L’eau chauffait dans la casserole. Je mis un sachet de thé dans la grande tasse en grés quand j’entendis la voix de mon guide « mets en un deuxième ». À un certain degré d’évolution spirituelle Reiki, on commence à vivre avec un guide. Je sais aujourd’hui que cette voix, on l’entend depuis la petite enfance, mais avec cette habitude de croire que tout vient de nous, se refusant de croire que nous sommes « autres ». Après la première connexion avec notre guide, cette voix est la même, mais plus forte, plus claire, de plus en plus audacieuse. Jusqu’à prophétique. Et toujours amicale.
Peut être parce qu’enfin on l’écoute vraiment.
« Mets un deuxième sachet de thé ». Ce à quoi je réponds « non, ça va être trop fort, il n’y a pas de sucre». Je n’avais trouvé dans le buffet qu’une boîte de thé entamée, pas de sucre. « Mets en un deuxième » me re dit la voix. Comme j’avais pris l’habitude de lui obéir et de lui faire confiance, à l’inconnu connu, je dis OK, et je mets dans la tasse un deuxième sachet de ce thé basic, vous savez ; la gaze à pansement et l’étiquette jaune. Puis je n’y pense plus. En attendant que l’eau frémisse je fais les cent pas devant le fourneau et le buffet. Machinalement je jette un œil derrière le buffet. Pourquoi fis-je cela ? Jamais on ne fait ça, regarder derrière un buffet, car il n’y a rien derrière les buffets dans les cuisines de France et d’ailleurs. Ors, surprise totale, là derrière ce buffet en formica blanc, il y avait un Tupperware extra plat, avec dedans devinez quoi…du sucre en morceau. Qui avait eu cette idée de planquer du sucre derrière un buffet. Tant d’acteurs insoupçonnés à nos vies…dans des actes inconscients.

Mon guide lui, savait que j’aime le thé fort et sucré. Il savait qu’il y avait du sucre malgré toutes les apparences auxquelles je m’étais fié.

Mais l’important dans cette histoire n’est elle pas l’écoute et la confiance à l’inconnu sans preuve qu’il ait raison !?!

Les symboles Hszsn et Shk du 2ème degré Reiki sont là pour nous apprendre à nous faire confiance et à faire confiance à l’inconnu, comme lors d’un envoi à distance ou lors de la guérison du passé. Puis la méditation et le symbole du 3ème degré nous permet de rencontrer notre guide, d’apprendre à l’écouter et de vivre avec lui les choses les plus simples de la vie, sans plus jamais être inquiet excessivement.


Questionnez, je réponds.

N... : Voilà ce qui s’est passé pour moi. Dans la nuit du 2 au 3 Janvier, j’ai vomi et diarrhée . Qu’est ce que tu en pense ?

Dom…: cela signifie que tu « évacue quelque chose sans faire la part des choses », une sorte de fuite, tu « liquide » l’affaire; ne pas bien regarder en face une certaine situation.
diarrhé = évacuer vite, liquide.
vomissement = rejet, sans le digérer. 

N….: LE Samedi 5 Janvier, j’ai fait comme une simili  occlusion intestinale : de 15h à 21h j’ai souffert énormément car je n’arrivais pas à évacuer les excréments. J’avais de très fortes contractions mais le sphincter ne s’ouvrait pas.

D…: là c’est l’inverse ; « tu retiens quelque chose » tu retiens de peur de décevoir ou de déplaire.

N… : J’ai aussi pratiqué le reiki sur mon fils et sa compagne. Mon fils a eu une réaction violente de colère ( reiki le 27 12 et réaction le 5 01) Il a mis sa compagne à la porte. Elle a été très choquée mais après explication ça s’est arrangé et je pense que mon fils a pris conscience qu’il n’était pas bien . Il habite à Reims et encore une fois je te demande conseil Que puis-je faire?

D…: simplement qu’il prenne conscience que des non dits se sont acculés et engendrent inévitablement de la colère. il est temps pour lui de s’autoriser à dire les choses au fur et à mesure au lieu de les retenir. voici le temps des échanges verbaux avec sa compagne. 

N…: Sa compagne ne parle pas beaucoup.

D…: et pareil pour elle, car en « retenant » son homme en fait de même par mimétisme, puis accumulation et colère.  

N…: Que de rebondissements négatifs mais que je considére comme positifs ????

exact !

tu peux leur passer ma réponse à tous les 2 ! 

N…: Tu sais Dom, tu m’as enseigné un outil merveilleux mais très puissant et après ces rebondissements j’hésite un peu et que puis je dire?????  Je pratique sur moi OK  Mais je ne tiens pas à être responsable des scènes de ménage ou autres !!!!!

D… : il suffit simplement de les prévenir en leur disant que l’ombre peut se dissiper et que des choses ignorées peuvent se monter, mais que Je suis toujours là, au cas ou… 

N…: A 11h ce matin une amie m’a demandé de lui faire une séance. Elle se fait suivre par un psychiatre car elle est maniaco-dépressive je crois. elle est hyper active. Alors qu’elle va être sa réaction? ????

D…: Tu fais la prise cosmique un quart d’heure, puis soin complet, l’idéal est de pouvoir répéter ce traitement pendant 4 jours consécutif  en prévenant que les 2 premiers jours il se peut que ça remue, puis l’amélioration devrait se manifester à partir du 3ème jour de soins Reiki.
Commence, et tu verra bien…
.  merci Reiki. 

N…: Es-ce que des soirées partage sont au programme en ce début d’année?

Dom :….oui, ça va venir, patience ma chère !



Vos retours de stages reiki ; aussi en bas de page.

PRINTEMPS été Automne 2015

Stage Reiki Karuna

Stage Reiki Karuna

Vos retours de stages Reiki Usui, Karuna, Komyo.

Retours de vos stages Reiki Karuna Juin 2015

Merci à toi pour ces 3 journées Karuna d’amitié, d’AMOUR, de compassion, de Lumière, d’humilité et de nourriture spirituelle………. !
Merci d’être toujours dans le DON et le PARTAGE !!! Bonnes Vacances et sûrement on se verra en octobre !!! ou peut être révision 1er Degré le 19/20 Septembre !! bises, Marie. ps : tes photos sont magnifiques et les fleurs du cactus du Dojo aussi !!!

********************En te rencontrant j’ai franchi la porte d’un autre monde ; celui de la réalité, de la spiritualité et du chemin vers le bonheur.
Merci de tout ce que tu fais pour nous. Bien amicalement. JB

***************************Cher Dom,
Je remercie tous les jours l’univers d’avoir fait croiser nos chemins. La personne que j’étais, qui voulait sauver le monde a fait du chemin depuis à peine 5 ans grâce au Reiki. J’ai en effet compris qu’il fallait me guérir en mm temps que de soigner les autres. Petit à petit les nœuds se sont dénoués, les liens sont devenus plus souples les larmes ont beaucoup coulé et coulent encore…….
Mais quel bonheur de se sentir libérée, de sentir le poids qui m’étouffait se retirer. Je respire enfin !!!!
Comme tu le dis, avec le Karuna les épreuves sont devenues des expériences. Oh combien d’expériences remplissent ma vie !  Toutes aussi merveilleuses !!!
En écrivant ces mots qui coulent tout seuls je me repasse le film de ma vie. Je n’aurai jamais pensé atteindre cet état de paix.
Un jour décembre 2010 …… Sur mon chemin ….. J’ai croisé un merveilleux maître enseignant Reiki Karuna. Il est parfois direct mais surtout il est humble et rempli d’amour.
Merci DOM de m’avoir initiée.
Merci REIKI de m’accompagner.
Merci les ANGES Karuna de veiller sur moi.
Retours de vos stages Reiki Usui et Komyo printemps et automne 2015

Cher Dom,
je viens vers toi pour témoigner avec une grande humilité que la formation du Reiki Komyo que tu transmets est une belle aventure car j’ai appris et partagé avec un Maître formidable qui a compris le pardon, l’humilité, le non jugement, la non critique, la simplicité d’être soi et se découvrir de l’intérieur pour être mieux envers l’autre.

Ma mission sur cette terre commence bien avec l’acceptation de mes dons grâce à la découverte de la paix intérieure qui s’est installée suite au stage Komyo, pour pouvoir progresser dans un monde où l’homme se sent si seul tout en étant entouré.

Le Reiki Komyo tel que le transmets ; j’y ai appris des techniques pour découvrir l’auto soin et le soin à distance pour moi et pour les autres. L’enseignement du Komyo m’a apporté des réponses à des questionnements principaux pour mieux vivre en harmonie avec moi mm, et avec les autres.

Je conseille au plus grand nombre d’entre nous de faire cette initiation pour être dans la lumière, rallumer l’ampoule de l’AMOUR car le cœur de l’homme est devenu tellement sec. C’est un bain de jouvence et un partage plein de sincérité.

Alors buvons cette tasse de thé pour être en communion pour faire ensemble le bien et donner de la lumière à soi et aux autres.

Merci au REIKI Komyo pour cette belle rencontre

Infiniment MERCI, pour ce que tu nous a, et m’a donné. ma pratique est quotidienne (45 mn environ), je me sens depuis lundi rempli d’energie, et pourtant je me lève à 5h30 du matin pour pouvoir exercer… je n’en reviens pas encore, ça sera avec plaisir de participer aux soirées reiki, donc je te dis au 9 octobre pour la soirée et le repas pratages. J….

Ton attitude sage posé et calme avec un brin d’humour a su (nous), me transmettre le 1er degré de REIKI. En cela MERCI.

Anecdote : il y a quelques mois, j’avais demandé à l’univers avec l’envoie à distance suite au stage 2ème degré de me faire rencontrer un homme gentil, qui a les mèmes valeurs et mèmes envies que moi …alors j’attendais, confiante… et il y a 1 mois, j’ai senti que je devais aller sur le site de rencontre où j’étais inscrite depuis un certain moment, mais où je n’allais plus… et là, un homme me contacte, avec un profil qui ne me correspondait pas du tout…et pourtant, je sens que je dois y aller….et en fait, en très peu de temps, je me suis aperçue que c’était bien lui que j’attendais….. du coup, nous sommes ensemble depuis 1 mois, sans doute, sans peur, d’une fluidité extraordinaire…(à 43 ans,ça ne m’était jamais arrivé) …avant j’avais l’envie, aujourd’hui, je suis prète…tout simplement…et je vis cette histoire, juste pour aujourd’hui, au moment présent….et demain n’existe pas…et c’est magique…. Merci Reiki, merci mon Guide , merci l’Univers !!!!  à très bientôt. gros bizoux. X… (du groupe Planète Reiki 2 « Amazones »)


MERCI Dom, pour ton précieux Enseignement…Tout était juste PARFAIT d ans ce stage Reiki 3. Je t’envoie plein de Lumière et chaque jour que l’Univers me donne, tu es dans mes prières. Je t’embrasse bien fort. N….

plein de choses sont en train de se passer en moi et c’est juste génial…même quand c’est moyennement agréable !!! lol…..mais dans l’ensemble, c’est plutôt des choses sympas.

je travaille à fond et j’ai hâte d’être à samedi pour le 2e degré…..et continuer ce merveilleux chemin avec toi….
MERCI Dom, pour ton précieux Enseignement…Tout était juste PARFAIT dans ce stage Reiki 3. Je t’envoie plein de Lumière et chaque jour que l’Univers me donne, tu es dans mes prières. Je t’embrasse bien fort. N….

Je t’écris pour te faire mon retour sur « bambin »

En effet, entre midi et deux, m…, Garcon, 7ans m’a demandé un soin

Allongé sur son dos, Je lui ai fait le « global »; mais j’avoue ne pas être resté 3 minutes sur chaque position de mains. (Une des raison: les pattes sur le feu lol )

Quelle conséquence a cela?

Il s’est relevé HEUREUX m’a til dit, en sentiment de « ca fait du bien » pour reprendre ses mots.

Nous avons mangé…

Puis il a demandé que je lui en refasse un; je lui ai fais celui des chakras.

Idem, Il s’est relevé en disant « ah je me sens grandi »

c’est trop beau je trouve..

Sa petite soeur a alors demandé elle aussi un soin reiki; 

Assise dehors au soleil, je lui ai fais téte ventre ….

Elle était zen, normal …

Lorsque je lui ai chuchoté « voilà ma chérie j’ai fini »

Elle s’est mise a pleurer!

Elle est alors venu dans mes bras me faire un calin

Puis son frère est venu et elle lui a dit je veux un calin de toi aussi.

elle ma dit « maman, je ne sais pas pourquoi je pleurs mais je veux un calin de vous deux »

Elle a serré fort son frere en lui disant « je t’aime beaucoup »

M…., souriant, ma dit « oh maman cest la première fois que j’entends ça d’E…. » 

(d’ordinaire, Ils se font régulièrement des calins, tout comme ils se chamaillent)

J’avoue que ces scènes ont été surprenante…
Encore MERCI.

Après le stage de Reiki 2, de mercredi et jeudi derniers, je te fais un bilan  des changements qui se sont opérés pour moi.  Vendredi et samedi , tout mon corps ressentait une fatigue impressionnante, à ne pouvoir rien faire physiquement… donc ça a été le repos complet. Après, une fois ma vitalité revenue, mon premier « nouveau soin » a été pour l’une de mes amies , qui m’a surprise ;  » Ouaaahhhh « !!! m’a t-elle dit…..c’est beaucoup plus fort qu’avant !!!. Pendant ce même soin, j’ai eu l’impression que quelqu’un était à ma droite et me transmettait des informations quant aux endroits en problématiques. Je pratique quotidiennement, et avec beaucoup de plaisir, ce que tu nous a enseigné, Je me sens maintenant plus calme, plus sereine, aidée, et ayant des ressentis  plus fort au niveau du cœur. Je tiens à te remercier encore pour ce stage merveilleux , le Reiki que tu enseignes est un véritable cadeau d’Amour….du Bonheur Pur !!!!.

A partager ce retour,  c est simplement ce qu’ il y a dans mon cœur,  ce fameux noyau divin, a qui j’avais interdit d exprimer quoique ce soit !
Le Reiki 2 m’a permis enfin de pouvoir vivre toutes ces émotions sans les craindre et de les accepter.


Ce soir je rentre chez moi, jusque là rien d anormale, mon fiston un peu « malade » toussotant piaillant…

Je l’installe sur la table de massage et je télécharge la musique…. Hop nous voila enbaraué dans une séance de Reiki…..


Non seulement plus de bobossss car maman était rentré et s’occupait de son garçon mais en plus pendant la séance à la gorge il a sur chauffé.

Après son retour il me prends dans ses bras et me dit il y a plein de chose que je n’arrive pas à te dire même si tu peux tout entendre je les gardais pour t’epargner…..

Et la il me vide son sac…..

Cela ne me concernais pas du tout ni directement ni indirectement mais lui les avait bloqué de peur de me créer du souci…. Le reiki l a libéré de cela ce soir….

Merci….. Le reiki nous a offert encore plus d’amour à partager.

Grand Merci pour cet excellent WE, stage Reiki 1 riche en apprentissages.

Les effets positifs perdurent, le Reiki c’est bénéfiquement « addictif » ! A bientôt


Mai 2015
Un grand Merci pour ces instants passés ensemble hier soir et qui ont été pour moi source de Bonheur et de Joie. Bonheur car j’y ai vu des hommes et des femmes de bonne volonté œuvrer tous ensemble pour contribuer à soulager la souffrance des autres, en toute simplicité. Joie d’avoir pour un instant retrouvé l’émerveillement de l’enfant qui sommeille toujours en moi. J’ai découvert hier un nouveau chemin dans le ressenti; je pensais en avoir fait le tour et crois moi, j’ai été gâté dans ce domaine par la Vie.

Depuis que mon grand père puis mes oncles m’ont appris à découvrir les sentiers de l’eau dans le ventre de la Terre, que de chemin parcouru, que de rencontres avec celle qui dirige invisiblement le monde; je l’ai retrouvée dans le silence des collines, au fond de la mer, en haut des montagne, dans la solitude sauvage des garrigues et des forêts. Je l’ai ressenti ensuite sous les voutes des églises et des cathédrales. Je me suis lié à elle contre les pierres levées ou couchées que nos ancêtres avaient érigées il y a bien longtemps mais qui continuent généreusement à nous léguer leur héritage, aujourd’hui encore. Puis vinrent les expériences des soins d’ici, puis de ceux des Chinois avec chacune leurs différences dans la palette des ressentis. Le ressenti de chacune de ces rencontres est différent. Et hier soir au Dojo Reiki, ça n’a pas manqué de se reproduire ; Je l’ai ressenti très fort à un endroit que je n’attendait pas…Et je suis resté là, immobile, abreuvé de cette force qui entrait en moi et qui me nourrissait, comme une mère allaite son nourrisson. J’ai remercié, j’ai prié, j’ai communié avec elle…c’était bien celle que je connaissait et qui me dévoilait un autre de ses visages….qui m’a réconforté, qui m’a rassuré, qui m’a soulagé et finalement, apaisé.

Merci aussi d’avoir pris soins de S..….Nous sommes ressortis du Dojo confiants et rassurés; conscients que nous ne sommes plus seuls pour affronter les épreuves du Chemin.

Merci de ces moments d’extases, où la Lumière vous envahit, quand le sentier se dévoile enfin un peu plus, éloigne la peur et l’angoisse, et que les choix sont remplacés par l’Evidence. Merci de nous avoir offert tout celà… et de m’avoir rappelé que, dans le domaine de l’Humain, un et un, ça fait beaucoup plus que deux… Que les Anges continuent à veiller sur toi.

Merci à toi Dom d’être ce que tu es!

Je me disais ce matin ,oups pas de pleurs lors ni pendant ni après la maîtrise!!

Me voilà guérie de mes traumatismes du passé ! Merci à toi. Merci au Reiki !!

Je te passe l’enregistrement que j’ai fais pendant la formation à la Maîtrise, Il y a tout le début de l’échange, la médit elle même démarre vers la 5eme mn. (c’est génial de pouvoir réentendre, t’es trop fort!) . Merci pour les 2 diplômes!
Je crois que je n’ai pas fini de mesurer l’ampleur des guérisons qu’il y a eu sur ces 3 jours… je l’ai sentit le dernier jour de manière très intense, mais waouh c’est vraiment énorme. Sachant que tu enchaines les stages j’ai pitié de toi et je t’épargne les détails…
Mes sœurs viennent dans 15 jours je vais pouvoir pratiquer à tour de bras, d’ici là sur les objets et les chats…Encore merci, merci, merci pour ton précieux enseignement.

Merci surtout pour tout ce que tu nous as fait découvrir. J’ai la sensation d’avoir vécu un « moment fort », de découverte et de partage, que je n’oublierai pas. Je ne pensais pas en venant au stage que le Reiki Komyo pourrait à ce point entrer naturellement dans notre vie, et modifier notre façon d’être. J’ai la sensation qu’il y a un « avant  » et un « après ». Tu nous as donnés les outils, le mode d’emploi, et l’envie de s’en servir. J’espère que le temps n’amenuisera pas mon envie de prolonger l’évènement, mais je sais que cela ne tiens qu’à moi. Montpellier est loin pour nous pour participer aux soirées partage, mais nous avons déjà programmé d’en faire avec ma sœur F…, G…, et M….le week end quand ils descendent à Arles.
C : Tout d’abord merci pour ces deux journées d’enseignement et de découverte d’un Maître Reiki qui est d’une ouverture et d’une humilité tout cela m’a beaucoup touché.
D : Bonjour C….c’est le Reiki qui coule en moi qui me fait….

C : Je te remercie encore une fois pour la mission que nous avions a faire en commun -m’initier et te faire confiance pour ça – et maintenant je commence a ressentir le début des effets de ton enseignement et le soin a distance.
D : c’est ça le vrai merveilleux de notre planète, sa présence, toujours. La présence de La Terre.
C : Comme tu l’écris si bien sur ton site « le plus grand ennemi de notre personne c’est nous même », travailler son mental est extrêmement dur quand on est seul mais là avec tes symboles et la parole cela va mieux.

D : c’est le chakra le plus dur à travailler ; la gorge ; parole, écoute, accueil du Divin, confiance et audace d’être soi. Mais à terme c’est lui qui nous donne notre force. Au quotidien.

C : Je te donnerai des nouvelles de mes progrès sur mes soins et sur moi et mon acceptation de ce cadeau de médiumnité. Au fait ton ange gardien me parle et me dit que tu aurais un ami à toi qui serait décédé et qu’il est souvent auprès de toi 😉

D : Merci, et dis lui de lui dire qu’il en profite pour faire le ménage ! l’aspirateur est neuf, il devrait se régaler…lol
Le lendemain du 2eme degré, urgence pour un proche au bord de la crise cardiaque,1h de reiki et sa tension est passé de 16 à 11.
Les 1ers jours, côté Sauveur à été réactivé…ce que la technique Reiki 2 du « traitement mental » m’a apporté de plus c’est d’abord le calme et une sorte de sérénité….jusqu’à bien mieux vivre aujourd’hui mon chagrin d’Amour (ou d’attachement peut-être),quand c’est trop fort prise cosmique…
J’ai lu avec attention ce que tu écris sur la relation Amoureuse, dans ton recueil du 2eme degré, Veux tu dire que ce que l’on voit chez l’autre ou ce qu’on lui reproche est précisément ce que l’on doit transmuter chez nous pour avancer et Gai RIRE!
Ton regard avisé est le bien venu, merci pour ce que tu transmets et la manière dont tu le fais...

Me voici de retour dans mes belles montagnes lyonnaises depuis tout à l’heure.
Je tenais à encore te remercier pour cette magnifique formation, je suis une autre, et ma famille m’a fait remarquer déjà hier, que j’étais transformée.
Hier après-midi j’ai fait un soin d’1h30 à ma belle fille qui a le dos dans un état lamentable la pauvre et ça lui a fait beaucoup de bien(mais il lui faudra beaucoup de séances car elle a la colonne vertébrale toute tordue). Mais ce qui m’a beaucoup émue, c’est lorsqu’un jeune homme qui fait des travaux chez mon fils, lui a dit hier au soir de me remercier car il n’avait plus mal au dos!!!Vers 17h,alors qu’il allait rentrer chez lui, il a dit qu’il souffrait beaucoup de son dos, effectivement cela se voyait dans sa démarche. Je lui ai demandé s’il connaissait le Reiki et dit que je venais tout juste d’être initié; il connaissait ;donc je lui propose d’essayer de le soulager en lui donnant de l’énergie  (je dois dire que j’étais entrain de terminer le soin sur ma belle-fille lorsqu’il a toqué à la porte ),il accepte, donc je mets mes mains à 10cm environ au dessus de l’endroit désigné , 6mn, pas plus, et il est parti en descendant difficilement les escaliers, mais en prétendant que ça lui avait fait du bien. Puis j’ai terminé le soin de S….(ma BF).Voilà, Jusqu’à 20h où  il est passé à la maison et a dit que même pas une demi-heure après ma petite intervention, il n’avait plus mal ! !! Imagine mon émotion ! quel bonheur, quelle belle récompense, si rapidement après mon initiation du 1er degré. Merci, merci, merci…3 fois de suite la aussi …lol ! !!
J’ai commencé la lecture du manuscrit Reiki 1er degré Planete Reiki ; j’ai compris ‘les éreurs gramaticales » ‘dont tu as parlé en nous le remettant. Voilà, cher Dom.Je te souhaite une bonne soirée.

Un petit mot pour te dire que la  pratique régulière du Reiki m’a apporté beaucoup de bien être et de réalisations. ma vie est en plein changement….et j’ai depuis quelques temps vraiment l’impression de communiquer mentalement avec l’Univers. et d’être entendue. je me sens plus forte tout en étant sereine. je remercie le fait de t’avoir rencontré et que tu m’es transmis l’amour du Reiki.
encore merci.

Décembre 2013
Retours de stages :

Je fais partie du groupe Reiki 1er degré  » vent d’automne » de Planète Reiki. Suite à ce stage, je suis partie aux Antilles. Savoir pratiquer le Reiki m’a beaucoup aidé pour ce voyage. Je fais des aller et venus aux Antilles depuis presque 10 ans. ce sont des voyages dû à mon activité professionnelle. A chacun de mes voyages, je rentre complètement vidée. Cette fois ci, très grande surprise, je me sens bien en forme.

Je fais des aller et venus aux Antilles depuis presque 10 ans. ce sont des voyages dû à mon activité professionnelle. A chacun de mes voyages, je rentre complètement vidée. Cette fois ci, très grande surprise, je me sens bien en forme. Avec le décalage horaire, je me réveille tous les matins entre 3 et 4 h du mat. Je profite donc faire mon heure de Reiki. J’ai eu des moments assez difficiles émotionnellement.
Heureusement, que Le REIKI est là. En plus pendant mon séjour, tu nous as envoyé quelques mails de nouvelles Reiki. Qu’est ce que ça m’a fait plaisir ! Je n’ai pas pu t’écrire avant pour te remercier pour ces moments chaleureux, et pour ces moments de partage qui m’aide beaucoup aujourd’hui. Je me sens un peu plus forte, un peu plus rassurée. P.


Bon Jour Dom, Merci pour ta prompte réponse ! Soyons patients pour Alain … Il semble que cette fin d’année soit pour nous tous, bonheur, amour et Conscience (pour nous en tous cas prises de conscience gigantesque !) c’est cela que j’étais venue chercher ici … Le Reiki vient encore de prendre une autre dimension pour moi : engagement profond et plénitude, confiance … Voilà un beau cadeau de Noël … Merci à toi Dom pour ta présence et ton enseignement. Que les belles choses et les belles personnes que tu viens de vivre lors de ton dernier stage « Reiki de Noël » t’accompagnent jusqu’à la toute fin de 2013.
Demeures heureux tels que nous le vivons.
Om shanti
Tu as raisons ici en Asie les énergies sont extraordinaires ! Cadeau de l’univers hier : j’ai vu des dauphins en toute liberté …Ici tout m’est offert au niveau des énergies, oh combien sont-elles belles ! Mon être tout entier est en pleine phase d’évolution /révolution !
Je t’envoie toutes les lumières et les énergies depuis ce bel endroit de  la planète et un bisou !

Septembre 2013 ; retour du stage Reiki 1 :

…des news, pour moi cela se passe très bien si ce n’est que j’ai du mal à atterrir un peu, j’ai même un entretien d’embauche vendredi et franchement cela ne me perturbe absolument pas !!! C’est quand même incroyable !!!  Sinon j’ai fait mon premier soin hier sur ma petite sœur, elle s’est sentie complètement anesthésiée au point qu’elle n’arrivait même plus à lever un bras  pour évacuer une mouche qu’elle avait sur la main. Elle s’est sentie un peu vaseuse après et 2h après tout allait bien pour elle et pour moi, je trouve cela absolument divin …lol

Merci reiki pour ces moments de paix, de boulersements et de belles rencontres. Une grande porte s’est entrouverte devant moi, je suis en train de la pousser petit à petit, j’ ai hâte de trouver ce qu’il y a derrière !!!…
Je travaille, je travaille le Reiki et le Qi Gong j’ai encore plus d’énergie dans les mains.

Merci a toi pour tout ce que tu transmets , répands et fait ressentir. Je m applique dans mes exercices et ai pratiqué un premier soin hier, ça m a fait beaucoup de bien !! La personne était ravie et m a dit que ses idées étaient plus claires , il doit me tenir informer de la suite. Voilà , je suis heureux! Merci Reiki et à bientôt. 
Cela se passe bien avec le Reïki 1er degré pour toutes les raisons que tu connais déjà … Je m’ auto- traite régulièrement et vais mieux, mon mari est
enchanté de mes services et le chien commence à en bénéficier aussi… C’est exactement ce que j’espérais …et je te remercie encore de ton enseignement
et de ta transmission … Que l’Amour Reïki t’accompagne toujours.


septembre  2012
Dés le deuxième degré Usui nous aprenons à utiliser les cristaux de quartz pour emplifier et prolonger les envois de Reiki à distance, autant pour soi dans le passé le présent et le futur, que pour les soins et les marathon Reiki à Autrui. Bien entendu les cristaux de quartz ne se limitent pas à cette déja si merveilleuse action. En voici une recette d’Elixirs de minéraux !

Préparation d’un élixir Reiki :

Mettre le cristal après l’avoir nettoyer dans un verre d’eau minérale, eau de source…et Couvrez le – verres « Nutella » à couvercle ! – puis donnez lui du Reiki et l’énergie du (des) symboles au moins 3 minutes – En faisant cela pensez ce que vous désirez de l’action de la pierre- , et placez-le au réfrigérateur pendant une nuit.
Le lendemain, faites à nouveau 3minutes de Reiki avec symbole(s) et il peut être bu ou appliquer. En massages, en onction, pour une plante, dans une recette de cuisine…ect.

Attention : Certains cristaux par leur composition ne peuvent être mis dans l’eau ou sont toxiques donc ne doivent pas être ingéré ; renseignez vous !!…

Du 30 Novembre au 3 Décembre 2012, nous serons au salon Bio Harmonies de Montpellier – Stand D40 Hall 9.

Clic  droit  sur l’image , puis : dans la liste qui se déroule : clic sur : Enregister l’image sous.
pour la télécharger

Vous reste plus qu’à  l’imprimer autant de fois que vous le désirez pour vos proches et lointains amis.

en cas de difficulté n’hésitez pas à nous écrire contac@planete-reiki.fr et nous vous l’envoyons par mail avec grand plaisir.

@ Bientôt au salon !

          Mudras de la danse et de l’eau.

Nous avons achevé la saison des stages et des ateliers Reiki par les 2 ateliers « Mudras et Reiki » mi Juillet. Leur pratique m’a donné cet été l’occasion de vivre un moment merveilleusement…intime.
C’était en Août, dans sa splendeur de feu, la recherche de l’ombre, de la fraîcheur. La quête de l’eau, celle de la baignade et des fruits frais. Si possible loin des foules, tout au moins le plus de solitude ou le maximum d’espace autour de soi. Guère possible à la plage.
Les Cévennes. Je campais autour de Saint Jean du Gard à l’occasion de son festival de théâtre de rue auquel je fus invité par une amie rencontrée à Avignon. Nous venions d’y vivre une semaine de Qi Gong Woodang 2 enseigné par le grand Maître …….La pratique du Qi Gong est « obligatoire » quand on pratique la Maîtrise Reiki intensément, afin d’en mieux canaliser sa puissante énergie, et le Woodang est, la forme la plus adéquate à mon humble avis. Gérard nous répétait tout au long de ce stage intensif qu’il fallait « chauffer » les reins, boire chaud, d’éviter les glaces, les boissons fraîches, bref de toujours protéger les reins du froid, même en été. Je n’y ai pas trop cru, confiant dans l’énergie Reiki et celle des symboles le Reiki est un Qi Gong – laissant ces croyances anciennes aux Chinois, et ne prenant à part moi juste la pratique des gestes et des métaphores puissantes et subtiles du Woodang 2.

Midi, chaleur, sueur, et faim. Pique-niquer au bord du Gardon, idée irrésistible. Pas un coin de libre, j’avais envie d’être seul au bord de l’eau, manger et méditer avant de retrouver avec bonheur la foule festivalière. J’entre dans le courant et décide de remonter le torrent à la recherche d’un endroit inabordable par la rive. Le truc sauvage hors du monde au sein de la nature. Chez soi. Je trace d’abord le symbole de distance en l’air, Ckr sur les mains les pieds et le corps et, pour ceux qui connaissent, Iava, et me connecte joyeusement à l’esprit de l’eau en terminant par le Mudra de la dance. Marcher au milieu du Gardon agité, de l’eau tantôt à mi cuisses tantôt mi mollets en roulant sur les gros cailloux moussus devient alors aisé, mains jointes devant Swadhistana,  dans la forme du Mudra de l’eau ; ne lâcher la forme qu’une fois trouvé le coin de rêve.
À l’ombre.
Au bout d’un kilomètre je trouve, termine le Mudra en offrant l’eau divine au torrent et m’installe au milieu du gardon sur un rocher, au sec. Ombre d’un arbre penché. Chant de l’eau qui court à la mer. Joie. Un héron cendré vient se poser à 20 mètres, de façon identique ; sur un rocher au milieu du courant. Jubilation. Merci, moment de grâce. Ouverture du sac à victuailles…et là, tout à coup je sens une douce chaleur bienfaisante dans le bas du dos et je ressens la masse des 2 reins. A l’intérieur. Leur volume, leur poids. Leur présence. Je me retourne pensant au soleil passant au travers du feuillage !?! mais non, « ils » étaient on ne peut plus à l’ombre et baignant dans l’aura fraîche du gardon enveloppante.
Ça chauffe, c’est bon, et ça dure.

Puis je comprends. Les reins sont Yin, l’eau qu’ils filtrent, je venais d’honorer l’eau, j’étais entouré d’eau,  alors mes reins ronronnaient en se présentant à moi comme jamais au cours de mon existence je ne les avais ressentis.
Merci Mudras, merci Qi Gong. Merci Reiki.
Merci la vie le soleil et l’eau pour ces petits instant de bonheur.

Stage Reiki enfants à domicile !

Stage Reiki enfants à domicile !
Suite au marathon que nous avons envoyé à Xavier pendant plusieurs 
mois (

Xavier va très bien dans l’ensemble, il a des hauts et des bas mais surtout des hauts! Il revit et vous y êtes pour bbbbbbbbbbbbbbbbeeeeeeeeeeeeaaaaauuuuuuuucccccccccooooouuuuuuuuupppp!!!!!!
Merci merci Reiki!! Ingrid) 

 ainsi que les soins à distance à 2 de ses filles, puis son initiation – à son domicile vu son immobilité – suite à son mieux être, je vais avoir l’honneur et le plaisir d’initier ses 3 filles – 6,15 et 11 ans – au premier degré Usui.


Leur stage en famille,  des fleurs de lumière Reiki dans une nation de chrimères…


D’autres enfants inscrits à un 1er degré. Quelle belle rentrée ces enfants se voient offrir !

Un maître Reiki enseignant peut il être malade ?

Bien entendu, et Heureusement. Pourquoi heureusement, parce qu’ainsi il a l’occasion de tester sur lui les effets du Reiki et des symboles. Lui permettant ensuite d’enseigner du vécu ! Convaincu lui-même.
En signant la chartre de l’éthique de Maître enseignant Reiki on s’engage à faire un travail continu sur soi – qui va de plus en plus en profondeur au fil des années d’enseignement. Dans l’intime secret de soi.
Fin Août c’est ce qui m’est arrivé. En repeignant la cuisine, le dos s’est coincé. Je peignais avec le dos ? Oui. Je m’en souviens, ce dimanche après midi j’en avais vraiment plein le dos, plus envie de continuer le travail, envie d’aller à la plage, finir avant d’aller à la plage, dualité, résistances des deux cotés. Crac. Sacrum, puis …Lire la suite…L4 et L5. Putain ça fait mal. Limite des mouvements, des positions, réduite à l’amertume la joie de vivre une fin d’Août très chaud comme je l’aime, une semaine pratiquement au lit. J’ai activé tous les symboles connus, dans des formulations diverses (Usui, Karuna, et Shamballa) fait des autotraitements, du Qi Gong et des demi-torsions Yoga – ce que je pouvais, vu que j’étais tout de travers par compensation… vertébrale.
Ou peu de résultats, qui ne tenaient pas. J’en connais la raison. Plutôt que de persister à me soigner, je constatais qu’une part restait dans l’état de souffrance, je préférais comprendre, chercher à voir la forme pensée qui créait le blocage plutôt que de me soigner physiquement. Par expérience, et grâce aux symboles, lorsque dans mon esprit se fait clair la raison de la peur inconsciente que mon corps voulait me communiquer par son langage-non-verbal (vertèbres contractées en l’occurrence) lorsque l’esprit comprend le corps, alors tout se débloque d’un coup. Ça n’est pas pour moi une simple théorie mais un long vécu symptômes-Reiki-Symboles-compréhension-libération/guérison spontanée. Expériences personnelles et celles des praticiens que j’ai aidés.

Si j’avais guéri cette lombalgie en un jour, je n’aurais pu apprendre l’excellente leçon que j’en ai retirée. Quelques fois l’énergie peut nous entraîner à stagner dans une situation pour en trouver l’élément déclencheur. C’est de l’amour, la rose avec les épines. Mais la rose tout de même.
L’antalgique enlève les épines. Alors la chose pointue reste en dedans, n’est pas exprimée, pas libérée.

Je passais ma semaine du lit au hamac à scanner l’imaginaire, détecter dans la mémoire les pensées incorrectes liées aux vertèbres en question et j’en oubliais – paresseusement – de me soigner physiquement – enfin, un peu quand même. Rien d’étonnant à ce que j’en ai eu marre de souffrir et j’ai lâché ; j’ai lancé l’appel par mail d’un marathon Reiki à distance. Pour moi. J’ai osé. J’ai écouté la voix de mon guide Reiki.

C’est la 1ère fois que je faisais ça, demander à mes stagiaires-élèves-praticiens de m’envoyer du Reiki. Je ne le faisais jamais, non pas par fierté ni orgueil mais par croyance.  Celle de croire que l’enseignant, le « Maître », doit toujours montrer à ceux à qui il enseigne une image invincible. J’ai compris que c’était faux, en partie. Du moins pour le « toujours.
Et c’est drôlement bien vu de la part du message du Reiki et des symboles, car ce « oser demander » fait partie des causes à effet du problème sacrum – exprimer les sentiments, exprimer les peurs et les souffrances – les garder comme j’avais l’habitude de le faire c’était retenir « en bas » l’énergie qui doit s’élever. J’ai compris ; le sacré c’est en bas ! J’ai compris et changé bien des choses depuis cette semaine d’Août. Voilà encore un « plus » à retransmettre lors de mes futur stages et ateliers.

J’ai vu aussi la compassion dans les actes et actions de mes chers initiés–ées, leurs élans spontanés vers moi, et même certaines personnes qui m’ont remercié car grâce à ma demande elles se sont mieux appliquées et en ont tiré profit, m’ont-elles écrit.

Moralité ; il y a autant d’honneur à demander et recevoir qu’à donner.
Merci  Reiki, merci à Tous Symboles pour ces belles leçons de vie.

Et merci à vous pour ce marathon d’été !

Moralité ; il y a autant d’honneur à demander et recevoir qu’à donner.
Merci  Reiki, merci aux Symboles pour ces belles leçons de vie.

Encore merci à vous pour ce marathon d’été !

Rébellion par la pensée positive. 

L’impertinence du monde exaspère. Est elle est bonne l’exaspération face aux inconvenances du monde ? Pour certains, elle pousse à produire de l’indulgence sous contrainte. Confrontés aux problèmes sociaux, éducatifs, nutritifs, et devant l’avatar qu’est devenue l’horrible industrie de la santé, le monde affiche une telle irréflexion, tient pour nul compte les milliers d’années de sagesse et de connaissances – la démystification de ce qui pourrait être la vraie vie – accumulée dans ses spacieuses bibliothèques…lire la suite.., pour ce monde en souffrance cela ne servirait à rien. Pour d’autre, à l’inverse, depuis leur plus rude enfance ils n’ont cessé d’y voir une injure à l’intelligence humaine. C’est cette injure, empirique, récurrente, qui en exaspère plus d’un. Exaspérés et révoltés, ils astiquent résolument chaque jour un peu plus une arme redoutable en vue d’une ultime révolution ; la bienveillance. Grâce à cette divine haine qui bouillonne dans leur ventre depuis un quart de siècle, en dehors de tout dogme et de toutes religions, ils firent l’effort de se rapprocher de Dieu – le jeune, celui sans barbe, sans visage défini, le joyeux, le présent, le don – et, contraints d’impuissance à changer l’ancien monde, il lui ont demandé de leur apprendre la clémence.

Les omissions des masses dominantes politiquement irrespectueuses, ils ne les prennent pas à la légère, ils ne commettent pas cette insouciante imprudence, seulement, plus les dirigeants vont vers la précipitation désastreuse et honteuse, grossière, plus ils se glissent dans la peau d’un ours magnanime. Sans cette exaspération pondérée d’impuissance à changer les idées des décideurs arbitraires ils seraient restés dépourvus de bonté. L’incurie des ministres, leur désinvolture insolente à négliger la connaissance des sages du Monde entier, percute leur impatience d’un monde meilleur. Cela leur plaît, absolument. Seuls avec leur colère et leur impatience, ils doivent se résoudre à détruire leurs emportements afin de laisser infuser  en eux l’amour du Monde que le lait de leur mère avait versé dans leur cœur d’enfants. Cette irresponsabilité qu’ont les hommes et les femmes pressés de devenir riches et obstinés à le rester inconsidérément au prix du malheur des autres, leur inattention à la voix unanime des poètes les rend furieux. Ils en font, de ce fumier, le plus sûr des engrais ; ils se transforment, s’épanouissent. Sèment sur le monde la même lumière qui les éclaire en dedans. Jusqu’à ce que se dissipent les brumes obscures de ces esprits moisis d’humides chancres, ils feront cela, ils aimeront leur sainte colère.


Reiki-2-deuxieme-degréMerci Dom pour cette belle élévation à la maîtrise ! Merci pour la qualité de ton enseignement et de ton relationnel. Ce stage fait désormais partie des moments marquants de ma vie. Je sens que ma pratique du Reiki va se modifier profondément. J’ai pris conscience aujourd’hui d’une « sphère » de chaleur permanente et intense dans la paume des mains. J’adore ces manifestations sensibles !

Je vais m’inscrire à ta newsletter et initier mes cristaux ensuite !  

Bonne soirée et à bientôt, JL….et ; joyeuse bulle de lumière Reiki !


Bonjour Dom, Je viens de prendre connaissance de ton mail, et viens d’imprimer, tes documents, c’est précieux. Je te remercie encore pour ce très beau week-end qui restera gravé, tout au long, de ma vie, dans la pratique du REIKI 4 !
Tu es un sage, un être de lumière, j’ai beaucoup aimé faire ce stage de Maîtrise avec toi.
Je remercie l’énergie Reiki, et par ma foi le Seigneur, de me trouver sur ton chemin.
J’ai aimé le groupe, l’ambiance, la synergie, et le lieu.


J’ai encore la tête à Cabrières et le coeur dans DKM Tibétain du Reiki 4…

Un petit miracle de douceur, de paix et de lumière….

Merci encore pour ta patience…. de maître.


Merci pour les coordonnées du groupe! 😉

J’en profite pour te remercier encore une fois de cette belle initiation, j’avoue que ça brasse pas mal de choses encore une fois surtout sur un niveau émotionnel, je pense que sksk que je n’avais pas reçu et que tu m’as transmis y est pour beaucoup! 😉 même si ça fait mal, c’est libérateur, alors j’accueille !
Je calerai ma prochaine venue à Montpellier pour participer à une soirée d’échange, se sera un grand plaisir d’y participer 😉

Alors merci merci merci!!!!!

Très belle journée ensoleillée,

À bientôt, P.


Depuis  mon initiation a la maîtrise reiki Usui Tbet, je suis envahie d’une sérénité et d’une paix incroyable. Au bout de quatre jours d »auto-traitement , pour la première fois….. j’aime et  je deal avec mes entités….le tout géré et canalisé par moi…….  Merci DOM…..merveilleux  weekend-


Merci mille fois pour ces 4 jours de stage reiki Karuna ! depuis je ne vois plus la vie du tout de la même façon, je suis très émue et c’est un régal du matin au soir
merci merci merci !!!

Le Karuna j’aurais du dire à ma mère de le mettre dans mon biberon, non ! dans son sein, c’est un nectar.

surprise de découvrir la liberté et la douceur de cette énergie Karuna. Aujourd’hui après ce fabuleux stage je comprend pourquoi j’ai du faire le Usui 3 avant, merci de tes conseils avisés Dom.

super génial ce stage de reiki Karuna ! en rentrant j’avais une patate d’enfer ! je chantais à tue tête dans la voiture, et ça fait 3 jours que ça dure.
moi qui avait peur de chanter avant , merci Dom pour ta patience et ta force que tu m’a transmise.
je ne l’oublierais pas.

Encore merci pour cet apprentissage de la technique du pardon.  Je la pratique de temps en temps et commence à ressentir cette paix intérieure mais je sais que la route est encore longue.


Bonjour Dom!

Tout d’abord à nouveau un grand merci pour ces deux jours formidables et cette fabuleuse transmission! Quel beau moment! Je suis très heureuse que le Reiki t’ai placé sur mon chemin!

Mes anges m’avaient envoyé le message suivant: « nous vous enverrons de l’aide sur Terre sous formes de maîtres et lectures afin que vous puissiez développer vos dons… »

Je les en remercie: te voilà;-)

La route n’est pas finie…j’ai encore du boulot… Et j’espère que tu accepteras de m’accompagner dans mon apprentissage!

…et pour finir, merci pour les contacts;-)

A très bientôt!

merci à toi P. pour ton e.mail,et un grand merci à tous ,pour ce que chacun à apporté au groupe lors de ces deux journées du stage, joie d’echange et de partage d’emotion et d’energie du Cœur !

…..J’ai moi aussi commence à pratiquer et j’ai eut la chance d’avoir vécu coup sur coup ,dans les 2 jours qui ont suivis, plusieurs experiences  formidables,que l’on pourras echanger j’espere sur Skype ou lors de nos prochaines rencontres à la planete reiki,!!!

…..ces experiences don’t je vous parle, m’ont amenées à m’inscrire des à present au stage reiki 2 des 14 et 15 juin prochain.

….comme ont c’etait promis de s’en tenir informés, çà c ‘est fait.

…au plaisir de vous revoir les uns et les autres ,soit sur Skype ,soit ailleurs….à la planéte reiki ,par exemple,lol

Nous avons la chance d’avoir un Maitre  du Coeur en la personne de Dom, et çà c’est une Bénédiction!!!.(.merci Dom pour l’ecoute, ton enseignement et ton Coeur)

bonne soirée et bon w.end à tous!…..bien amicalement


il est tard , mais je viens de vivre des instants emotionnels tres forts en l’espace d’une heure!!..houa!!…..

merci pour la force et la foi avec laquelle tu nous a souligné l’importance du : ICI ET MAINTENANT, l’instant present, ……et de l’ Amour avec un grand A ,don’t tu as commence à nous imprégner!…..voilà, çà c’ est dis.

Pour les emotions, je te les expliquerais de vive voix, ce seras plus facile que sur l, ordi.

A TRES BIENTOT……………merci…pour ton accueil chaleureux,et ta disponibilitée envers chacun d’entre nous. C
juste un petit mot pour vous remercier encore pour ce super week end d’initiation au REIKI2 !!

Au de la de votre enseignement , c’est pour votre disponibilitée et toute cette Energie d’Amour et de Positivitée que vous dégagez tous les deux et qui est contagieuse que je vous dis un GRAND MERCI !….


Merci a vous deux pour ce merveilleux week end riche en émotions


Merçi encore à toi et Isa de ce beau stage, encore une belle étape sur le chemin du Reiki
A très bientôt
Avec coeur



 Suite Stage échanges Mails entre l’enseignant et une stagiaire.

Le 10 octobre 2012 22:25, L. a écrit :Bonsoir Dom !Dimanche soir après ce fabuleux week-end d’initiation, je me suis sentie comme si un rouleau compresseur m’était passé dessus. La même sensation que lorsque je ressors de chez l’ostéopathe mais en beaucoup plus intense. ça bouge à l’intérieur, ça se transforme !Je viens te demander un conseil. F. m’a dit qu’elle se faisait comme une bulle d’énergie le matin en arrivant à son travail. Peux-tu m’expliquer cela ? Comme F. mon travail m’amène à beaucoup me déplacer dans les différents bâtiments de l’établissement dans lequel je travaille. Comment créer une petite bulle qui me suive partout toute la journée ?Encore un merci pour ton accueil de ce week-end. Bonne nuit !


From: dom jeambrun <contact@planete-reiki.fr>;
To: L.fr>;
Subject: Re: demande de conseil
Sent: Thu, Oct 11, 2012 3:17:22 AM

Plus tu vas tracer Ckr sur les chakras à chaque rituel de préparation plus ton système énergétique va se manifester et créer une bulle protectrice. Comme F., tu vas interagir en « T’Imaginant » que tu es entourée d’une bulle de lumière Reiki ( ce qui est parfaitement vrai – aura éthérique) mais le fait de l’imaginer créé une réalité plus dense. Donc dans le travail, tu t’isole 2mn, tu fais le rituel de préparation, et tu trace le symbole sur chaque chakras avec l’intention qu’ils (le symbole et les chakras) te protègent des autres et qu’ils  protègent les autres de toi, en créant une bulle d’amour autour de toi durant tout le service.

Je te souhaite de.
Le 11 octobre 2012 22:24, L.fr> a écrit :

merci pour ce précieux conseil. 
j’ai lu ton mail ce matin ; j’ai donc pu me créer une bulle de lumière pour la journée. À un moment un peu compliqué : hop ! j’ai refait discrètement le signe sur mes mains et tous mes chakras, l’air de rien en pleine réunion. Ça m’a amusé de faire ça discrétos à l’insu des personnes autour de moi et surtout ça m’a permis de voir à nouveau cette lumière dorée qui m’a redonné confiance en moi.
Je dis voir la lumière parce que je l’ai imaginée tellement fort que je l’ai vue  ! !Encore une fois merci. bises. L.
Envoyé par …truc Mail (sur Android)



Une autre histoire d’eau…

Une histoire d’échange de mails suite à un courrier de réservation de stage Reiki 4.


Le 19 septembre 2012 23:02, C.fr> a écrit :


Avez-vous reçu mon chèque et mon inscription pour le R4 du 19/20/21 octobre ?



20 Sept . dom jeambrun contact@planete-reiki.fr

à C.


non, je ne l’ai pas reçu, aujourd’hui mercredi 19/09….

vous l’avez expédié quand?


Le 25 septembre 2012 19:55, C.fr> a écrit :


Avez-vous reçu mon chèque ? Il est parti le 16/09



dom jeambrun contact@planete-reiki.fr

25 sept.

à C.

non, rien. vous devriez faire opposition, s’il le faut je peux vous donner un justificatif de non réception.



dom jeambrun contact@planete-reiki.fr

29 sept.

à C.


je vous ai laissé un message sur le répondeur.

le chèque est arrivé.

tout va bien

bon wend !


j’y ajouterais… »Normalement je devais dormir à Nîmes ou j’animais un stage Reiki 2, mais une batterie solaire à claquée avec l’orage continuel samedi, et lorsque je me suis réveillé après la sieste after-animation-intense, il n’y avait plus de lumière dans la yourte ni dans les cuisines, Yam, notre hôte était au théâtre, je ne pouvais pas rester dans le noir donc je décidais de rentrer à Montpellier, sous l’orage – très beau j’adore rouler dans ces conditions/nuit/éclairs/pluie-dense – et me voilà devant la boîte aux lettres que le facteur avait laissée ouverte au soleil du matin…et à l’orage du soir ! Tout le courrier trempé de chez trempé, avec, vous vous en doutez, votre lettre de réservation, chèque à l’eau, encre délavée. »

La boite aux histoires.


Le 01 Octobre 2012 19:55, C.fr> a écrit :


Je ne suis pas étonnée que le chèque soit arrivé samedi, j’ai traité la situation samedi matin avec HCZN le symbole de distance. Pourquoi je ne l’ai pas fait plus tôt ?

Surement trop de situations à traiter en ce moment… Mais ce qui m’étonne toujours avec le reiki c’est la rapidité et la synchronicité avec laquelle ça répond de quelque manière que ce soit.

Je me dis que les « petits lutins » doivent bien rigoler en ce moment, parce que j’ai des travaux pratiques tous les jours bien concrets. Cela me fait penser aux apprentissages des derviches tourneurs, où l’initié est roulé dans la farine, éprouvé dans ses différentes peurs, raillé jusqu’à ce que l’ego laisse place à sa véritable nature.

Je navigue avec confiance et peur. Ces deux là pourraient bien être sœurs.

17 jours… 21 auraient été plus parlant ! J’ai l’image de la boîte aux lettres restée ouverte battante sous la pluie, de la lettre arrosée et du facteur qui lui laisse encore la possibilité de s’échapper. Mais non, elle est restée. Je me demande si le facteur l’avait pas dans sa poche, attendant le signal pour la déposer !

Un simple voyage postal peut se transformer en épopée. Tout ça pour un chèque de réservation de maîtrise reiki.

Cela ressemble à mon voyage intérieur.

Bien à vous.




De : dom jeambrun <contact@planete-reiki.fr>

À : C.fr>

Envoyé le : Mercredi 3 octobre 2012 13h31

Objet : Re: Reçu

Merci de ce partage ; j’adore ce genre d’histoires intérieur-extérieur-univers, celles des autres autant que celles qui m’arrivent.

En plus vous avez une belle plume.

ça vous dirais que je la publie lors de la prochaine newletter Reiki ? Anonyme.


C.fr) :

OK pour la newletter et le rajout !

C’est drôle de découvrir l’autre côté de l’histoire, vécu par vous l’autre personnage. Il était temps d’arriver….

Il manque le point de vue du facteur, ça me donne envie de l’interroger.

Merci pour le compliment. Moi j’adore votre site, j’aime l’écriture, le ton sur lequel vous parlez du Reiki.

Bonne soirée.







Recette d’élixir de minéraux et d’énergie Reiki !

Dés le deuxième degré de Reiki Usui nous apprenons à utiliser les cristaux de quartz pour amplifier et prolonger les envois de Reiki à distance, autant pour soi dans le passé le présent et le futur, que pour les soins et les marathon Reiki à Autrui. Bien entendu les cristaux de quartz ne se limitent pas à cette déjà si merveilleuse action. En voici une recette d’Élixirs de minéraux !

Préparation d’un élixir Reiki :

Mettre le cristal de quartz, cristal de roche – après l’avoir nettoyer – dans un verre d’eau minérale, eau de source…et Couvrez le – exple : verres « Nutella » à couvercle ! – puis donnez lui du Reiki et l’énergie du ou des symboles au moins 3 minutes – En faisant cela pensez à ce que vous désirez de l’action de la pierre- , et placez-le au réfrigérateur pendant une nuit.
Le lendemain, faites à nouveau 3 minutes de Reiki avec le symbole(s) et il peut être bu ou appliqué.
Appliqué en massages, en onction, pour une plante, dans une recette de cuisine, sur une plaie…ect.

Attention : Certains cristaux par leur composition ne peuvent être mis dans l’eau ou sont toxiques donc ne doivent pas être ingéré ; renseignez vous !!…

Atelier Reiki Chakras Pardon rêves argent et kotodamas.

Les Ateliers Reiki

Les Ateliers Reiki Les Ateliers Reiki
Les Ateliers Reiki Les Ateliers Reiki Les Ateliers Reiki
Les Ateliers Reiki Les Ateliers Reiki  Les Ateliers Reiki
  Les Ateliers Reiki  VOYAGE CHAMANIQUE

Atelier sur le pardon

Atelier « méditer avec les pierres » 2 dates en Avril 2019 !!!

Atelier « Fabriquer votre tambour chaman en pleine conscience »  25  &  26 Mai 2019 !!!

Atelier sur le pardon – pourquoi pardonner ? Quoi pardonner ? Comment pardonner ?

Ateliers sur l’estime de soipour comprendre d’où vient le manque d’estime de soi meme, pour savoir quelle partie de nous nous n’aimons pas précisément et comment y remédier sans prise de tete.

Atelier sur l’argent – comprendre quelle est la réalité de l’argent dans la nouvelle conscience. Aide incontournable contre le mauvais rapport à l’argent, et percevoir l’« argent » avec une pensée agréable.

Ateliers sur les chakrasLes divers ateliers & la physique quantiqueun jour par mois ! Enseignement d’un seul chakra !
Je fais la synthèse de mes 20 ans de pratique sur les chakras grâce aux techniques de Reiki, et la synthèse également de toutes les informations que j’ai pêchées sur une multitude de sites et dans une multitude de livres sur les chakras. Dans tous les domaines. Yoga, Qi Qong, alchimie, physique quantique, anatomie de l’esprit… etc. j’ai lu étudié et pratiqué sur moi, réalisé des soins sur les chakras avec le Reiki, avec les pierres, au pendule, avec les chants thérapeutiques spécifiques au chakra. Mais toujours ma conscience canalisée grâce au symbole de distance Reiki HON SHA ZE SHO NEN. Ce système de canalisation spirituelle apporte la connaissance intuitive.

Lors d’un atelier chakra j’explique, ce que c’est réellement un chakra par la physique quantique. J’enseigne et fais la démonstration, également, de la première loi universelle ; la loi d’incarnation, puis la loi d’attirance, et la loi de cause à effet. C’est de la plus haute importance de connaître ça pour bien aborder l’alchimie d’un chakra.
J’ai extrait ce qui m’a paru essentiel pour notre quotidien de toutes les informations compilées que j’ai trouvées à travers les écritures. Je retransmais les informations à travers mon filtre d’expérimentation personnelle et nous en débattons tous ensemble lors de l’atelier – entre 15 et 20 personnes.
Les retours que j’ai des participants, c’est que cet atelier sur les chakras leur permet d’avoir une vraie connaissance de soi beaucoup plus approfondie, précise, et les informations efficaces pour un changement notable.

Angéologie traditionnelle de la kabbalePour alterner et reposer l’esprit, Il y a au cours des ateliers des moments de pratique de petit Qi Qong, posture de yoga toujours très facile à comprendre à pratiquer et à reproduire chez soi, un mantra, un mudra, et j’offre à chaque atelier la pierre thérapeutique qui correspond au chakra du mois.

Description courte du chakra

 Un chakra est un atome, un atome est une réserve de mémoires, et cet atome attire d’autres atomes ; ce qui veut dire que nous attirons à nous ce que nous sommes.

Ateliers interprétation des rêves et des signes – selon l’Angéologie traditionnelle de la kabbale, tressée avec l’art de la PNL, et avec la linguistique « étude du langage ».

Ateliers d’écriture Reiki – l’atelier écriture proposé au praticien Reiki tous niveaux et toujours sur des thématiques concernant le Reiki – cela varie d’un atelier à l’autre ; soit pour comprendre mieux appréhender un symptôme douloureux, soit pour mieux comprendre les mieux pratiquer une technique ou une pratique Reiki.

Ateliers hebdomadaires de chants sacrés shintoïstes et Kotodamas Reiki – cet atelier vise à utiliser le son du corps afin de faire vibrer les mémoires cellulaires les mémoires de l’ADN. Les sons sacrés Reiki éveillent le potentiel de chacun.

Ateliers interprétation des rêves et des signes chants sacrés shintoïstes et Kotodamas Reiki Atelier sur l’argent