La lumière Reiki au service d’autrui

La lumière Reiki peut paraitre dans la réponse à un service demandé

Aider un adolescent à s’exprimer

​​lumière-reiki-service Le 23 mai 2017 à 14:35   <x………@truc.org> a écrit :

Bonjour Dom, question : comment donner des soins Reiki à un ado qui manque de confiance en lui (mon gamin) ? Sur une  vidéo, dont je t’ai fait parvenir le lien, le conférencier mentionnait la confiance en soi pour les élèves, dans les applications possibles. Si j’essaie de me souvenir de l’enseignement condensé reçu lors de notre WE Reiki 1er degré alchimiste, je dirai : – soin du corps complet, car ça ne fait pas de mal & pour être bien dans sa tête, il faut être bien dans son corps. Puis – soin particulier au niveau des 3 chakras du haut. Ensuite, comme j’essaie d’être appliqué, je consulte les documents reçus et je vois que différentes zones  peuvent être concernées, en fait, toutes les zones du corps ! Aurais-tu des conseils à me donner ? D’avance  merci & bonne journée. X………

– Dom Bonjour X… Pour le manque de confiance ; en soi. C’est pas que ça soit compliqué mais ça va prendre beaucoup de temps. On peut pas régler la confiance en soi en bloc. Il convient de la régler contexte par contexte.

Je te conseillerais de discuter avec lui et de faire une liste ; -énumérer comme une liste de courses les domaines dans lequel il manque de confiance en lui…

exemple ;

– physique, le corps, le visage.

– prise de parole, la voix, les mots, le vocabulaire, (j’aime pas ceci, j’aime pas cela… l’écrire sans juger sans justifier) et surtout sans tenter de rassurer.

– la mémoire, mémoriser les choses apprises et ne pas être sur de pouvoir les retranscrire lors des examens.

– les filles…et oui….c’est la vraie vie.

etc. etc.……… et il conviendra de définir quelle est la priorité et l’urgence : et : choisir l’urgence et ; faire en sorte de trouver le moyen, ou les moyens, techniques de développement personnel, afin de comprendre l’origine de la cause du manque de confiance en soi dans ce domaine trouvé.

À partir de ce moment-là l’intelligence de l’énergie Reiki va agir sur la cause de ce problème et amplifier les efforts faits pour transmuter la problématique.

Le soin

Le soin se fera sur la tête et la gorge en priorité et ensuite tout le corps si possible si nécessaire ou s’il y a le temps, tous les jours jusqu’à ce que ça suffise.

Plus on est précis et plus on obtient des résultats rapidement.

Erreur commise par beaucoup en général c’est le syndrome du miracle ; vouloir tout régler d’un coup.

En attendant, je te conseille de commencer le soin par la prise cosmique durant 15 minutes minimum, puis 15 minutes tête et gorge, et terminer par les reins 15 minutes (qui sont le siège des peurs) tu fais ça pendant une semaine tous les jours et tu me tiens au courant.

X………Merci pour tes conseils sur les soins Reiki pour mon « petit » (qui me dépasse d’une tête) afin d’avoir  une meilleure confiance en lui-même : les soins lui ont permis de libérer sa parole sur ses sentiments et émotions refoulées depuis son enfance, rien de grave en soi mais plusieurs ressentis négatifs vis-à-vis de son environnement et qui ont influencé son comportement, son rapport à lui-même et aux autres. Le fait d’en parler comme tu me l’as conseillé, de s’en rendre compte, de l’accepter = il se sent libéré et voit la vie comme une somme d’opportunités plutôt que comme une somme de contraintes.
Mon avis de non expert : couplé à des exercices d’écoute active, les soins Reiki semblent avoir eu un effet catalyseur et accélérateur de sa propre prise de conscience.
Donc grand merci pour tes conseils et merci au Reiki !

**************************************

Tel maitre tel chien

– X…. Bonjour Dom, j’ai besoin de tes conseils pour aider mon chien qui est souffrance. Comme c’est son pancréas qui souffre, difficile de vraiment savoir., donc toujours preneuse d’aide…j’en saurais plus mardi, avec la prochaine prise de sang…en tout cas, de mon coté je fais tout ce qu’il m’est possible de faire évidemment….tout en « travaillant » ma patience et le lâcher-prise….encore de « belles » leçons en perspective !!!!

– Dom Je te donnes mon avis sur le symptome du mal etre de ton chien mais sur le plan symbolisme ;
Mais ds un 1er temps, je te conseille de méditer. Une fois en posture méditation avec HSZSN et GNOZA activés, regarde au niveau de tes « besoins » comment fonctionne tu avec TON pancréas.

les animaux, domestiqués, signalent les problèmes de leurs « maitres » avec leur langage non verbal ; langage du corps miroir.

tel-maitre-tel-chien

tel-maitre-tel-chien

– 1 – symbolisme du chien 

Les animaux représentent les besoins ; besoins matériels, besoin de nourriture matérielle, et besoins affectifs, les besoins spirituels : les besoins d’être reconnu, besoin d’ètre soutenu.

Coté plus (le pole positif) – Le chien représente la joie de vivre. Il représentent aussi la fidélité, c’est le gardien…

Coté moins (le pole négatif) – le chien est capable d’aboyer, de grogner, et de mordre ; il représentent donc une possibilité, ou une réserve d’agressivité contenue en son maitre.

On retrouve ici la possibilité d’une colère enfouie non guérie au niveau du besoin d’être reconnu, et/ou soutenue affectivement.
Par exple de n’avoir pas eu suffisamment de soutient paternel ds la petite enfance et voir adolescence….

Un autre aspect à ne pas négliger c’est que le chien est excessivement dépendant. Il peut donc représenter une forte dépendance affective qui entraîne un manque de joie de vivre une tristesse profonde lorsqu’il y a un manque, une solitude…..

– 2 – symbolisme des causes possibles des problèmes du pancréas

Anxiété, angoisse, ressassement, mélancolie, obsessions tournées vers le passé, besoin de correspondre aux normes, de respecter les règles, peur de manquer, de ne pas être à la hauteur

Ça peut être aussi l’expression de manque de joie de vivre, d’une tristesse profonde en lien avec une blessure de non reconnaissance ou encore d’abandon.

cela peut aussi avoir été provoqué par un sentiment d’injustice.

Ça peut être aussi la conséquence d’une grande colère, d’une révolte, face à une situation récente ou ancienne que l’on n’accepte pas et qui nous fait vivre un profond sentiment de non respect de trahison. 

X…..merci, merci, merci !!!
j’avais justement commencé à réfléchir et à regarder tout cela aussi… effectivement, j’ai bien compris, il y a quelques mois que je devais aller creuser plus profond, que ce moment était venu pour moi…et depuis, justement, je travaille sur mes blessures et aussi toutes mes peurs…par contre, maintenant, j’ai aussi compris que je devais y aller en douceur, 1 par 1…cette leçon là est bien intégrée !! lol…du coup, j’ai bien des vieux trucs qui remontent, mais je les gère un peu mieux …
je te confirme donc, que tout ce que tu nous enseignes et nous dit, n’est pas vain !!! et que ça porte bien ses fruits …
Merci pour tout !!!

**********************

Maitre Reiki sur Facebook

je viens de visualiser une photo ; ton souvenir face book ; je viens de prendre conscience. je savais que l’autre est mon miroir mais plus les hommes de mon entourage proche ne semblaient pas me convenir et plus je travaillais sur la femme que je suis(en fait sur ma femme intérieure, )et non sur mon homme intérieur ..:  
voila pourquoi je me sentais bloquée; comme quoi une simple photo et ses commentaires ! Merci d’etre sur FB.

Dom Jeambrun facebook & planete reiki facebook, rien à cacher.

***********************

Ancrage Enracinage

– R…..j’avais lu ceci –ci-dessous, j’ai retrouvé le passage –  sur votre site il y a quelques semaines, et avec le temps, certains propos ont été un peu déformés dans mon esprit. Plus mon interprétation personnelle…donc, vous n’avez pas écrit qu’il faut être enraciné avant de faire ce genre de formation. Cependant je trouve qu’un passage peut tout de même prêter à confusion. C’est sur votre page d’accueil, concernant les méfaits du reiki :

« dans tout travail avec l’énergie il faut un solide enracinement à la terre – à la réalité, au réel – et le reiki ne fait pas exception. Les hommes sont en général plus en danger que les femmes qui elles par leur instinct maternel sont plus en contact avec la réalité. Alors que les hommes, on le sait par les horreurs et les erreurs de l’histoire et de l’environnement, ils confondent la réalité avec l’imaginaire poussé par le besoin de pouvoir, besoin de contrôle, et se perdent facilement dans les chiffres de leur imagination utopique. »

et vous finissez par cette phrase (qui peut laisser penser que l’ancrage par le 1er niveau de reiki n’est pas suffisant… C’est du moins ainsi que je l’ai ressenti) :

« pas étonnant que beaucoup d’hommes, recevant l’initiation à la maîtrise reiki se prennent ….tout à coup pour de vrais maîtres… »

-dom…merci de vous ètre donné le temps de me répondre avec cette précision.

En fait, j’avais écris ce post suite à un long entretient (par mail) avec une personne très pressée d’aboutir à la réalisation de soi et qui voulait faire tous les niveaux reiki le plus rapidement possible.

En effet, il y a des gens qui sont assez mal ds leur peau, et qui croient, ou qui veulent, régler tous leurs problèmes d’un coup, grace à « l’énergie ».

Ce genre de comportement est dangereux, ou peut ds certains cas etre dangereux pour eux. Le résultat risque d’etre assez proche de celui de la décompensation. 

Je m’explique ; les problèmes n’étant pas résolus (peurs, phobies, angoisse, sous estime de soi ) puisqu’ils enchainent les exercices ou les stages sans prendre ni le temps de pratiquer ni d’intégrer, alors l’énergie élève le mental au niveau de la conscience élevée, mais d’un coup, sans entrainement – à l’inverse de comme le font les yogis, et les praticiens Reiki correctement formés ; un niveau après l’autre, en écoutant son propre rythme et en respectant les limites du corps. L’impatience est un mur. La patience est un confort.

Donc c’est la mm chose pour des personnes qui passent tous les degrés Reiki rapidos et se bombardent maitres sans avoir travaillé en profondeur sur eux ; ils ne peuvent transmettre que ce qu’ils sont et seulement ce qu’ils ont pratiqué eux mm. C’est de ce non ancrage là que je parlais ds le post que vous avez lu. Et grace à vous, tout ces détails je vais les ajouter sur le site ! Vive les échanges ! Ils m’enseigne un peu plus chaque jours. 

D’autres gens sont pressés , sur la route, ds ls affaires, dans les discutions, dans l’éducation…ect, on connait le résultat de l’excès d’impatience, on sait ce que ça peut donner n’est ce pas…!?

Pour en revenir à la réalité du 1er degré Reiki ; il n’est pas nécessaire d’etre « ancré/enraciné » pour faire le stage et pratiquer car l’énergie ne « montera pas d’un coup », parce que  l’énergie Reiki est l’intelligence de l’univers, donc elle respecte chaque individu, c’est pour ça que le Reiki est une énergie douce, non manipulable, subtile mais avec ses effets parfois étonnants de guérisons et de changements. 

En faisant le stage Reiki 1er degré, les 4 initiations espacées ds le stage, plus les exercices pratiqués en groupe avec les retours que je fais à chacun, plus la mise en pratique du symbole ésotérique et ses applications, plus l’enseignement des 5 idéaux du Reiki tout le long du stage et la guidance sur le symbolisme que je fais en accompagnant chacun durant les 4 jours, et le livret qui retrace tout ça……c’est ce tout, qui va constituer le départ de votre encrage/enracinage, avec en plus, de nouvelles façons de penser plus agréables.
Et vous pourrez compter sur moi si besoin est après le stage, le suivi fait partie de l’éthique du maitre Reiki.

****************************

Effets bizarres Reiki !?!

résistance_au-lacher-prise-Reiki

résistance_au-lacher-prise-Reiki

– Dom…c’est un des effets Reiki qui arrivent de temps en temps, dont j’ai parlé pendant le stage… mais il y a tellement d’informations pendant un stage…

Tout d’abord ; n’arrête pas le Reiki sur toi-même ni sur les autres, car ce symptôme est encourageant, symptôme de guérison.

Tout en faisant un soin Reiki sur toi médite ; repasse en revue tout ce que tu pensais pendant que tu donnais le soin à ton amie ;

– quelles étaient tes pensées ?

– Est-ce que tu voulais qu’elle ressente quelque chose ? Est-ce que tu avais peur qu’elles ne ressente rien ? Est-ce que tu avais peur qu’elle ressente des mauvais effets ?

– Toi-même est-ce que tu as craint de prendre des mauvaises choses ? Est-ce que tu as craint d’être fatiguée, de t’épuiser ?

– Est-ce que tu te demandais si tu étais vraiment efficace ? Est-ce que tu pensais qu’en tant que débutante Reiki premier degré tu n’as pas encore la capacité de la soigner ?

….ect…

Avec ce genre de pensées inconscientes, certaines personnes, sans s’en rendre compte, utilisent leur propre énergie pour faire les soins ! Et comme elles ne sont pas magnétiseuses aguerrie…
C’est ça qui se passe : ton propre magnétisme que tu as utilisé dans ces cas-là en bloquant partiellement l’énergie du Reiki.

Le Reiki c’est l’amour inconditionnel, et le Reiki va laisser faire la personne, te laisser faire, pour que tu apprenne quelque chose sur toi-même comme c’est le cas aujourd’hui…

Avec toutes ces questions toutes douces, inconscientes, des pensées automatiques qui ont fait que tu te se sens fatiguée pendant plusieurs temps après. Et découragée.

Lorsqu’on fait un soin Reiki à quelqu’un on se prépare correctement avant, comme tu as appris en stage, on nomme ça RITUEL de PREPARATION.
Ensuite on pose les mains, on lâche prise et on sourit, on laisse couler le Reiki, de temps en temps on active le symbole et on sourit ; et surtout on ne fait rien, on ne demande rien pour la personne.
Prends bien note de ceci ; on ne souhaite rien pour la personne !
Ça peut paraître égoïste, mais ça serait de l’illusion de croire que c’est égoïste. Pourquoi ? Parce que le Reiki ne nous appartient pas et lorsqu’on fait du Reiki à quelqu’un on laisse couler le Reiki et c’est le Reiki qui fait, ce n’est pas nous, ce n’est pas toi ; c’est une histoire entre le Reiki et la personne.

Moins on en fait et plus le Reiki est efficace et plus on est rechargé soi-même. 

Et penses y, après un soin Reiki boire un grand verre d’eau.

Une autre réponse possible : Il est possible qu’en ce moment dans ta vie tu ais besoin de repos, et peut-être que tu as un projet, ou que simplement pour aller de l’avant, pour avancer, aller au travail, ou autre activité,   peut-être que tu te sens un peu découragée, les jambes lourdes, fatiguée pas motivée….. et que le Reiki ai activé ces mémoires là, pour te dire  » regarde tu as besoin de repos et de te remotiver »…C’est ce que l’on appelle se prendre en main, en toute sécurité en se faisant du Reiki au quotidien, et en en faisant aux autres en lâchant prise et en souriant.

  • Fais toi une séance de rééquilibrage des chakras et pendant ce temps médite sur ces questions……et tiens moi au courant. Amicalement. Dom

– K….Merci pour ta réponse .

Effectivement, pendant le soin j’ai souhaité que cela fonctionne et qu’elle se sente mieux .

J’espère retrouver rapidement vitalité car j’ai le corps qui est épuisé.

Belle journée 

K……

*******************

Délais entre stages

​​ Le 19 mai 2017 à 15:25, <f……@gmail.com> a écrit :

-F…. Je suis devant mon ordi et tombe par hasard sur les photos de notre formation KOMIO … bon souvenir … alors j’en profite pour te faire un petit bonjour du cœur !

…et te dire que je ferai le niveau 2 à l’automne vers le 20 novembre de mémoire…

attente-patience-impatience-stages-niveauxPar ailleurs… je ne peux pas faire le stage niveau 2 le samedi et le stage niveau 3 le dimanche : je dois me mettre en attente, attendre le printemps pour le stage niveau Reiki Komyo 3 c’est bien ça ? Mais je ne suis pas impatiente…

J’espère que tu vas bien et passe le bonjour de ma part à ceux que tu croises à tes ateliers de partage ! Au plaisir de te lire, Amicalement, F….

– Dom…Bonjour F…oui effectivement, le stage niveau 2 est quand même assez conséquent et il convient d’attendre entre six et neuf mois pour passer le stage niveau 3, le temps que les énergies les symboles et les techniques que tu vas utiliser fasses leurs effets sur le mental l’ego et la conscience, et patiemment vivre agréablement l’intégration des changements – changement lié aux effets Reiki pour toujours plus de bonheur pour toi et pour les autres – mais faut prendre le temps de changer les habitudes, même si le Reiki aide à cela… on a jamais rien fait de bon dans la précipitation. même avec le Reiki Usui Komyo ! Je te garantis qu’avec le niveau 2 du 25 novembre tu vas te régaler !

Symbole de la gorge et le troisième degré Reiki

 

Le Symbole de la gorge peut il etre transmit dés le troisième degré Reiki ?

Symbole de la gorge

Un chat dans la gorge ? ou s’exprimer

Symbole de la gorge et le troisième degré Reiki Usui Shiki Ryoho
Komyo Kai et Komyo Do

Au cours de ce premier semestre 2017 lors d’un stage troisième degré, une des stagiaires, que j’ai initiée jusqu’à la maîtrise Reiki, et qui enseigne elle-même, révisait le troisième degré pour son perfectionnement professionnel. Elle nous a fait part d’une chose assez dure. Que j’ai pu lire sur les documents qu’elle avait collectés pour me les montrer et me demander mon avis. Ce qui nous a permis d’en débattre au cours de ce stage troisième degré Reiki.
J’écris cet article pour essayer d’équilibrer les choses. Comme dans toute profession, dans toute corporation, il y a des débordements de toutes sortes et c’est inévitable. Ce que j’ai lu m’a offusqué aussi. Certains enseignants Reiki écrivent dans leur manuel technique du quatrième degré, la maîtrise Reiki Usui, des paroles pas respectables du tout sur les autres enseignants Reiki qui ne font pas les chose à leur manière à eux. Ma stagiaire était peinée, dans un état de colère, de rage et je la comprends.

Ces enseignants Reiki qui pensent que les autres devraient faire exactement comme eux disent en gros ceci ;  « les Maîtres Reiki qui transmettent le symbole de la gorge au troisième degré alors qu’il ne se transmet qu’au quatrième degré commettent une erreur grave dont les conséquences peuvent aller très loin. » Sans toutes fois dire où elles vont ces « conséquences »….

Ensuite ils se contredisent  « la vibration du symbole de la gorge : CKS, ne fonctionne pas à l’initiation du  3ème degré et ne peut fonctionner qu’en étant initié avec les autres symboles uniquement au 4ème degré, uniquement lors de l’initiation à la maîtrise».
Très drôle.

Ce qui veut dire qu’il n’y a absolument aucun risque de le transmettre au troisième degré puisqu’il ne va pas fonctionner… !!!???!!!… vraiment très drôle.

Je pense que les enseignants Reiki qui ont écrit cela devraient se regarder bien en face dans le miroir et s’avouer franchement qu’ils ne l’ont pas testé sur eux-mêmes, pour écrire de telles inepties. Ce n’est pas fini, je continue. Je le fais fraternellement par solidarité envers tous les autres enseignants Reiki qui transmettent ce symbole au troisième degré. Allez-y sans crainte, je le fais depuis 20 ans, et chaque fois mes stagiaires en sont pleinement satisfaits et dans une immense gratitude envers le symbole et envers ma manière d’enseigner.

Ces enseignants Reiki affirment écrivent et signent qu’ils ont fait une enquête car ils se sont quand même posé la question… lol… de savoir si c’était efficace ou pas de transmettre ce symbole CKS au troisième degré… lol again… évidemment ils écrivent, et dans leur manuel de maîtrise en plus ! une réponse qui va uniquement et exclusivement dans leurs sens  « toutes les personnes ayant reçu ce symbole au troisième degré l’ont trouvé intéressant, mais après il ne fonctionnait plus du tout et ne leur avait absolument rien apporté »… comme c’est bizarre, comme ça les arrange ; ils n’auraient dans leur enquête questionné que des personnes – ils écrivent toutes les personnes qui – pour qui ce symbole n’aurait pas fonctionné. Je vois là une autre raison de leur conseiller de se regarder en face dans le miroir, sans broncher, et de vraiment poser leurs questions à leur enfant intérieur, à leur femme intérieure « est-ce que ton masculin intérieur a utilisé vraiment le symbole de la gorge CKS en profondeur pour cultiver la tolérance ? L’altruisme ? La connaissance intuitive ?… ».

Évidemment, vous vous en doutez, je vais écrire l’inverse.
Je me suis remis en question avant de commencer à transmettre ce symbole au troisième degré. Évidemment. C’est au-delà d’une question d’éthique, plutôt une question de responsabilité professionnelle personnelle qui n’a rien à voir avec la lignée. J’ai reçu ce symbole en initiation lors de ma formation à la maîtrise ce qui veut dire que j’ai passé la maîtrise d’enseignement. Ce qui veut dire que je suis apte à enseigner. Ce symbole m’a été transmis pour communiquer avec mon enfant intérieur et avec mon guide Reiki le plus élevé. Et je ne me suis pas gêné de le faire tous les jours depuis 20 ans. Le résultat est que très souvent, avant de faire quelque chose de nouveau dans mon enseignement ou mon quotidien, et bien c’est mon guide qui me le propose avant même que je lui demande. Comme transmettre ce symbole au troisième degré au lieu de le transmettre au quatrième degré uniquement, ce fut une intuition, suivi d’une demande si c’était juste ou non de le faire. Posez-vous la question suivante « pourquoi et comment, par quel heureux hasard Dom Jeambrun s’est-il posé la question, pourquoi a-t-il posé la question à son guide «  qu’est-ce qui manque le plus dans notre nation à l’heure actuelle ? ». Cette question là.

Je me suis souvent posé la question de savoir pourquoi je me posais des questions, et très souvent, c’est l’énergie et la présence de mon guide en concomitance avec mon enfant intérieur qui grâce à l’énergie de CKS m’ont amené à me poser la question « est-ce juste que je transmette CKS au troisième degré ? »… D’autant que je m’en souvienne, j’ai reçu la réponse sous la forme d’un ressenti. La réponse, je l’ai reçu par mon corps. Un ressenti, une vibration Reiki. et je me suis dit je fais l’expérience sur trois stages Reiki troisième degré avec le symbole de la gorge CKS. Après chacun de ces 3 stages Reiki 3ème degré je demanderai aux stagiaires ce qu’ils en ont pensé. Et bien sûr j’ai eu des réponses par mails, par textos, et de vives voix lorsqu’ils revenaient aux soirées partage ou aux ateliers chakras ; toutes et tous m’ont remercié et ont remercié le symbole car ça leur a permis de mieux exprimer des choses difficiles à dire. Il y a même une chanteuse qui avait peur de chanter – pourtant c’est une professionnelle – et sa voix, son audace ont été décuplées. D’autres par contre – peu en fait – ont eu peur de l’utiliser – ce qui n’est pas la même chose que d’écrire que ça ne fait rien du tout d’avoir ce symbole au 3ème niveau Reiki – peur de l’utiliser car il pressentaient qu’ils allaient, soit devoir dire ce qu’il n’osaient pas dire jusque-là, et qu’ils préféraient encore se taire. Soit qu’ils allaient devoir vivre leur vie en fonction des conseils de leur guide et/ou de leur enfant intérieur, et très particulièrement laisser leur féminité s’exprimer – ceci qu’ils soient hommes ou femmes – et ça, ils en avaient peur. Mails ne le surent que lorsque je leur ai posé la question « Alors ? et CKS ? ».
Recevant le symbole de la gorge CKS au quatrième degré, maîtrise Usui, ces mêmes personnes auraient eu aussi peur de l’activer. Mais si on leur avait posé la question,  ils auraient sûrement dit que oui, ça marche, sans trop savoir quoi au juste je suppose, fondu au milieu de la totalité des neuf symboles du quatrième degré.

Évidemment il y a plusieurs façons de transmettre un symbole, il y a plusieurs façons d’enseigner le Reiki. Il y a l’enseignement basic, technique. L’enseignement du livre aussi. Hélas également l’enseignement où l’on ajoute un tas d’autres choses autres que l’essence du Reiki, faire du remplissage.
Et il y a l’enseignement du vécu, c’est-à-dire ceux qui ont pratiqué en profondément sur soi les techniques et les symboles du Reiki, et continuent de les les pratiquer régulièrement dans leur quotidien, dans leur vie de tous les jours.

Personnellement j’ai une chance inouïe, j’ai un long parcours d’artiste sculpteur peintre comédien metteur en scène et styliste, et je rends grâce au symbole CKS car il m’a permis de briser les limites de la créativité et d’atteindre assez rapidement les sommets que je visais dans ces domaines respectifs ; exposer dans la cour des grands. Tout un cheminement, double ; Art et Reiki. Une pure merveille.
Une fois que je suis arrivé à ce sommet avec la sculpture, tout s’est écroulé. Les trois dernières grandes expos auxquelles j’ai participé n’ont rien donné de bon pour moi. Mis à part quelques articles de presse glorifiants mais inutilisables au niveau bancaire. Après un petit temps d’abattement je me suis centré, je me suis connecté avec le symbole de distance HSZSN et avec le symbole CKS – qui permet entre autres : de mieux écouter, et d’obéir, ou de mieux comprendre le bien-fondé de l’intuition si vous préférez – et grâce à ce symbole j’ai compris que j’avais terminé mon incarnation dans l’art. Et que la voie m’était désormais ouverte uniquement pour me consacrer à l’enseignement complet du Reiki. Complet veut dire pour moi l’imprégner de ce que j’enseigne autour du Reiki. Des stages et formations, sous la formule ludique d’ateliers ; l’alchimie des chakras, le rapport à l’argent, au pardon, à l’estime de soi, à l’analyse des symboles et des émotions, et les lois de l’univers dont la loi d’incarnation et les lois de cause à effet… j’ai donc obéi ; j’ai soldé la grande collection de mes sculptures et mes toiles, ça à fait de la place dans ma vie dans ma tête dans mon cœur et dans mon KI. La place du Rei.

Je continuerais avec joie et en pleine conscience de transmettre le symbole CKS au troisième degré. Je certifie qu’il est amplifié en passant le deuxième degré Karuna avec les symboles GNOZA et IAVA. Et je peux même dire que c’est bien d’être initié avec ce symbole de la gorge dés le 3ème degré ; pour apprendre à mieux écouter, à mieux parler, à mieux créer, à mieux prier le guide Reiki et à lui obéir sans avoir besoin de preuve qu’il a raison, ceci avant de passer le quatrième degré Reiki, la formation à la maîtrise. Si on veut vraiment enseigner assidûment, c’est une lourde responsabilité.
Les symboles GNOZA ET IAVA permettent de se réapproprier les droits divins de ses propres opinions et expressions littéraire et artistique, créativité et perfection distinctive. Un droit qui est perdu à la naissance avec le système éducationnel dogmatique. Et à ce sujet je précise ceci ; les initiations Reiki et les symboles troisième degré USUI et les symboles du deuxième degré Karuna ont un but bien défini ; grandir et s’élever intellectuellement et spirituellement. Quant au quatrième degré, la maîtrise Reiki, il n’a à mon avis qu’un seul but ; travailler profondément sur soi pour s’élever et grandir intellectuellement et spirituellement. Ceci pour devenir un jour son propre maître. Bien malin celui qui saura dire le nombre d’années qu’il faut pour être son propre maître… ça peut arriver en une année, 10, 20, 30, 40 années ou plusieurs vies. C’est à mon humble avis, avant tout une histoire d’expérimentation de la connaissance de soi.

 Malheureusement ces deux niveaux de Reiki sont très souvent enseignés l’un uniquement pour soigner, et l’autre pour initier autrui. Mais rarement, voire pas du tout, dans la détermination farouche à se métamorphoser et à se transmuter soi-même par de puissantes et très intéressantes remises en question. Ce qui fait que pas mal de praticiens, quelque soit leur niveau Reiki, restent parfois dépendants de leurs « maîtres Reiki ». Dépendants à l’autorité de ces derniers. Ne faisant pas du tout confiance à leur propre intuition, à leur propre autorité. Peut etre n’ont t ils pas pu, ou n’ont ils pas réussi à faire l’apprentissage de l’autorité du guide Reiki par l’usage du symbole CKS. Qu’ils aient reçu le symbole de la gorge CKS avec ou sans les symboles de Grand Maître Tibétain, au troisième ou au quatrième degré, qu’importe. Ce qui détermine une incarnation solide et altruiste va être la conséquence d’un travail sérieux et profond sur les trois niveaux de la conscience ; l’esprit le cœur et le ki (les besoins). C’est de ce travail que va découler la forme de l’enseignement, forme pratiquée, qui sera alchimique, ou dogmatique.

De toute façon chacun est libre de faire comme il le sent comme il le veut et comme il le peut, on prend le risque ou on ne le prend pas. Zatis ze kouestionn.

Les enseignants Reiki, ceux là même qui montrent du doigt ceux qui ne font pas comme eux, vont jusqu’à écrire sur leurs manuels techniques – que j’ai eu en main grâce à ma chère stagiaire révisant le troisième degré Reiki qui m’en a apporté plusieurs, merci à toi pour ta récolte , et ta révolte –  écrivent que nous qui transmettons le symbole CKS au troisième degré, nous le faisons pour  obtenir plus d’argent… tu parles d’une sagesse Reiki pour écrire un truc pareil !!!!…

Surtout lorsqu’on sait que le symbole CKS agit sur le chakra de la gorge, et que c’est le chakra de la parole… et qu’en tant qu’enseignant Reiki on devrait au moins connaître cet accord Toltèque   « que ta parole soit toujours juste et ne fait jamais de suppositions »… mais je m’autorise à rebondir là-dessus ; et si c’était l’inverse ? Et si c’était ces gens-là qui auraient peur que ‘leur maîtrise Reiki à 1800 € et des miquettes’, devienne moins attrayante avec un symbole de moins ; sans le symbole de la gorge ? De quoi ont ils peur pour écrire ça ?
Quoi qu’ils fassent, nous serons de plus en plus nombreux à le transmettre au troisième niveau. On appelle ça le changement. Et la vie a horreur de la stagnation mais adore le changement. Il suffit de regarder la météo et les arbres pour cela.

Ce manuel de technique Reiki niveau quatre dont je parle, est bien évidemment d’une qualité technique irréprochable, car comprenez que je ne parle que de cette anecdote que je qualifierai d’agressive, voire même une tentative de manipulation pour conserver un certain pouvoir. Uniquement le symbole de la gorge CKS. Et toujours rapport à cette anecdote,  j’ai pu lire aussi « on ne doit absolument jamais changer un protocole d’initiations ». Oh stupeur ! Oh tremblement ! – autorité abusive… !??!!… je me demande.
Alors je me permets d’activer le symbole de la gorge CKS et en toute innocence, je pose cette question ; et de quel droit ? Et surtout, pourquoi ? Et je sais d’avance pour l’avoir expérimenté cette question  « pourquoi ? » avec certains de ces enseignants, que les réponses qu’ils me donneraient… et bien ils n’ont pas de réponse juste. À peine des arguments personnels sur un niveau mental. Ce qu’en Reiki s’appelle des dogmes.

On me l’a enseigné dès le premier niveau Reiki et répété ensuite sur les autres degrés Reiki ; il n’y a aucun interdit, aucun dogme dans le Reiki. Et c’est particulièrement pour cette raison merveilleuse que je l’aime. Et que j’aime le transmettre tel que mes guides me le suggèrent au fur et à mesure de mon cheminement spirituel.

Dans l’histoire du Reiki Usui il y a deux protocoles bien distincts ; celui de l’école de Phyllis Lei Furumoto, et celui de l’école de William Lee Rand, créés aux États-Unis. Je suis persuadé que déjà Hawayo Takata, qui, ayant transité par son pays natal le Japon où elle a apprit le Reiki avec Hayashi, puis revenue dans son pays d’adoption  Hawaï, et enfin premier Maître de Reiki arrivée aux États-Unis, je suis persuadé qu’elle a modifié le protocole d’initiations. Mais jamais personne n’ est arrivé à prouver que ce soit. Qu’importe. Donc deux protocoles d’initiations différents ; Furumoto et Lee Rand. Les deux fonctionnent parfaitement. Ensuite il y a le protocole de John l’Hermitage qui a créé le Reiki Shamballa, dont j’ai été initié à la maîtrise et qui fonctionne parfaitement. Ceci dit je ne l’enseignerai jamais. Tout comme le système ‘Energie Universelle’, complètement différent du Reiki avec des protocoles d’initiations bien opposés. Les protocoles d’initiations Reiki Karuna ensuite, créé par w. Lee Rand, protocole complètement différent des deux premiers et du Shamballa, et qui va très bien lui aussi tout en étant complètement différent. Je les connais puisque j’ai été initié aux 2 maitrises Karuna.  je les enseigne tout comme j’enseigne et initie à tous les niveaux le protocole d’initiations Reiki Komyo Kai Reiki Komyo Do. Ils sont encore complètement à l’opposé de tous les autres protocoles Reiki et ils fonctionnent à merveille bien entendu.
 J’ai personnellement expérimenté de mixer parfois des protocoles d’initiations, je les ai expérimenté sur plusieurs niveaux de stages, j’ai expérimenté ce mixage à tous les niveaux 1, 2,3 et 4, et tout fonctionne parfaitement. J’ai la réputation de ne jamais faire les choses à la légère. Je m’en voudrais trop pour cela et si je vois que ça ne fonctionne pas je ne refais pas. Et après ces expérimentations de modification de protocole, plutôt de mixage d’expérimentations diverses expérimentées par d’autres humains avant moi comme l’ont fait d’autres humains avant eux, je suis revenu dans la salle de cours et j’ai demandé à chacun des élèves de raconter dans le détail ‘qu’est-ce qui s’était passé pendant l’initiation, qu’est-ce qu’ils avaient ressenti, et qu’est-ce qui s’était passé en pratiquant de suite après les initiations’. La conclusion est tout à fait positivement merveilleuse, et là encore comme dans chaque stage il y a toujours une ou deux ou trois personnes qui ne ressentent rien en pratiquant le Reiki la première fois. Et certains même ne ressentent jamais que très peu, et pour ça vous lirez à la fin de l’autre article que j’ai écrit dans cette newsletter une petite fiche sur l’éducation violente, et je pense que de ne pas ressentir les énergies Reiki ça viendrait de là. En grande partie du moins. Et quoiqu’il en soit, tel que je l’ai appris lorsque j’ai passé la maîtrise d’enseignement Reiki, à chaque fois que je change quelque chose dans l’enseignement d’un stage je préviens les stagiaires, en disant que cela vient de moi et non pas de ma lignée, et qu’ils ont le choix de me suivre ou de ne pas me suivre.

Je préfère avoir les réponses par l’expérimentation plutot que par l’abus d’autorité et de pouvoir venant des autres. Ça suffit avec tout ce qu’on nous impose  la politique et le commerce industriel, on peut songer ici à ce protocole de 11 vaccins en tentative d’imposition… je suis fier d’être arrivé aujourd’hui à être mon propre maître et je me félicite du travail sur moi accompli durant ces plus de 20 années et je souhaite à chacun d’en connaître autant, et bien plus encore. Pour le plus grand bien de toute l’humanité. En arriver là ; ne plus dépendre de qui que ce soit d’autre que de ma femme intérieure, de mon enfant intérieur et de mon guide spirituel Reiki. L’assurance d’une transmission toujours juste car souvent accompagnée d’une prise de risque. Un enseignement sans prise de risque est à mon avis un enseignement limité. Tout comme pas mal de lois qui nous régissent encore aujourd’hui à tous et qui datent de Napoléon Bonaparte. Que juristes magistrats et politiciens imposent en disant qu’il ne faut absolument pas changer ces lois. Pour connaître la réponse posez-vous la question « où va l’argent ? ».

Voilà ce que m’a appris le symbole merveilleux CKS ; être soi-même, en connexion avec l’enfant intérieur, avec la femme intérieure et avec le guide Reiki. Et je construis la triple personnalité.
 Et avec les anges pour ceux qui pratiquent l’Angéologie de la kabbale.

Le symbole de la gorge CKS agit sur le chakra de la gorge, sur les cervicales et le cou, sur les épaules, les bras les coudes et les mains – donner et recevoir – et que l’énergie du chakra de la gorge c’est ; la générosité, l’altruisme. La générosité de la parole, la générosité du chant, la générosité de l’écriture, la générosité de la créativité et l’ obéissance aux lois divines, l’obéissance à la voix intérieure, l’obéissance à l’intuition. En un mot n’écouter que le cœur.

Mais pas du tout l’obéissance aux dogmes de qui que ce soit.
Merci CKS. Tu vas très bien avec DKM 3ème degré.

La Newsletter Reiki de Février les partages Reiki du Languedoc Roussillon

Les nouvelles locales du Reiki ; aujourd’hui la Newsletter de Février

Les nouvelles locales du Reiki

QUESTIONS RÉPONSES REIKI

un échange, un partage.

Les Questions Réponses Reiki, FAC, un échange avec les praticiens Reiki, Usui Karuna et Komyo Kai.
Une Question = des Réponses.
Nous ne sommes sur terre que pour apprendre, pas pour réussir.

Et c’est idiot, vraiment, de punir les erreurs et les fautes dans les écoles et dans la vie. Car c’est grâce à elles que nous apprenons. …mais tandis qu’on enseigne et pratique la voie de l’unité d’autres exigent la réussite à tous prix.  C’est le culte de la réussite qui est à blâmer, pas l’échec.

 

Faire le Deuil

– G : Juste un petit mot pour te dire que la soirée chant des Kotodamas au dojo d’hier m’a fait le plus grand bien (bon je m’en doutais qd même!)! J’ai pu enfin dormir correctement…. 

– Dom : ouf ! merci le son sacré du Reiki Kotodamas et Shinto !

– G : au matin ; un rêve étrange: mes dents bougeaient comme si elles allaient tomber (celles du bas, devant) mais quand je les touchais elles étaient bien solides… 

– Dom : ton guide t’as envoyé un beau reve ; ça signifie que quelque chose de bon (changement) bouge en toi ; au niveau spirituel – le blanc des dents – et dans la matérialité ; dents du bas, la terre.
ça bouge et ça tient bon !

– G : J’ai lu aussi la prière de ton livret de stage Reiki « cultiver l’estime de soi », elle a bien raisonné en moi… je l’ai relu ce matin et j’ai chanté les 5 principes fondamentaux du Reiki et ma voix était plus ample, plus claire, plus affirmée! 

– Dom : merci, merci de venir suivre les ateliers Kotodamas du mercredi soir, de te lire m’encourage dans mon investissement à retransmettre.

– G : J’ai encore de la tristesse, de la colère et de la rage pour y…. qui m’a fait espérer quelque chose pour rien mais ces émotions sont moins intenses avec la pratique quotidienne.

– Dom : c’est tenace les sentiments, surtout ceux là car il y a de l’affect……vis les, mais dans le but de faire le deuil, et surtout pas de t’en débarrasser mais peu à peu tu arriveras au détachement.

– G : J’ai à nouveau l’envie de bouger, de m’ouvrir, doucement…

Merci à toi et merci au Reiki de me donner cette chance inouïe d’ouvrir les yeux sur moi et de guérir mes blessures!! 

– Dom : ce que j’enseigne, c’est du Reiki d’occasion ; testé sur moi avant de retransmettre, et approuvé  !!!!
******************

Odorat

Le 7 décembre 2016 à 14:44, A….. <s….@outlook.fr> a écrit :

Bonjour Dom, Aujourd’hui je t’écris car j’ai une question pour moi. Cela fait depuis vendredi que j’ai mal à la gorge et depuis samedi que je n’ai plus de goût ni d’odorat. Même les odeurs fortes qui me dérangent d’habitude, je ne les sens plus (aquarium de fumée de cigarette chez mes patients par exemple). Normalement ce sont des symptomes qui passent en 2 ou 3 jours grand maximum pour ensuite laisser place au rhume mais là ça persiste. Est ce que tu aurais une petite astuce sachant que je me fais déjà un soin complet reiki tous les jours de 45min environ ?Je te remercie par avance.

Dom – Bonjour A…

Je v tenter de te répondre en terme de symbolisme d’abord.

– L’odorat : peut signifier une perte d’intérêt ou un interdit pour les plaisirs des sens, ou encore une perte de joie de vivre. Ne plus se donner le droit au petit plaisir de la vie.

-* As-tu perdu ta joie de vivre ? dans un domaine ou un autre….?

*- T’ês tu  interdit pour une raison quelconque de profiter des plaisirs de la vie… ?.

-* As-tu été souvent soumise à des odeurs désagréables ? Si c’est le cas la perte de l’odorat est simplement partielle et ne durera pas, ne devrait pas durer.

– Le goût : c’est l’organe relié au deuxième chakra : concerne le coût de vivre, le goût des choses, le goût de la vie…

– on retombe là sur les mêmes questions que sur l’odorat, à peu près.

Les douleurs de la gorge :

– sont souvent associés à la peur de s’exprimer, ou à une émotion de colère exprimée et qui est regrettée).

– La douleur à la gorge peut être associée à la peur d’être ridiculisé ou encore de blesser quelqu’un par nos paroles.

Ces douleurs que je décris sont des douleurs sans inflammation c’est-à-dire sans angine. Si jamais il y a inflammation, genre angine, la question à se poser c’est : ai-je ravalé més mots plutôt que d’exprimer la colère qui m’habitait ?

Voilà de quoi réfléchir, de quoi rentrer en toi, un beau cadeau pour apprendre à mieux te connaître ! Continue à te faire du Reiki, de préférence en commençant par la prise cosmique 15 minutes. Et fée toi du Reiki bien sûr à la gorge, au chakra racine (l’odorat le nez) et au chakra sacré (la langue le goût).

Et n’hésite pas à demander aux personnes que tu connais de t’envoyer du Reiki !
Amicalement. Dom

***************Reiki Usui Komyo Kai

Merci pour les adresses mails et les photos de ce beau stage 2ème degré Komyo Kai.

Depuis le reiki komyo 2 le nettoyage est profond et intense, et en même temps je me sens solide et en totale sécurité, comme un arbre pleinement ancré à la Terre. 
Tous les jours mon corps est courbaturé, comme s’il était trop petit pour moi, comme ci j’étais devenue géante ! Les auto soins m’aide beaucoup. 

La semaine dernière j’ai fait 4 soins, 2 en présence et 2 à distance, qui se sont présentés « par hasard »  Les personnes étaient satisfaites, et je me rends compte que je lâche encore plus prise qu’avant. quant au résultat, je laisse faire l’énergie, je ne suis qu’un canal. Jamais je n’ai senti autant de puissance, de façon aussi fluide et instantanée ! Déjà qu’avant c’était intense mais alors là je suis subjuguée. 

Merci du fond du cœur pour tout ce que tu m’as transmis avec le Reiki Komyo Kai.

*************

Bonjour Dom,

comment vas-tu? Ici tous se passe pour le meilleur. Encore MERCI pour ce SUPER stage et que tu m’avais ecrit ces mots, qui mon motiver de venir au stage !
Aussi ton livret Reiki est super, j’aime lire tes experiences personnelles, cela me fait beaucoup comprendre.

**************************************

Merci beaucoup pour ton super conseil ; on voit le bon maître !

Maintenant, lors des soins (j’ai bien repris aussi sur moi), je cite la prière des symboles avant de les dire 3 fois, et, quel bonheur…

Dès que j’ai procédé de cette façon, j’ai senti une énergie !!!

Je sais que c’est ton travail et que c’est naturel pour toi de conseiller, mais grâce à tes conseils personnalisés, on peut mieux avancer ; surtout que je n’avais pas vraiment réalisé que je les disais sans les comprendre ; des fois, il me faut du temps et un peu d’aide (heureusement que tu es consciencieux) pour assimiler ce que je trouve évident ensuite.

***************

merci à toi Dom, pour ton enseignement, ta bienveillance et ta patience. Merci à ton tambour de m’avoir emmené si loin et si profondément en moi. Merci pour ton hospitalité et ta créativité qui a si bien remplie ta maison de couleurs. Et merci pour tout ce que j’oublie de ce merveilleux week-end…..les bonbons, le thé, l’encens………..et le marché aux puces !!!!
J’aurais sans doute, bientôt, mille questions à poser…pour le moment je laisse mon corps s’équilibrer, mon esprit se poser et mon cœur savourer. Je te souhaite une fin d’année lumineuse. S….

**************
– je veux remercier le REIKI toi meme et tout le groupe car grace a vous je peux demystifier la peur qui depuis plusieurs annees bloquait ma voie chantee et parlee, cette peur avait une influence dans mon comportement   encore merci  merci merci    A…. 

S….- tout comme mon epouse merci pour ce stage qui m a apporté beaucoup je pense que je trouverai mon guide que je n ai pas vu ce jour la   mille fois merci a   toi et a tous  
Dom -Merci mes amis pour ce beau retour « en duo » !
Je connais les effets quelques fois perturbateurs du Reiki, Pas toujours simple à vivre car ces effets agissent sur les plans émotionnels,, mais ils ont toujours dans le sens de la libération, vers une meilleure connaissance de soi, toujours pour avoir une meilleure façon de penser, un plus grand plaisir de penser, et progressivement être véritablement au service de la lumière, la vraie celle qui éclaire et non plus celle qui éblouit et engendre la peur d’avancer.
*******************karuna

et voili….tu as réussi à me mettre la larmes aux 3 yeux….cette parole juste, juste ça merci….le coeur touché qui pleure au bout du fil…

Dom – c 7 amour là, la compassion. Et passer à l’acte, l’acte d’aimer, 7 ça KARUNA.
Huggggg
********

karuna

Le 31 octobre 2016 à 08:37, a……<l@gmail.com> a écrit :

Bonjour,
Quelques News depuis que l’on ne c’est vu…. il y a longtemps …

Bon Zonar aujourd’hui ok je signe, griffonne ok meme pas peur…
Ah mes menstruations…. au bout de deux mois…. tiens ! j’Aurais travaillé sur ma féminité ?… rire…Zonar encore ok et la tout s’aligne…
J’attrape les impôts je confectionne le courrier laissé à l’abandon…
je bois un truc je repense au livre l’eau et le feu que tu nous a conseillé…
Et je vois un truc… avant karuna je n’avais pas connu le vrai amour je crois.
La vrai compassion ; et la je tel à mon père,  il répond décalage horaire…. il gueule je lui dis merci il se calme je lui dis que le passé ne dois pas nous empêcher d’avancer et je ne sais pas pourquoi je ne lui parlais plus depuis 20 ans…
Il pleure il dit « j’attendais un signe merci ».
On raccroche et j’enchaine,  j’apprends mes cours sur le système nerveux de merde qui me gonfle ….trop facile….
Merci Reiki karuna, merci Maitre

*****************************************

Vente Maison Reiki à distance !

Salut Dom, journée bien remplie au boulot j’ai même pas pu te répondre! Je voulais juste te raconter une petite histoire reiki qui m’est arrivée ce week end!
Nous avons mis en vente notre maison depuis le mois de mai, mais nous ne pouvons la vendre que en janvier 2017, nous nous y sommes pris assez tôt mais c’était pour voir la tendance. Nous avons eu beaucoup de visites mais sans accroches précises. Voyant l’échéance arriver j’ai fait un petit papier reiki pour la grille Reiki 3ème degré….il y a une semaine et comme par hasard vendredi j’ai eu une visite qui a accroché direct, ils sont revenu dimanche et ont signé avec l’agence! Trop fort merci l’univers!

****************************

Ch…. a besoin de pratiquer le Reiki, n’a pas d’amis, et comme il passe souvent chez moi pour tout et rien je lui ai proposé de me faire une séance et la ! il m’avait répondu qu’il n’était pas à la hauteur…. bref…..  c drole… ; je constate ce que me dit un jour mon Maitre Shinto ; « tu enseigne, mais n’atends pas que l’élève comprenne ».
D’ou l’intéret du Dojo Reiki fonctionant en porte ouverte ts ls jrs….

*********************************

Je ne le sais que trop…. ton avis est toujours porteur de bonnes choses et bizarrement je l’accepte avec bonheur! Y serais tu pour quelque chose ? Oh que oui…..   ma sérénité retrouvée. ….. plus de sentiment de culpabilité. ….. Maître Dom à changé ma vie ! 
J’ai pris un peu de temps pour moi…. 
Gratitude et bises….E…

**************************

Merci à toi également pour tout ce que tu nous as apporté, j ‘ éprouve une immense gratitude depuis le stage, envers toi, envers le groupe, envers le Reiki et l ‘ Univers et….Choses totalement nouvelle, envers moi même…Les émotions se bousculent à chaque pratique depuis le stage et parfois même lorsque je ne pratique pas, sans comprendre ce qui m » arrive, c’est merveilleux de se sentir à un tel point vivant même si parfois un peu trop puissant à canaliser pour le moment.A très bientôt pour les ateliers, amicalement.Ma….

*******************************Je te remercie pour ton hospitalité et pour ce très beau stage. Je te remercie aussi de M avoir réconcilie avec le reiki. Je trouve que le nom du groupe concernant ce stage est tout à fait approprié et la photo est magnifique.

*********Il y a vraiment un avant et un après. La semaine a été compliquée professionnellement (comme pour beaucoup d’entre nous), mais des réflexes se mettent progressivement en place. Pour le ressenti général, pas de pleurs, sauf parfois une indéfinissable tristesse vite évacuée avec le travail reiki et CKR sur les chakras, mais beaucoup d’excitation et pas toujours dans le bon sens (100 000 volts), comme si un petit diable essayait en vain de prendre le dessus…Aujourd’hui, plus de sérénité et une confiance en la pratique quotidienne. Le chemin est encore long, mais je sais qu’il mène à un immense océan … 

Tu tisses un lien, ton enseignement est clair, sobre et tout en profondeur, l’ancre est jetée. Merci ! 

Il me faut continuer, savoir passer d’une façon spontanée et sereine de la planète Reiki aux autres contraintes du quotidien, choisies ou subies, dompter le mental et prendre le recul nécessaire en pleine conscience. 

Alors à très bientôt Dom, je t’embrasse bien fort, prend soin de toi, nous avons besoin de toi.

*********************​​

Bonjour Dom, 

J’attendais d’avoir une semaine de recul afin de  t’envoyer un message de mon ressenti pour ce stage Reiki 1er degré du 5/6 nov dont j’ai bénéficié. J’avais une appréhension de ne pas ressentir certaines énergies et donc de ne pouvoir pratiquer cet art, ces soins.

J’ai beaucoup apprécié la manière dont tu inities cette pratique du Reiki. Veronique G. et toi avez  une simplicité vous êtes rayonnants et plein d’énergie!!! Merci!!!

J’ai un peu de mal à prendre le temps pour faire mes soins au vu de mon organisation quotidien. Et pourtant, j’en ressens le besoin!!! Jusqu’à présent j’y suis arrivée, 1 heure par jour!!! Mais par moment, je ne me sens pas totalement dans ce que je fais! Mon esprit vagabonde, je dois me recentrer sur cette énergie. 

Dom – C’est ta nature, c’est le cheminement que ton mental avait besoin jusqu’à présent. Le mental il faut le respecter et l’accueillir, le questionner, l’écouter avec beaucoup de tendresse et d’amour pour pouvoir lui répondre avec force et douceur. lui montrer qu’aujourd’hui tu es adulte forte et capable, et peu à peu il cessera d’être capricieux colérique et frustré.

On ne le répétera jamais assez ; la pratique des cinq Gokaïs le soir et le matin plus réciter la prière de la culture de l’estime de soi tous les soirs à voix haute avant d’éteindre la lumière – elle se trouve vers la fin du « Manuel Planetre Reiki niveau 1 ».
ça et une pratique quotidienne de l’auto traitement Reiki « entre 10 minutes et une heure » associée à des lectures qui élèvent l’esprit « à la place de la télé », c’est la recette idéale pour attirer le bonheur, et le bonheur n’est autre que la paix intérieure.

Paix intérieure qui ne peut être que relative à chacun.

Donc je respecte ton rythme, accueille, lâche prie et souris en pratiquant !

Peut être aussi un manque de confiance!!! 

En suivant cette recette du Qi Qong : la pratique du Reiki, du symbole, des Gokaïs, va progressivement réveiller ta confiance en toi, c’est absolu.

**************

M..P…-  On n’a rien sans rien et il est important pour  moi de pouvoir m’épanouir dans cette philosophie, cet art de vivre que tu enseigne. Depuis le milieu de semaine je me sens plus vulnérables que d’habitude. Penses-tu que ça ai un rapport?

Dom – Oui, c’est en rapport : c’est un symptôme de guérison : parce que le Reiki te mets dans un « état d’âme » afin que tu puisses ressentir ta sensibilité et ta vulnérabilité, car ce sont les choses que le Reiki a trouvées que tu refoulais derrière une carapace et qu’il est tant maintenant que tu es initiée, de prendre en charge, t’en libérer. .

Si on est sensible, fragile, vulnérable, et si on le cache à tout le monde et à soi-même, et bien on ne vit pas, on survit,, ce qui veut dire qu’on n’est pas « en soi » qu’on n’est pas ancré, on est au-dessus de soi en suspension : survie = sur, et non pas dans = en vie.

C’est le moment ou jamais de t’ouvrir et de parler à tes proches de ta vulnérabilité, de ta sensibilité, car c’est en en parlant, en le verbalisant que tu aura forcément un écho. Et écris !!

Le Reiki fait parti de la nature et la nature a toujours raison, elle est toujours précise, elle ne se trompe jamais.

M..P…-Merci pour tes mails remplies d’infos. Merci de ton partage.

 

******************************L’argent !

Bonjour Dom,

Merci pour cet atelier sur le rapport à l’argent vivant et émouvant. Ce matin, en me réveillant, une image m’est envoyée. Une porte s’ouvre, je suis sur le seuil d’une pièce remplie d’objets. Il y en a des vieux, des récents, impossible de voir leur fonction. La seule chose, c’est que je les vois de façon différente. J’ai compris grace à cet atelier que c’est une nouvelle façon de voir, ce qui s’est passé, ce qui est maintenant et Ce qui arrivera. (j’ai compris pourquoi j’avais les yeux un peu larmoyants le matin …)

Dom – ça pouvait peut etre venir de frustrations non pleurées….non dites, non exprimées…..ces frustrations t’empechaient d’etre Toi….

*****************************

il faut dire que tout m’a connecté à vous, je m’explique: il y a 3 jours je me réveille et le mot Juvignac me vient en premier, je me demande pourquoi et vais voir où se trouve Juvignac puis j’oublie…ce matin je commence mes recherches pour un 3eme degré, je tombe en premier sur votre site…j’ai pas cherché plus loin.

************************

l atelier chant sacré au Dojo Reiki de Juvignac me tente , chanter n est pas une evidence pour moi donc oui, je peut m offrir cette zone d inconfort hihi, je te tiens au courant. merci de ta presence, j avais demander un  » soutiens » pour faciliter le chemin et tu est la, merci  d etre toi, tes ateliers me sont d un grand soutiens, me permette de m ouvrir encore plus , merci …Aloha 
*****************************

A chaque degrės c’est comme si j’etais a cloche pied depuis toujours et que je trouvais enfin la marche ou m’appuyer…

Comme si j’etais chanteuse et que tu m’apprenais avec un amour infini comment placer ma voix pour qu’elle se libere et donne tout son potentiel…

Alors Merci pour cet enseignement si sincere et bienveillant !

Merci Reiki, Merci la vie, Merci Dom 🙂

***************

Il n’est pas un jour où l’initiation REIKI ne fasse pas surface. Face à un doute, un questionnement, une réponse tombe sous la forme d’une de tes paroles, enseignement, expression, posture et même silence. Tu constitues une richesse infinie dans mon cheminement de vie.
Infiniment merci

*****************************

J ai eu mon résultat cette apm je suis prise pour ma formation  d aide medico psychologique. Le reiki à vraiment transformé ma vie positivement avec le travail sur moi même. 
Il me tarde de reprendre les ateliers chants sacrés au Dojo !
Maintenant que ma formation est en place je vais me lancer aussi pour donner des soins.
*************************
– I… : J’ai pratiqué le Reiki sur mes animaux, très contents apparemment, attitude digne presque solennelle comme s’ils comprenaient (je leur demande avant…). J’ai une petite chatte qui a le sida, elle est depuis devenue très belle, s’est remplumée et a le pelage brillant (les gens l’ont remarqué, car moi je n’oserais…non, le doute s’est fini…).
J’ai du mal à proposé à l’humain, mais hier j’ai eu une demande….

-Dom : com’ par hasard…..!?!

Questions réponses Reiki, un échange, un partage.

Les Questions Réponses Reiki, FAC, un échange avec les praticiens Reiki, Usui Karuna et Komyo Kai.
Une Question = des Réponses.

question-reponse-FACNous ne sommes sur terre que pour apprendre, pas pour réussir.
Et c’est idiot, vraiment, de punir les erreurs et les fautes dans les écoles et dans la vie. Car c’est grâce à elles que nous apprenons. …mais tandis qu’on enseigne et pratique la voie de l’unité d’autres exigent la réussite à tous prix.  C’est le culte de la réussite qui est à blâmer, pas l’échec.

Octobre 2016

Kyste, hématome, les fesses…

Le 5 avril 2016 à 18:25, N…….> a écrit :

N – Depuis mon 3ième degré, ….il y a eu l’opération du kyste ovarien le 30 par célioscopie. J’ai eu quelques jours où j’étais  comme endormie, je ne réalisais pas que la vie m’envoyait des signes à décoder. Mais hier tout (enfin énormément de choses) s’éclairait, m’apparaissait. C’était un enchaînement sans fin. J’avais l’impression d’être noyée. Noyée: plusieurs heures après être remontée dans la chambre j’avais demandé si on pouvait enlever le carré de protection des draps car je me sentais très mal et sale. Quand je l’ai vu je me suis dit: c’est carrément un bain de bétadine! Déjà 2 idées liées: bain et noyade. Et après tout c’est enchaîné. Ovaire gauche, ablation d’un kyste, hématome énorme autour du nombril. Sans exagération, il a la taille de ma main avec les doigts écartés, l’infirmière en est restée scotchée. 2 ou 3 jours après, ma cicatrice d’appendicite c’est retrouvée elle aussi au milieu d’un joli bleu. Allergie sur la fesse droite, urticaire, démangeaison. On peut peut-être ajouter le refus de prendre une infirmière pour les piqûres plus que je me les fais moi-même alors que je n’en avais jamais fait. Je pense que j’ai fais à peu près le tour. C’est comme si la vie m’avait dit que je pouvais maintenant enlever ce kyste car je pouvais, j’étais capable, je devais… assumer, affronter, me libérer… Je n’arrive pas à mettre un mot précis pour décrire ce que je ressens. Bon je ne vais pas me relire pour ne pas changer les phrases et laisser tel que c’est venu. Je ne sais plus par quel bout y prendre. peux-tu m’aider ?

Dom – Je peux t’aider en le faisant comme si c’était pour moi-même. Personnellement je fais du Reiki et je laisse couler, mais pendant ce temps je demande à mes groupes Reiki niveau 2 niveau 3 niveau 4, à tous je leur demande de m’envoyer du Reiki à distance en leur précisant de demander au Reiki de M’aider à comprendre « quelles sont les causes dans l’esprit qui créent ces conséquences dans le corps physique ». 

Pendant ce temps je fais de la méditation sur un seul symptôme à la fois !
Par exemple ; un kyste ; c’est une boule de peine.
Comme un petit flocon de neige que tu vas pousser pousser rouler rouler rouler qui deviens une boule. Une pensée, que tu tournes en rond, que tu rumines, d’année en année et qui finit par devenir un boule qui suinte (liquide = émotions) . On l’appelle un kyste. 

Boule de peine : tendance à toujours se passer le même cinéma intérieur. 

Comme ce sont les ovaires, cela représente ta féminité. Ce kyste à l’ovaire est une réponse à une douleur de perte, ou d’une grande déception, concernant ton pouvoir de création (enfants OU projets). Il peut s’agir d’avortement, de la mort d’un enfant, une séparation, de la mort de son enfant ou de la difficulté à enfanter ou à mettre en route un projet qui te tient à cœur, ou qui t’a tenu à cœur. Parfois on voit passer des années et on peut craindre de ne plus pouvoir avoir d’enfants ou un second si tel est le souhait…

Est-ce que tu te désoles parce que tu n’arrives pas à devenir enceinte ou à  réaliser un projet qui te tient à cœur ? 

  • Mets cette phrase présente avec un quartz : « je me réjouis de ma féminité. J’adore être une femme. J’aime mon corps. » ou suis ton intuition.
  • … Encore une autre,  tu peux faire les deux ou alterner « je me réjouis d’être qui je suis. Je suis une merveilleuse expression de la vie, qui coule parfaitement et sans cesse. »

Les fesses : représentent le pouvoir ; s’asseoir sur son trône. Elle peuvent représenter aussi l’inactivité, le repos ; allez pose ton Q, souffle respire médite… détend toi. 

Dans l’allergie urticaire, la démangeaison à ce niveau-là, à mon avis, représente quelque chose qui te tarde de faire, (ou tu insupporte d’être oisive à l’hosto)  ou te tarde d’avoir ton propre pouvoir, ou alors de t’asseoir de te reposer…

L’urticaire par contre serait liée à une personne de ton entourage qui t’énerve qui t’agace et qui n’était pas prévu qu’elle serait comme ça et qui devient supportable ; toujours concernant le symbolisme des fesses. 

Hématome (de savoie… lol…) : c’est une accumulation de sang suite à un choc ou un accident et sont donc reliés à de la culpabilité puisque l’accident s’est de l’autopunition/autodestruction. Comme l’hématome se situe au niveau du ventre, du nombril : le plexus solaire ; la personnalité. À mon avis il doit y avoir une culpabilité concernant les causes des kystes ovariens… tu me diras si ça te parle. 

Tu es en période d’initiations et ces symptômes ressortent parce que le Reiki te dit qu’aujourd’hui tu es prête pour les régler. Avec des années de retard à rattraper. Les deux phrases que je t’ai données devrais être efficaces ; en envoie à distance pour toi-même, et la première en traitement mental jusqu’à ce que tu sentes que tu deviens toi-même. Dans cette vie, dans cette incarnation tu es venu dans un corps de femme ; ton devoir spirituel, ta mission divine est d’incarner la femme dans tous ses états. Même si cela doit passer avant par des réparations. C’est pour cela que la première phrase correspond tout à fait. En acceptant que le Reiki te donnera des leçons, d’autres choses à nettoyer, ton chemin va alterner entre ronces pelouse pâquerettes, des plages ensoleillées et des orages, pour aboutir finalement un jour ou l’autre dans la réalisation de toi-même ; en accord avec les lois de l’univers, dans l’amour la joie et la satisfaction.
Dom
************************

Migraines récurrentes

Suite à la séance consultation sur mes migraines à répition et ta façon d’orienter ma façon de voir et de penser, j’ai pris quelques jours et j’ai décodé des fonctionnements de cause à effet et une grosse migraine qui m’a clouée au lit hier pour la journée a confirmé ton diagnostic.
Merci pour ton éclairage…

*****************************
REVES

J’ai encore fait un rêve cette nuit avec mes voisins. Je te passe les détails, mais à la fin, j’ai ressenti (dans le rêve et pour de vrai) de la compassion pour ma voisine qui avait un petit problème physique, je l’ai écoutée et rassurée, et je l’ai vue repartir en marchant sur le trottoir en face de celui où j’étais, elle était toute guillerette, contente que je m’intéresse à nouveau à elle, et dans de très bonnes dispositions à mon égard…. Ça devient bon !!!  merci pour ton éclairage !

********************
Retour de stage KARUNA
je veux te remercier de tout mon cœur pour ce fabuleux stage karuna…..je sens kil s’est passé kelke chose en moi d’extraordinaire….comme un sentiment d’avoir trouvé les clés ki ouvrent tous les cadenas de mon ètre (j’en ai des frissons en te le disant !!!)…les symboles karuna et leur signification me parlent énormément…différemment du reiki usui et du reiki komyo Kai….comme si je venais de trouver LA solution !!!!
d’habitude kan je rentrais de stage le soir, je me posais et après j’attendais le lendemain pour me replonger dans ce ke nous avions vu….et hier soir, non !!! je me suis posée, mais j’ai senti ke je devais me rapprocher des symboles de suite…comme une urgence….et avant de m’endormir, j’ai eu une image : tous les symboles karuna étaient derrière une porte fermée, en trépignant d’impatience…alors, je leur ai ouvert la porte et ils se sont mis à danser, comme pour montrer leur joie…..et ce matin, je me sens très bien, différente, apaisée et heureuse…prète à démarrer ma semaine avec Z….avec l’impression, ke tous les symboles reiki Karuna font déjà partie intégrante de moi….c’est génial !!! un énorme MERCI!!!!

******************************

Un merveilleux retour de stage d’initiation 3ème degré Reiki Usui Kai

 » Reiki , 3e degré, journée 1

J’ai vécu une journée extraordinaire samedi, peut-être plus intense que l’initiation au 1er degré.
Je n’entrerai pas dans le détail de la formation par elle-même. Ayant approché de si près la connaissance et la puissance des symboles, je comprends mieux maintenant l’intérêt du Mystère.

Retrouver Dom est en soi une belle expérience. Sa présence même nourrit notre âme, et son enseignement, donne sens à la vie, à la mienne en tous cas. J’espère de tout cœur (et j’y mets du reiki 😉 ) atteindre un jour ses connaissances, son humilité, son sens de la compassion.
Les grands hommes sont rares, c’est un bonheur d’en croiser un sur son chemin.
Retrouver Cabrières, la yourte et ce cocon de verdure sièges de tant d’initiations, c’est comme pénétrer dans un entre-deux mondes magiques, c’est ouvrir une parenthèse spirituelle.

Arrivée là est déjà une mise à nue bienfaisante.

Ce troisième degré est une redécouverte des précédentes expériences.

Dom y aborde l’aspect spirituel du reiki plus profondément, alors qu’il ne fait que semer quelques graines lors des degrés précédents. ET j’ai enfin eu un tas de réponses qui m’ont apaisées. J’aurais voulu  dire : encore, encore ! il y a tant à apprendre !!
Premier symbole, première claque. Très vite, je m’aperçois que je le dessine presque d’instinct. Il coule de source, familier, c’est un bonheur. Là où tout fut laborieux au second degré, tout devient fluide et évidence.
Nous apprenons à le tracer sur papier , puis devant nous et sur nous.
Lorsque je la trace sur ma gorge, j’en ai le souffle coupé. 

Une porte s’ouvre, j’ai l’impression d ‘avoir reçu un coup de poing en pleine figure.

Dom me demande « ca va ? »… j’ai du mal à répondre et à reprendre mes esprits « oui, … Ca arrive …». 

Il me faudra de longues minutes pour me remettre de ce premier choc, à tel point qu’à quelques minutes de  l’initiation, j’ai un peu peur. Vais-je y arriver ? Suis-je prête ? Et si je rentrais chez moi, là, tout de suite ?? lol !!

Tracer les deux nouveaux symboles sur papier et dans l’air éclairent la présence et la puissance de ceux déjà reçu précédemment. 

Leurs sens respectifs se confirment, dans une douce alchimie, j’ai l’impression de tous les réapprendre et me les réapproprier.

Ce troisième degré est une évidence, une révélation. Pas d’attente avait dit Dom, mais pourtant, que de résultats !!

L’initiation se passe en douceur. Je suis surprise à un moment donné car je sens une présence derrière moi, un peu sur la gauche. Cette présence m’absorbe, je pense que c’est Dom, mais non, il est là devant moi, il vient de me prendre les deux mains ! Alors qui était là, tout proche ? Cela restera un mystère.

J’ai les yeux fermés et un symbole m’apparait brutalement. Derrière mes paupières, impression noir sur fond blanc, il est puissant, un « oh ! » silencieux m’envahit. Le temps que je comprenne, il disparait. IL m’a marquée, il raisonne encore , même maintenant. 

C’était la première fois que je vivais ça. Je ne connais pas ce symbole, même si une partie de moi sait qu’il est familier. Il ressemble à un autre, et pourtant ce n’est pas le même.
La douche de lumière m’envahit, je suis bien, et Dom me dit que je peux ouvrir les yeux. Déjà ? Mais ça vient de commencer il y a quelques secondes ??
Où étais-je donc tout ce temps ? 😉
Ensuite je travaille sur moi, dans la yourte, je me nourris, c’est la première fois que le Reiki coule aussi fort en auto-soins. Toujours cette sensation d’une évidence, d’un voile qui se lève.
La première méditation avant le repas me plonge dans un premier ravissement. Ce n’est plus de la lumière qui coule en moi, je Suis la lumière, j’en suis la source, canal et émetteur à a fois, quelle puissance, mais en même temps, quelle douceur.
De nouveau ce sentiment écrasant d’évidence et d’être à ma place, là où je devrais être, en communion étroite avec mon moi intime et l’Univers.
Il est dur de revenir de cet état de transe transcendentale, même pour aller manger !! 
Le premier exercice après le repas redémarre doucement. Entre temps , je suis redescendue sur terre, et puis c’était tellement formidable que je pense ne pas pouvoir retrouver cet état de nouveau. Mais on trace DKM dans nos mains, et là, la lumière explose et grandit de nouveau, c’est juste « ouah !!! » Bein oui, quels mots mettre là-dessus, c’est impossible, c’est juste un nouvel état d’Etre que j’ai découvert ce jour là. Le reste de la journée avance, je baigne dans la lumière, je plane, je règle une douleur d’oreille, et j’entends enfin ce que je ne voulais pas. Ca fait mal. Au cœur. Aux tripes. Et le soulagement vient.
Merci reiki, merci J. , merci Dom !

Troisième méditation, puis Dom nous fait ensuite  pénétrer dans la yourte pour une méditation guidée pour rencontrer notre guide le plus élevé en Reiki.
J’avoue que je suis assez dubitative, je ne vois pas encore trop comment ça pourrait être possible, et puis, je baigne déjà tellement dans la lumière que je n’attends plus rien de plus. M
ais je fais confiance, je suis les consignes avec application et je lâche prise. En fait, l’initiation m’a mise en condition, je baigne dans le reiki, je dois le secréter par tous les pores de mon corps !!nIl suffit donc d’activer les symboles et de suivre la voix de mon Maître Reiki.

Je me  retrouve d’abord à marcher le long d’une plage, au bord de l’eau. Très vite, la végétation apparait sur ma droite, touffue, prolifique, et je me vois pénétrer dans une forêt tropicale. Je suis les indications de la voix qui me guide. Je m’immerge dans les sensations, j’avance pieds nus, je sens la mousse sous mes pieds, sur le chemin.
J’atteins la clairière, avant même que Dom ne le dise, je l’ai aperçue.
Je m’approche de la cabane qui s’y trouve et j’observe la lumière qui filtre au travers du bois.
Comme demandé, je pousse la porte.
La cabane est vide, très sombre.
Immédiatement, s’y dessine une silhouette : Un bouddha d’or, qui se construit sous mes yeux émerveillés, l’image délicatement ciselée d’or et de lumière.
Mais au même moment, Dom me dit de voir le symbole reiki, je chasse donc cette image de Bouddha, elle n’a rien à faire là!
Une deuxième fois, l’image se construit devant moi, de la même façon, indépendamment de ma volonté. Je suis perplexe, ce n’est pas ce qui est prévu, ne suis-je pas censée  voir le symbole reiki demandé?
Alors je chasse de nouveau le bouddha, et je façonne le symbole reiki avec ma volonté.
Il estt nettement moins puissant que mon bouddha de lumière.
Avec du recul, je me dis que j’aurais dû laisser venir ce qui s’offrait à moi, mais j’étais comme dans une transe profonde, incapable de résister à la voix qui me guidait là-bas, dans la yourte.

Je quitte donc la cabane pour découvrir l’arbre, un peu plus loin, par derrière . Cet arbre a une forme indéfinissable, ondulante, rayonnant de lumière , arbre primordial, sans doute, qui m’évoque l’expérience du grand Pin d’Akhéna.
Sa forme change pendant que mon cerveau tente de lui donnait forme, mais il résiste à mon analyse, je suis face à l’Esprit Arbre. L’énergie qu’il dégage est douce et puissante à la fois.
Puis, comme Dom l’indique, quelque chose sort de derrière l’arbre.
Je m’attends à une silhouette, une forme humaine, avec appréhension et curiosité, enfin !!!
Mais c’est un condensé de lumière qui s’avance vers moi, sans forme, ni visage. Je me sens alors emportée loin, dans un espace très gris, uniforme, sans mur, ni repère visuel.

Dom nous propose de demander son nom à notre guide.
Chose que je fais, avec impatience, bien sûr !
Je reçois une réponse teintée d’humour, de douceur, de connivence, un clin d’oeil à nos rencontres astrales précédentes au cours desquelles il a souvent joué à cache cache avec moi.
Une réponse affectueusement moqueuse : Il ne me donnera pas de nom, il restera « Guide ». Dans le même temps, je perçois que ce n’est pas si important.

Je sens alors que je secoue la tête, dans mon corps physique, dans un « non » silencieux, je ne me sens pas prête à ce qui va suivre, pas à la hauteur de ce qu’entrevois. J’ai peur.
Je reçois un message de lumière, sans mot, sans parole, un message d’amour, de reconnaissance « sa fille » me reste comme impression, et le sentiment que j’appréhenderai le message plus tard, que ce message se grave en moi et que je n’ai pas besoin de le conceptualiser maintenant.
J’entends au loin Dom qui nous propose de demander un cadeau à notre guide, et un message pour progresser d’avantage en Reiki.
Je me sens alors étreinte de douceur et de lumière, et je reçois un message en parole pour la suite des évènements : »laisse faire, aies confiance ». 
A regret, j’applique les consignes de retour, je ne veux pas le laisser partir, je me sens déjà orpheline. Je me détache pourtant doucement de lui, deux entités lumineuses fondues l’une dans l’autre qui se séparent. Mes bras de lumière tentent de le retenir, et le chagrin me serre le coeur en y repensant maintenant. J’ai  l’impression fugitive de deux espaces temps qui se rejoignent puis se séparent.

Dom nous  demande d’emprunter le chemin du retour dans la forêt, et je ressens nettement mon corps de lumière qui réintègre le corps physique sur le sentier. Je pleure là bas, dans la yourte, puis je reviens à moi, en ouvrant les yeux. Les larmes coulent un bon moment après ça.
Chacun retrace son vécu de l’expérience, les récits sont différents, mais chaque récit m’éclaire sur ma propre expérience.
Je passe la soirée chez une amie dans un état second, connectée à la lumière, entre rires et larmes car chaque émotion, chaque mot, chaque moment est exacerbé. Et je regagne mon lit vers minuit pour m’effondrer de fatigue et de bonheur !!

************

Maitrise Reiki Usui Kai 
Merci Pour ces 3 jours riches en emotions et sensations uniques!!!..Merci de m’ avoir permis de parcourir tout ce chemin et de m’avoir prepare à cette nouvelle vie!! Accepte toute ma gratitude,pour cela et pour ton écoute permanente et ta façon de nous guider avec humour et bonne humeur!!! Merci ,à l ‘ UNIVERS, de m’avoir permis de vivre cette experience exceptionnelle de la Maitrise….une  BENEDICTION.
AMITIES….C

********************
Je ressens une vive émotion en pianotant sur mon clavier pour t’écrire que c’est une Grâce qui m’a été accordée que de te rencontrer afin d’être initié jusqu’à la Maîtrise. Je ne mesurais pas jusqu’à quel point il fallait être investis pour initier à cette merveilleuse Energie du Reiki dans les règles de l’Art. Je ne mesurais pas tout l’investissement que tu fournissais. KANSHA SHI TE.
Ma vision du Reiki est à présent bien plus riche. Je te disais en préambule du stage que je ne souhaitais pour l’instant pas enseigner mais à travers ton enseignement, j’ai compris l’acte d’amour que c’était de répendre cette merveilleuse Energie.
J’ai aussi compris, comme disait Benjamin Parker, qu’« un grand pouvoir implique de grandes responsabilités ». aussi je travaillerais sans cesse pour être un Maître le plus pur et divin possible. Ainsi je me sentirai un digne représentant de la lignée MIKAO USUI/…/Jeambrun et honorerais au mieux mon Maître Obi Wan Keno Reiki.
s
**********
Je te remercie de tout coeur et de toute àme pour cette lumière, cette force, cet Amour que je ressens tant malgré la distance et l’écran…. J’éspère te revoir avant l’an prochain mais si ce n’est pas le cas,c’est avec un immense respect et une immense gratitude pour le Maitre que tu es que je travaille jour après jour à chacun de tes enseignements afin de me rapprocher de ce que je suis vraiment, de mon essence perdue, ou du moins oubliée,depuis trop d’années.

*****************************
En passant, le très beau cristal Arco Iris que je t’ai acheté la dernière fois m’a permis de faire un bon de géant lors de mes dernières séances en guidance. D’une stabilité et d’une précision laser ! Un vrai bonheur 🙂

********
Hier je me balade sur ton site web ( ça faisait longtemps)…assez malade comme tu le sais, douleurs extinction de voix…. toux plus plus…bref que du bonheur : Je tombe sur ton article MIEL CANNELLE, assez septique je lis jusqu’au bout et parviens à me convaincre d’essayer…Ben ca va mieux!!!!  toux encore génante mais plus de douleurs sauf gorge mais moins qu’avant le traitement….Sur le cul je suis….
******************
De toute façon il faut procéder par ordre et donc commencer par m’aider moi-même. J’en profite pour avouer que ça fait beaucoup de bien de s’occuper de soi et de se rendre compte que l’on existe!
********************
Tu as l’art de nous secouer dans le bon sens Dom. Ça pique un peu au début, mais en même temps, on se dit: » je ne vais pas mourir idiot », alors hop, on prend un livre…..et puis après la lecture, on remerçie Dom et nos guides qui nous ont menés vers Dom; pour cette piqûre de rappel qui nous a mené vers la connaissance ( enfin le début de celle-ci, je reste humble). B…
********************
Très cher Dom.Voilà un an jour pour jour !!!Je remercie le Tout d’avoir guidé mes pas vers toi!!!Je te remercie infiniment pour tout ce que tu m’as apporté, ma gratitude est infinie..Ta formation reste dans mon cœur un merveilleux souvenir. J’ai beaucoup évolué depuis et ça ,c’est grâce à toi. Tu m’as ouvert la voix de la sagesse ; j’ai trouvé mon rôle ici, aider ceux qui en ont besoin ,à se guérir et protéger tous ceux que j’aime. Aider!!!! Partager. Merci, merci !!!Gratitude infinie.
******************
Je voulais également te remercier pour l’enseignement que tu m’as offert et ceux qui arrivent car j’ai fait le point sur moi il y a quelque temps avec tout ce qui m’arrive ( notamment message pendant mes rêves à communiquer à des personnes proches venant de leurs aïeuls, de gros ressentis quand je soigne etc ) et cela m’a transformé! Tout le monde autour de moi ne fait que dire que j’ai changé, que je rayonne, que j’attire les gens, qu’on aime être en ma présence…  Et tout cela grâce au Reiki qui m’a permis de changer , évoluer et de faire sortir le Vrai Moi Intérieur!! Et c’est trop coooooollllll .

*********************
J ai beaucoup apprécié votre stage du samedi 21 Mai, merci pour l’énergie que vous donnez à tous….cela m’a tellement parlé …..J ai l’intention de continuer avec vous et toutes les personnes qui vous entourent…. il me faut du temps…. J’ai eu des réponses à certaines questions et situations vécues les jours qui ont suivi votre stage ….. simplement je prends mon temps pour digérer les informations …..très cordialement 

 C….
***************
merci beaucoup pour les photos du stage et surtout pour ce merveilleux week-end passé tous ensemble….je me suis vraiment régalée !!!

*********************
évidemment depuis le stage, plein de 2eme effets kiss-cool….lol…des agréables : amplification de l’énergie, plus de lacher-prise, moins de douleurs…. et des moins agréables : grosse fatigue, crises de guérison….des surprenants : frissons électriques….donc, c’est génial !!!!
****************

je fume encore, mais moins envie et moins de manque….donc, je continue le traitement mental chaque jour, jusqu’à la réussite !!!

**************
Phrases affirmatives de Planète Reiki
Je fais le soin avec les phrases affirmatives sur les chakras chaque matin et cela me fait bcp bcp de bien! Je sens un travail qui se fait profondément en moi… c’est génial… je me sens de mieux en mieux.

Le Reiki est venu à moi au bon moment! Sans oublier ta rencontre, car ton savoir Être et savoir Faire sont vraiment précieux!
Merci l’Univers….
******************************

Merci pour ces belles photos et surtout merci pour ce stage de Reiki Komyo qui a été très enrichissant pour moi.

*******************************

Trois jours après la révision du niveau 1 en stage puis l’initiation au niveau 2, je reçois un appel d’une personne voulant me rencontrer et savoir si j’étais toujours a la recherche d’un emploi, pour me proposer un poste auquel j’avais postulé il y a plus de 6 mois et ou mon POLE EMPLOI m’avais dit clairement qu’ils ne me sélectionnerai pas compte tenu qu’ils demandaient des diplômes que je n’avais pas.

*****************

La personne que j’ai eu au téléphone m’a donné rendez-vous pour me rencontrer et aujourd’hui je viens de passer un entretien d’embauche avec cette même personne. Je me suis fais du Reiki avant l’entretien et il s’est passé a merveille. J’ai eu un très bon contact. J’aurai une réponse la semaine prochaine et si c’est ok on me forme pendant 1 mois et je débouche sur un CDD de 6 mois puis CDI.Je te tiendrais au courant de la suite de cette belle surprise.

************
Un grand merci pour ce stage qui m’a appris beaucoup et apporté encore plus….. et de même., il m’a apporté un enrichissement personnel extraordinaire et m’a apporté les clés qui, je l’espère me permettrons de travailler sur moi… pour pouvoir, enfin, aider ceux que j’aime le plus au monde, et les autres….. et tout le monde !!!
Aussi un grand merci à ce merveilleux groupe sans oublier V…. On sens tellement de bonté en vous 2 que le retour à la maison à été difficile car l’ambiance du Dojo est tellement sereine qu’il est difficile de retourner dans la réalité terrestre….
Merci aussi pour tes conseils de ce matin, je vais m employer à bien les appliquer…. merci pour tes conseils, et merci pour les conseils sur les pierres..
*********************

Incarner ou ne pas incarner  ?

Entités ou pas d’entités ?

R…En discutant avec différentes personnes, j’ai appris que lorsque tu vas à l’hôpital, il y a des tas de choses qui trainent dans l’air, entités, âmes …. (Et tout ça pas toujours bienveillants) et que ça peut s’accrocher à toi. 

– Dom.. Il n’est nul besoin d’aller dans un hôpital pour avoir ce genre de choses, appelé entités, qui s’accroche à nous ; il y en a partout ! Nous vivons dans un monde inouï, on nous a toujours interdit de côtoyer le monde invisible en nous faisant croire qu’il était dangereux. Or le véritable danger : ce sont les peurs qu’une personne a en elle, ces croyances négatives, ses phobies, ses accumulations de frustration et d’agressivité refoulée, tous ces manques au niveau de l’amour, le besoin d’être aimé, toutes ces peurs d’être soi-même, peur d’être aimée etc. etc. etc.

Ces pensées conscientes ou inconscientes génèrent des vibrations énergétiques qui peuvent se ressentir jusque au-delà du corps physique ; dans l’aura. C’est ce que les médiums « de surface » (niveau en dessous des médiums de haute envergure,) perçoivent la plupart du temps et appellent entités ou parfois les prennent aussi pour des mémoires de vies antérieures. 

Il peut arriver lors d’un soin Reiki que par empathie nous ressentions ces vibrations qui sont dans l’aura de la personne que nous soignons, soit sous forme d’images, soit sous forme ressentis intuitifs, ou encore des perceptions dans le corps physique et/ou éthérique, comme ce que tu décris.

Dans ces cas-là ; selon l’intensité de tes craintes, ton mental peut te faire croire que c’est toi qui as attrapé ça ! Avec le risque que tu t’affoles, que tu y crois, c’est comme si tu disais que ça t’appartenait en quelque sorte… 

Quelques rares fois certaines personnes retiennent dans leur aura des particules de personnes proches décédées qu’elles refusent de laisser partir. Les vrais médiums, les vrais clairvoyants – clairs sentant -, nous affirment que jamais en aucun cas aucune entité quelle qu’elle soit ne peut faire du mal à un humain. Ce genre de situation n’existe que dans les cerveaux des ignorants et au cinéma.

Par contre il y a la loi d’attirance ; on attire à soi ce que l’on est, ça c’est absolu. Et peut-être que tu as attiré à toi cette personne là pour que tu es à faire un nettoyage au niveau psychologique concernant le symbolisme des cuisses et des poumons, et une colère que tu retiendrais dans tes mains sensation de brûlure = colère.

Ce genre d’expérience est toujours enrichissante quand on la prend du côté métaphysique, du côté de la vie, au lieu de rester coincé dans la matière et dans la peur.

*************************
– L…J’ai lu un reportage ; qu’il était essentiel d’apprendre à bien  se protéger. !!!???? (on peut s’attraper tant de saletés en faisant du Reiki ??)

  • Dom…Depuis 20 ans que j’exerce ce métier d’enseignant Reiki et de soigneurs Reiki, de formateurs d’enseignants Reiki…je peux t’affirmer que les gens qui disent ça ce sont eux les « saletés« . 

Tous les « grands » maîtres Reiki savent très bien que depuis plus d’un siècle que le Reiki est pratiqué dans le monde il n’y a aucun exemple prouvant que le Reiki a fait du mal à une personne. Les gens qui disent ça ont été soit, très mal formés au Reiki ou ne le pratiquent pas de manière correcte, soit n’y connaissent rien, et ne font que des suppositions.
Cependant il est important de savoir que le Reiki est un système énergétique et que la fine subtilité du Reiki qui entre dans la personne que l’on soigne ou qui se soigne avec le Reiki peut parfois faire remonter à la surface les distorsions à l’inverse d’un antibiotique ou d’un anxiolytique qui eux, vont « endormir ». Alors la personne va s’affoler et va croire qu’elle a chopé quelque chose avec le Reiki. Mais la seule chose qu’elle a chopée , c’est l’extraordinaire chance de pouvoir nettoyer des mémoires distordues –venant souvent de la petite enfance – et qu’elle passe à côté de ce cadeau en arrêtant de faire du Reiki, ou de recevoir du Reiki. Elle ira surement chez un autre « réparateur » qui va lui donner des médicaments ou l’enfermer dans un système de croyances négatives, de craintes et de peurs.

Je reviens donc que sur ce que j’enseigne au premier degré ; pendant les premiers mois après le stage d’initiation et de formation au Reiki : pratiquer le plus souvent possible une à plusieurs fois par jour le rituel complet de préparation en traçant CKR sur chaque chakra avec l’intention que ce symbole protège des autres et protègent les autres de soi. Ce protocole si simple va créer un bouclier énergétique d’amour et permettra d’entrer en contact avec qui que ce soit en éliminant absolument tous les risque d’interférence indésirable (c’est ce que je fais depuis 20 ans et Dieu sait si j’en ai vu des phénomènes ! ! !)

Ensuite : avant d’aller à l’hôpital ; soit à ton domicile, soit dans la voiture, ou en arrivant sur le parking de l’hôpital, ou que ce soit d’ailleurs pour aller voir n’importe quelle personne pour lui faire un soin même si c’est une amie que tu connais : tu te fais un envoies à distance en mettant en avant que ton canal Reiki est ouvert pour laisser librement couler l’énergie du Reiki pour la personne (non pour toi), et que tu es protégé à tous les niveaux et que tu es en sécurité totale. Et dans la voiture avant d’entrer à l’hôpital, te faire un auto rayonnement une ou deux minutes après avoir tracé CKR sur les chakras. C’est la moindre des choses à faire.

Sinon tu vas entrer en résonance avec les distorsions qui sont dans la personne, activées et excitées chez elle par la maladie et la peur, mais en sachant que tu as d’éventuelles mémoires en toi ; la loi de la résonance. L’effet miroir. Ce n’est jamais par hasard que l’on va donner un soin à à une ou à plusieurs personnes.

***********

-P…Ma question est : quels sont les dangers que je cours en me servant de l’énergie car même en faisant kenyoku et CKR  j’ai la sensation que je prends je ne sais quoi. Y a-t-il tant de danger que ça qu’on ne voit pas ?
Faut-il que j’arrête de pratiquer et que je me forme plus profondément car je ne sens pas l’énergie ni je la vois, ni j’arrive pas à méditer, faut’ il vraiment être concentré sur les symboles que l’on fait avant le soin car j’ai tendance à les faire automatiquement. Est-ce que Kenyoku et CKR sont suffisants pour me protéger (mais de quoi ?).Je suis un peu perdue dans tout ça et aussi un peu inquiète. 

  • Dom…Peut-être néglige tu le rituel de préparation, enfin, tel que je te l’ai enseigné au premier degré et au deuxième degré. 

Peut-être néglige tu l’intégration des cinq idéaux de Reiki chaque matin et chaque soir. 

Peut-être néglige tu de pratiquer régulièrement chaque technique de changement du deuxième degré pour guérir le passé. Les mauvaises habitudes avec le traitement mental, les peurs les craintes les blocages avec la guérison à distance dans le passé. 

***********************************************************************
– B….Je trouve que l’initiation Reiki beaucoup plus puissante que l’extrême onction. Que le symbole réunifie le corps et l’esprit sur tous les plans de la conscience.
Je sais que l’ame reviendra avec ce don dans sa prochaine incarnation.
je le fais gratuitement parce que j’aimerais qu’on me le fasse quand je partirais, une grâce. Une dernière fois recevoir de l’amour qui ai du sens. Partir avec ça donne envie de revenir, tu parles, le dernier souvenir est un souvenir Reiki, trop bon. Je ne connais rien de meilleur que le Reiki. C’est le sens de la Vie. Et de la mort aussi.

*********
Merci Dom , ça fait du bien de te lire ds tes news letter. Perso je n’ai jamais fait de soin à une personne en fin de vie ( sauf un chat…) et ce que tu dis me  » convient  » ; j’ai à ce jour toujours donné les soins reiki que l’on me demandait gratuitement , et ce alors que je suis moi-même dans la précarité ( je n’ai plus de domicile fixe et n’ai aucun revenu ) mais il semble que tous les jours je sois bénie puisqu’il y a toujours un lendemain ; je fais et j’ai confiance même si c’est pas toujours facile . Par contre je ne sais pas si j’aurai envie de revenir, me réincarner … peut-être me faudrait-il croiser quelqu’un comme toi au dernier jour.

– Dom…on doit tous revenir pour régler nos distorsions, qu’on le veuille ou non. C’est la Loi Cosmique de la réincarnation.

le but de la vie n’est pas de réussir mais d’apprendre qui nous sommes et comment nous fonctionnons au milieu des autres, et ça : à travers nos expérimentations que nous nommons « métiers » « familles » « couples »…. les émotions !!!!

…et aussi à travers la faune des « récompenses à la performance » leurs dérives : l’illusion : médailles, titres d’excellence, star système, diplômes automatiques……on s’incarne en partie pour apprendre à comprendre pourquoi nous n’atteignons pas l’Altruisme, et pourquoi nous restons coincés dans l’égocentrisme et l’attachement à la matière, au pouvoir qu’elle exerce sur nous. Par manque de connaissance.

*****

Le 18 mai 2016 à 13:44, S….> a écrit :

Bonjour Dom, Dans le cadre de séances énergétiques, je suis amenée à nettoyer/libérer les centres énergétiques de programmes indésirables chez mes clients. Mes guides thérapeutes et les anges m’enseignent une méthodologie pour déprogrammer de la « mauvaise onde » (celle qui entrave la liberté, le libre arbitre).
Mes questions sont les suivantes : Nous abordons dans tes ateliers les mantras pour dynamiser les chakras, ce qui ouvre et augmente le taux vibratoire de ces chakras. Ces mêmes mantras travaillent-ils indifféremment dans le sens de la vie et de la mort ?

– Dom. Bonjour S… je ne me préoccupe que de la vie, la mort n’existant pas, étant simplement un processus de transformation. 

Le mantra n’a qu’une seule fonction c’est d’aller au cœur de l’ADN, résonance avec les chakras, dans un seul but ; d’activer le potentiel endormi de l’être. Seulement 3% de l’ADN est actif, les 97 % restant roupillent.
Le plus simple, serait de chanter ! De lacher prise, et de Vivre pour Vivre.
***************
Hier il s’est passé un très bel événement qui m’a permis de me rendre compte de ….tout ça. ..je suis rentré dans un cloître je ne sais pas pourquoi…il a y avait  4 personnes qui faisait une prière en chantant à haute voix j’ai eu l’impression que c’était pour moi tout ce qu’ils disaient
Suite à ça, j’ai fait du Reiki sur une des 4 personnes, qui avait un bouton au niveau du nez qui lui faisait extrêmement mal, deux heures après elle m’a appelé pour me dire qu’elle n’avait plus rien. ensuite le soir mon fils avait mal à la tête j’ai fait du Reiki il s’est couché…m’a appelé et m’a dit maman je n’ai plus mal! en fait le Reiki c’est comme ce que faisait Jésus et cela m’a émue j’ai pleurée d’amour… car c’est merveilleux donc je ne me pose plus de questions et je me lance j ai confiance.

C est incroyablement merveilleux!!L amour ne me quitte pas, toutes les personnes que je rencontre veulent du reiki mais je ne me sens pas prete encore? Je ressens un besoin de travailler chez moi de pratiquer sur moi meme, avant de me lancer (j ai un peu peur je ne sais pas pourquoi ) …donc j ai décider de me laisser une semaine ensuite je rappellerai les personnes qui veulent du reiki qu est ce que tu en penses?

  • Dom…Oui c’est merveilleux maintenant l’amour ne te quittera plus jamais, tu y reconnectée et c’est à vie ! Ce que je pense c’est que si tu donnes du Reiki tout de suite tu en feras l’expérience tout de suite. Et que si tu attends c’est simplement représentatif d’un manque de confiance en toi en général.
    Donc c’est en faisant l’expérience de donner du Reiki de suite que tu gagneras en confiance en toi et non l’inverse ; c’est-à-dire d’attendre d’être prête pour en donner. J’ai insisté lourdement là-dessus sur le stage, tu as reçu de l’amour, tu vas donner de l’amour, et si tu t’inquiètes : Shin Pai Suna.

***********************

Main qui chauffe beaucoup

 

– V…Je reviens vers vous car la pomme de ma main gauche me brûle régulièrement ça me gêne et ça me faisait peur.

  • Dom…Dans ce cas il ne faut pas se poser de question faut pas réfléchir faut la poser sur quelqu’un, ou sur toi et laisser couler le Reiki en accueillant. Tu peux la poser sur la terre et demander à la mère terre de décharger le trop-plein d’énergie et de te montrer par la voix du cœur comment canaliser l’énergie du Reiki de la meilleure des façons. 

– V…J’ai arrêté le reiki (pratique et 2ème degré) que j’avais prévu de faire je trouvais ça aller trop vite ces sensation fort…J’ai envie de reprendre parce-que je sais que ça marche et que ça aide mais j’ai peur. Est-ce normal et que puis-je faire ???

-Dom…Il ne faut jamais avoir peur des sensations que donne l’énergie du Reiki, ni des changement que le Reiki peut provoquer ; car ça signifie qu’il y a des années que tu attendais que ta vie change, alors quand ça arrive il faut sauter en l’air les bras tendus vers l’Univers et remercier,  accueillir tous avec beaucoup de joie : sinon tu retiens et ça brûle.

       Est-ce que tu as peur de changer et est ce que ça gêne ton entourage, ton environnement, ta famille ? ? Est-ce que ça serait ça qui brûle en toi ? La main gauche est le prolongement du cœur…l’affect.

C’est bien que tu reconnaisses que tu es peur. Et sache que l’énergie du Reiki c’est l’énergie de la terre, de la planète, et que cette énergie sait exactement de quoi tu as peur, et l’énergie du Reiki va t’aider à changer et à transformer tes peurs. Le véritable courage, la véritable force, c’est d’agir malgré la peur. Car derrière l’épreuve se trouve la liberté, le bien-être et le bonheur. Et tout l’entourage en profitera. Et en pratiquant le reiki régulièrement, ça va se dissoudre tout seul…(à peu près tt seul …) Une dernière question : est-ce que tu donnes souvent des soins Reiki aux autres ?

 

– V…Bonjour Dom merci pour tes réponses et tes encouragements. 
Non malheureusement je ne donne de reiki à personne même pas à moi pour éviter que cette brûlures s’intensifie je savais pas qu’il fallait faire le contraire.
****************
La patience, c’est comme un grand champ de fleurs au soleil, et des oiseaux joyeux, des insectes bourdonnant de satisfaction, et l’amour dans ton cœur.

L’impatience, est comme un jour de pluie et de mistral, tu es décoiffée, mouillée et agacée, tu es seule et tu as peur.
Dom
**********************
calculs
– B…Hier j’ai senti que le reiki me remuait un peu car je n’étais pas trop trop bien, je me sentais patraque. Ma Tante E…. ma dit que c’était normal et que elle, grâce au reiki, elle est en train d’évacuer des calculs reinaux.

  • Dom…Yes ! Le Reiki des fois ça remue, c’est que ça en a besoin !! Mais aussi le Reiki ça équilibre, ça met de bonne humeur, et parfois on oublie de rester sur cette fréquence de bonne humeur et on laisse notre esprit fabriquer des pensées lourdes, négatives. Alors on dit que c’est le Reiki qui nous remue, alors que NON !  ce sont nos pensées nos sentiments nos émotions lourdes et ténébreuses, mécontentement ou autre, c’est ça qui nous brasse.

C’est très difficile de rester en permanence sur la fréquence du bonheur qu’apporte le Reiki. Au début.

Mais quand on se rend compte qu’on est sorti de la lumière et qu’on broie de l’ombre il suffit d’une toute petite éclaircie – une pensée positive affirmative, ou activer un symbole – pour nous faire penser que c’est le moment de faire une séance de Reiki – qui peut n’etre que de 3 mn – et retrouver la joie, la bonne humeur, et on est beaucoup plus fort pour régler la situation embarrassante car on y voit plus clair.

***************
Anciennes relations et changements d’état d’esprit

Par rapport au sujet dont tu me parlais vendredi avant la soirée, des gens dont on s’éloigne parce qu’ils ne suivent pas le même chemin d’évolution que nous, j’ai curieusement rencontré samedi matin (comme par hasard….lol) un ami que je n’avais pas revu depuis une bonne dizaine d’années, ou plus. Toujours aussi sympa. Mais enfermé dans une lutte. Il y a 15 ans on se voyait beaucoup, toujours au sein d’un groupe d’amis. A cette époque je n’étais pas le mm et il me complexait avec ses paroles de sagesse d’amour et de paix et les admiratrices admirateurs qu’il avait autour de lui. Je nourrissais à son égard un sentiment d’infériorité et de jalousie. À ce niveau – la connaissance spirituelle – seulement. Sûrement qu’à cette époque la loi de résonance me montrait que j’avais le même homme spirituel en moi et que je souffrais de ne pas le connaître ni même le faire connaître aux autres.

Son histoire est triste ; lui qui parlait d’amour de paix et d’harmonie de respect des autres, il est parti un long moment en prison pour avoir frappé sa femme violemment et l’avoir envoyée à l’hosto dans le coma. Et le pire, il est parti en laissant sa fille de 4 ans. Depuis huit ans il souffre de colère de ne pas pouvoir voir sa fille plus d’une fois par trimestre et d’être confronté au rejet et à la haine de celle qui fut « sa chérie, la mère de leur enfant, sa fille qui a huit ans aujourd’hui ». Et sans fierté particulière (que j’aurais pu avoir il y a 15 ans…) j’ai ressenti beaucoup d’amour et de compassion pour lui, et pour elles. Et je suis reparti sur mon chemin lumineux Reiki avec un sourire dans le cœur en sachant qu’ils vivaient une expérimentation dans le monde des émotions et qu’un jour ils finiront par réparer ça.
Dans cette vie ou dans une autre.

*********
Echanges….

Ne t’en veux pas de ne pas avoir assez parlé à la soirée, je comprends très bien ces états de conscience que l’on vit tous à un moment ou un autre, ils sont légitimes et respectables. Le Reiki, la connaissance par les chakras, par les rêves, par les pierres etc. etc. etc. …. nous fait grandir certes, met aussi à nu notre sensibilité que nous avions barricadée par la forteresse, la carapace de l’éducation psychorigide que nous avons reçue, qu’on nous avait imposée. Et cette sensibilité, ces émotions respirées que nous vivons, sont là pour nous aider à avoir encore plus confiance dans ces énergies qui nous aident d’une façon si vraie ; un amour sans complaisance. Cet amour qui nous a manqué du point de vue maternel et paternel, et  éducationnel. Comprendre que le système éducatif parental et national était dirigé non pas pour notre bien-être mais pour que ces gens-là soient en paix et tranquilles et puissent gouverner leur petite famille ou leur petite nation en étant sûrs que les jeunes ne viendront pas leur casser les pieds ; sinon : violence. 

Je suis content que tu ai vécu ta tristesse, que tu ais pleuré, que tu sois vraiment en contact avec tes sentiments. C’est promis y aura d’autres soirées silence et le plus tôt possible sera le mieux.
*************************
Envois à distance

Super merci ! Et merci reiki ! Après 1 mois et demi de recherche sans même voir une annonce qui m’intéresse, voilà que les visites d’appartement s’enchaînent ! Le choix va être difficile lol c’est incroyable, ça a commencé dimanche en rentrant du stage Reiki 2 avec une 1ere annonce intéressante. C’est vraiment magique l’envoi à distance ) je profite de ce mail pour te demander les références de la musique que tu nous a passé pendant le stage, quelle page sur ton site. Et je souhaitais connaître le tarif des différents ateliers (rêve, chakras, méditations etc). Encore merci pour ce fabuleux stage et la qualité de ton enseignement.
*****************
Le balancier du pendule….

  • JC….Bonjour à chacun d’entre vous, j’ai vu que pour certains la semaine qui vient de passer marque de grands changements et pour d’autres un véritable yo-yo émotionnel, j’en fais partie, un jour je sais qui je suis et où je vais et dans la même journée je doute de tout, j’essaie avec recul d’en comprendre le « message », et malgré cet état j’essaie au maximum de pratiquer sur moi et certains de mes amis, sans oublier de « méditer », voilà un peu le constat.

Malgré un état qui semble assez confus et qui en temps normal m’aurait bien gonflé, assez paradoxalement je reste serein et confiant, à croire que mon esprit cartésien est en train de régler son curseur avec cette dimension ésotérique qui m’est tombée dessus pendant le stage et que je ne peux nier au fond de moi.

Merci du plus profond de mon cœur à chacun pour ces journées vécues ensemble et ces étincelles de moments magiques, moments furtifs mais chargés d’amour pur et d’émotions intenses.

– Dom….Bonjour JC….merci pour ce partage, c’est courageux.

Le Reiki te fait un beau cadeau encore une fois ; il te montre où tu en est sur le plan intellectuel et sur le plan affectif. Deux états de conscience intérieurs qui oscillent ;le balancier ; tantôt l’illusion de se connaître ( confondre ce que l’on fait – métier – et ce qu’on a fait et réussi, construit, établi – la personnalité – et qui on est – être soi sans rien prouver)

et tantôt ; côté affectif douter de soi, ou de tout, peut démontrer une insatisfaction de soi. Quelque chose en soi que l’on n’aime pas peut créer ce déséquilibre, c’est-à-dire ne pas être dans l’axe entre intellect et affect : content de soi.

Spirituellement, c’est-à-dire intérieurement, content de soi ; c’est ce que l’on est soi et non en fonction de ce que les autres attendent ou que l’on croit que les autres attendent de nous.

Si tu accèdes au deuxième degré puis découvriras les outils adéquats pour rééquilibrer. Je t’encourage à continuer les pratiques du premier degré car le Reiki va à la cause des problématiques. Reste dans un bel optimisme quand au symptome grace au reiki usui. Le symbole, il te suffit de le lire, et tu préserve ta sante.

Questions Réponses est un échange.
Les Questions Réponses, c’est un échange avec les praticiens Reiki Usui Karuna et Komyo reiki- Kai.

Les Questions Réponses

Tout’ ces questions dans ma têt’
Machine sourde et tempête….

Questions = Réponses.
Nous ne sommes ici que pour apprendre, pas pour réussir.
Et c’est idiot vraiment de punir les erreurs et les fautes dans les écoles et dans la vie car c’est grâce à elles que nous apprenons. …mais tandis qu’on enseigne et pratique la voie de l’unité d’autres exigent la réussite à tous prix.  C’est le culte de la réussite qui est à blâmer, pas l’échec.

Mai 2016….

soirée-partage-reiki-juvignacClic sur « Le Slam Reiki« 

 

Mai 2016

Travailler l’Ancrage

Yv. – Est-ce que tu peux me donner des recettes pour travailler mon ancrage stp ? Je me fais une séance de Reiki chaque matin, et une le soir aussi. Plus un à deux rééquilibrages des chakras comme tu nous l’as expliqué lors du stage. Merci d’avance pour ta réponse.

Dom – pour travailler l’ancrage il convient de travailler avec les cinq idéaux, chaque matin et chaque soir, afin qu’ils deviennent des réflexes conditionnés tout au long de la journée. Cela aura pour effet d’accepter la réalité telle qu’elle est, la réalité du présent mais la réalité du passé également. La famille la petite enfance et adolescence, le monde tel qu’il est, toi comme tu es… etc. Ceci concerne l’ancrage du chakra racines.

  • Tu ne dois pas oublier de pratiquer les 5 idéaux de Mikao au quotidien; il y a les deux feuilles que je donne lors du stage en japonais avec des traductions et explications en français, et il y a aussi dans le livret du stageManuel de reiki – un paragraphe pour chaque ; tu peux en lire un par exemple– pour t’en imprégner – avant une séance de Reiki.

Également tracer le plus souvent possible CKR sur chaque chakra en commençant par le bas ; avec cette pleine conscience qu’il réunifie ton esprit et ton corps et la confiance en l’univers et en la terre. Et ne pas oublier de le tracer sur les reins, protéger les reins et y penser ; vider la vessie avant un soin. urine = eau= émotions.

Il convient aussi de faire un ancrage dans le corps causal. Ça concerne le chakra de la gorge. Représente l’expression de toi ; assumer tes choix, devenir confiante en ton intuition et tes ressentis, tes idées tes opinions ta façon d’être ta confiance dans l’avenir. C’est un chakra que l’on commence vraiment à travailler au troisième degré Reiki. Mais il est nécessaire d’en assurer les bases pendant le premier degré, puis de faire le nettoyage pendant le deuxième degré.Tu devrais également travailler l’ancrage en suivant un cours de Qi Qong hebdomadaire afin de faire les exercices chez toi. Le Qi Qong est très complémentaires au Reiki.
************************
Estime de soi et arthrose
X…  – je suis initié au premier degré Reiki depuis un mois ou deux par toi, j’ai de très bons résultats en donnant des soins – je suis thérapeute  – mais voilà ; je suis un peu ennuyée, un peu déçue et triste: la semaine dernière, je reçois une femme que j’ai souvent vue en soins dans mon cabinet,( arthrose, solitude, souriante et dynamique), très contente d’un premier reiki qui l’avait beaucoup détendue et soulagée. Mais cette fois j’avais l’impression de lui envoyer de l’électricité: je suis restée peu de temps et seulement sur tête et dos. Elle avait de petites secousses et la séance l’a fatiguée, moi je me sentais bizarre. Pas de détente, et elle m’a dit s’être sentie vidée deux jours durant. A priori aucun bénéfice dans les jours suivants.

Dom –  il se peut aussi, et surement mm, que cette personne avait besoin de recevoir le reiki de cette façon ce jour là. Pourquoi ? parce qu’elle a de l’arthrose – sous estime de soi – solitude = manque d’amour de soi dans le féminin intime – et malgré « ça » souriante !!!…elle compense ses vides intérieurs par de la sur-activité pour se prouver qu’elle existe…..donc : explique lui cela en lui disant que le reiki l’a secouée parce quelle devait être secouée. Et que le reiki lui a faite remarquer qu’elle devait se reposer…. explique lui que grâce à ces symptômes que le Reiki à activer avec bienveillance c’est une chance pour elle de mieux se connaître et d’entamer un processus curatif. Dis lui qu’un médicament ne lui aurait pas permit de se connaitre plus en profondeur…..dans ces cas : il convient de continuer les soins reiki au moins durant 4 jours….

x … – je me sens mauvaise, pas mauvaise thérapeute mais personne mauvaise. Que tous mes défauts mes mauvaises pensées paroles…etc …sont la cause.

Dom – impossible ! Sauf si tu dégageais une volonté à vouloir la guérir ou lui faire du bien, par ta volonté – donc ton énergie – au lieu de lâcher et laisser faire le Reiki. car le reiki est TOUJOURS JUSTE.

X… –  je suis triste  pour elle, je n’ai pas fait de reiki depuis, sauf sur moi et une de mes aînées qui me le réclamait. Ma fille aussi a eu de petites secousses et m’a dit ressentir comme « un courant électrique » mais elle se sent beaucoup plus détendue depuis et n’a presque plus mal au genou. Mais quand même, je pense à cette dame. cela me fait un peu peur.

Dom  – ta fille n’a pas les mm symptômes que la dame. rappelle là, explique lui ma réponse. C’est ton devoir de thérapeute praticienne reiki, et pour toi et pour elle et pour l’âme du monde.
*****************************
La liberté d’être

Dom – Ma liberté d’expression, ma façon d’expérimenter l’enseignement du Reiki.
j’ai toujours considéré important d’offrir un partage à chaque stage ou séminaire. Ça me manque lors de la pratique hebdomadaire comme un cours de judo de musique ou de danse, de sculpture peinture écriture…Au Dojo Planète Reiki il est bon à chaque fois de se retrouver de se réunir, de faire un symposium. Partager un thé avant la séance et un repas après la séance, en atelier et bien entendu en stage.
Autre chose, concernant la liberté de mon enseignement – les plus – je Considère que dans un groupe les autres font parti de soi, le flux et reflux extérieur de ce qui est à l’intérieur de soi. Et c’est dans ce sens que je prends en photo quelques situations lors de vos stages, afin qu’au-delà du visuel vos âmes se sentent rattachées les unes aux autres. Pour moi c’est aussi ça, l’esprit Reiki. L’esprit Komyo.

…et liberté suite à la pratique Reiki… 

R – Pour une fois j’ ai réussi a appliquer une notion abordée en pnl ; d’habitude j’ai tendance a en faire trop et me fatiguer pour très peu de résultat; à peine quelques jours après le premier degré de Reiki dans la yourte avec toi, cette fois 20% d activité et 80%  d’efficacite !

Dom – Excellent ! En fait je suppose que tu as été à l’essentiel, un peu à l’image de CKR, tu as rassemblé tes énergies qui s’éparpillaient en satellites, grâce au Reiki tu as pu rester centrée rassemblée au lieu de contrôler et de t’éparpiller. Bravo !

R  – ex : je travaille sur le non dit depuis des années ;je viens de comprendre une nuance c’est sur la notion de liberté ; être libre de. Pas au sens « humain » mais un peu comme l’amour universel ;la liberté universelle ;je ne sais pas si cela fait écho en toi ;j ai beaucoup ressenti cette notion en stage et tu as répété je ne sais combien de fois le mot libre; le choix; si ca vous convient etc…

Dom – C’est exactement ça. Remarque : la notion de l’esclavage, la soumission, l’emprisonnement, s’applique également à la loi de la liberté universelle ; la prison la soumission l’enchaînement à son maître, c’est l’être lui-même qui le fabrique qui le crée.  Ce que j’ai appris dans mon cheminement pour acquérir la liberté c’est que longtemps on se trouve dans une prison, d’accord, mais en y regardant de très près on se rend compte que la porte n’est pas fermée et qu’il n’y a pas de cadenas… donc qu’il n’y a pas besoin de clé… Il suffit d’ouvrir et de laisser entrer la lumière la chaleur la simplicité et la fluidité… et de respirer…de l’air libre. C’est ça. C’est ça ; on inspire le Reiki et on lui demande de nous montrer comment aller là où on veut aller.

R  – meme lorsque la guepe, tu l’as laissé libre de se poser sur ta joue…

Dom  – C’est lorsqu’on commence à mieux se connaître et à savoir comment on fonctionne, qu’on commence à savoir et à comprendre comment fonctionne le monde. C’est par le symbolisme que l’on peut comprendre ça le plus facilement possible. J’ai compris ça lorsqu’à l’école ou au catéchisme on nous a montré les saints dans l’arène ; ligotés à un poteau et lâcher de lions ou de taureaux et ceux-ci venaient leur lécher les mains et ronronner à leurs pieds. Pour en arriver là il suffisait d’avoir la foi nous disait on. « Ceux qui auront la foi pourront jouer avec des serpents et des poisons sans être nullement inquiété… » depuis l’école j’ai médité là-dessus toute mon existence parce que je me trouvais un peu martyr moi-même mais je sentais qu’au fond de moi je voulais devenir l’ami des lions et des taureaux et être à l’abri de tout empoisonnement….lol.

Et c’est quoi qui nous empoisonne le plus ? La peur. Avec le Reiki (les symboles du deuxième et troisième degré) j’ai décortiqué la peur comme on décortique un artichaut pour atteindre le cœur. Et par le symbolisme la guêpe vient donner le feu pour réveiller l’esprit si l’être en a besoin. Sinon, elle n’a aucune raison de piquer et elle ne le fera pas. C’est aussi simple que ça et c’est pour ça que c’est difficile à accepter…parce que c’est simple !!! lol… et des tracteurs ou les philosophes de comptoir diront « oui mais c’est un peu trop facile ça ». Le diront avec beaucoup d’emphase et d’orgueil car au lieu de rechercher ce qui est simple ils tournent tout autour en compliquant les choses en compliquant la vie en compliquant le monde, en perdant du temps. Le symbole, le symbolisme est une concentration et sa spirale ramène au centre de toutes choses.

Si c’est pas simple ça…

R  – en tout cas cela a été mon interprétation; autre image les papillons ils ont la mauvaise image de butiner un peu partout je n’ai jamais compris pourquoi l’homme se sert de ce fonctionnement pour imager un de ces mauvais fct ;le papillon n’a que peu de temps pour apprendre et remplir sa mission prendre transporter donner; et il ne pique pas ; a méditer ??

Dom  – J’adore le papillon !

C’est le symbole qui a été pris pour le nouveau paradigme. La véritable liberté c’est de vivre par soi-même et non pas par rapport aux autres, surtout ne pas vivre pour plaire aux autres, surtout ne pas vivre avec la peur de déplaire aux autres !

Et le symbolisme spirituel du papillon ; c’est son vol ; Insaisissable !

L’oiseau file droit, le papillon lui va dans tous les sens, zigzague, on a l’impression qu’il est saoul. Comme il vole dans l’air il représente un aspect des pensées et nous indique que nous devons suivre nos pensées au lieu de suivre la pensée dogmatique des pseudos philosophes et instructeurs qui prétendent savoir comment la vie doit être ; l’ E N (éducation nationale).… Lol…

R  – merci ;ta réponse décrit exactement ce que je recherche ;guérir de mes peurs transmises  et acquises  pour vivre mes pensées en toute liberté; pour la petite histoire, j’ ai choisi ta formation en fct de qui émanait de ton site internet Planète Reiki ; évidement lorsque j’ai vu que tu venais au salon bio à Nimes ;je me suis empressée de vérifier mon choix en allant te rencontrer ;mais tu étais en conférence à laquelle ,j’ai assistée ;ce qui a fait le déclic c’est de faire  chanter au public dans la salle de conférence le son OM , de proposer de chanter m’a un peu bluffé je me suis posé la question ;pendant les dix secondes ou  tu l’a annoncé je me suis dis  « va t–il vraiment le faire ? oui ! il a une sacrée dose de liberté, car ce n’était pas un stage de yoga mais simplement le public d’un salon bio énergie bien-être fruits et légumes bio etc. etc.
*************************
Protection en soin reiki

L… – J’ai reçu dans mon atelier de soins une femme qui souffre de partout, en mi temps thérapeutique, me dit qu’elle est passeuse d’âmes, que toutes les personnes avec lesquelles elle commence à se lier d’amitié meurent…dans sa famille aussi beaucoup de décès…j’avais l’impression que ma pièce était chargée d’un  air lourd. Un instant j’ai regretté qu’elle soit venue (je sais c’est nul ) Plusieurs fois des amis thérapeutes m’ont parlé de « personnes toxiques » ou « négatives« … cela m’a parcouru l’esprit mais je ne suis pas d’accord. Je pense que les autres sont…comme ils sont, c’est tout. Il n’y a pas de toxicité à craindre et que de toutes façons notre protection infaillible c’est notre amour. Même en admettant qu’une personne ne soit pas gentille, si on s’occupe d’elle avec amour, rien ne peut être négatif. Qu’en penses tu? c’est naïf ?

Dom  – rien à craindre en effet. Je suis d’accord avec ton propos, ta définition est très belle. À mon avis, cette personne vit des coïncidences qu’elle prend pour de la médiumnité. Personnellement j’opterais pour un point de vue symbolique, je me permets d’y voir que des parties d’elle meurent et que le message que je lui donnerais serais « prends de nouvelles façons de voir de vivre de penser ; renais !!!! » Car c’est universel, une mort annonce toujours une naissance. De tt façons : protège toi avec CKR sur les chakras avant chaque séance !!!!! c’est bon pour le mental et l’émotionnel.
*******************
Les 21 jours d’auto traitement 

M… – je voulais juste te faire partager la joie de mon premier reiki « officiel » après ce beau stage premier degré Reiki à Juvignac : une dame (76 ans, une merveilleuse personne) que je vois depuis une dizaine d’années, ponctuellement puis plus régulièrement. Maux de dos, syndrome de Parkinson puis maladie. La réflexo l’aidait bien jusqu’à ce qu’elle prenne les médicaments du neurologue contre les tremblements. Ce sont toujours des obstacles à l’auriculo mais là…plus rien. j’étais si triste de la voir souffrir avec le moral si bas. Je lui ai proposé du reiki en mode « on peut toujours tenter, on verra bien » …j’avoue très perplexe car l’osteo non plus ne la soulage plus…

Deux jours après, elle me téléphone, la voix joyeuse me racontant ses exploits comme une chipie toute fière de me dire qu’elle est partie se promener en ville la veille pendant plus de trois heures (il m’en faut moins pour être morte!)  puis a passé l’aspirateur chez elle…. »oui c’était peut être beaucoup pour mon dos » tout en riant…Voilà! quel bonheur de l’entendre heureuse. Je la revois cette semaine.

Les 21 jours d’auto traitement se terminent et je voudrais savoir s’il faut arrêter ou continuer l’auto traitement Reiki journalier ? Je t’embrasse, merci, je suis super heureuse!

Dom  – je suis heureux aussi. Je le suis professionnellement. Professionnellement heureux de t’avoir transmis le Reiki et la quintessence du Reiki, l’esprit du Reiki Usui pour guider le tiens afin d’aider les autres dans ton office de thérapeute. Et ce qui m’enchante c’est ce que tu as dit à cette personne ; la façon dont tu lui as proposé du Reiki en mode « on peut toujours tenter, on verra bien » c’est une bonne posture qu’il est bon d’avoir lorsque l’on fait du Reiki ; oser poser les mains lâcher prise et sourire, ne rien attendre… pas d’attentes pas de déception. 

Il est toujours bon de dire ça « si ça marche c’est bien si ça marche pas c’est bien aussi, il se passe exactement ce qu’il doit se passer » et le faire en étant rempli d’amour ou dans un état de conscience proche de l’amour…
Tu en verras d’autres des miracles je te le garantie. Des tous petits et des grands aussi. 

Puisque tu en parles, je me permets de te préciser quelque chose d’important.

Je te conseille vivement, de continuer de te faire le soin Reiki tous les jours et de ne pas arrêter au bout des 21 jours d’auto traitements après le stage, pour répondre à ta question de savoir s’il fallait arrêter le Reiki au bout des 21 jours après le stage Reiki. Ça serait ordinaire d’arrêter. Les 21 jours servent aussi à prendre l’habitude, la bonne, celle de se donner du Reiki tous les jours. Quelque part ça fait peut-être aussi parti de ton rôle de thérapeute ; de rester chaque jour et chaque nuit remplie de cette substance curative du reiki et de maintenir autour de toi aussi son énergie dans la couche mystérieuse qui t’entoure – l’aura – afin d’être pleinement au service des autres sans ne plus te poser de questions puisqu’en agissant ainsi tu en fait partie. Du Reiki ! De ce mystère qu’est le Reiki.
Lorsque nous pratiquons ainsi nous sommes Reiki.

**********************************************

Avril 2016 
C…- Il se passe des choses extra ordinaires dans ma vie; C’est magnifique. Je suis en train d’épurer les mémoires : ça fait grandement du bien et surtout comprendre plein de trucs.
Dom – je te l’avais « promis » lors de ton initiation, non ? Le Reiki, lorsque tu n’as pas peur du changement….t’ouvre la voie de la nouveauté en toi et ton environnement – ta vie – ressemble de plus en plus à ton épanouissement intérieur..

*********************KARUNA

effectivement je comprend pourquoi les gens ne pouvaient pas me décrire le reiki Karuna et me disaient plutôt « il faut le faire pour savoir ce que c’est ! ». C’est vraiment impressionnant les ressenti même pendant les auto soins !
*************
X… – Déjà tu peux m’inscrire au niveau 2 Karuna…Depuis l’initiation Karuna 1 , je me sens enveloppée d’une immense bulle lumineuse , qui se déplace avec moi et dans laquelle je vis , je marche , je conduis , etc…c’est très particulier comme sensation  et très agréable. Je vais avoir besoin de me relier à cette Lumière , car la rencontre avec  » la partie sombre de moi même  » , est troublante , heu… pas très belle …. mais comment fais-tu pour nous guider dans cette méditation ???  C’est extraordinaire !!!!! 

Dom – Faut refaire la médit souvent, prendre l’habitude de parler en méditation avec elle, l’intégrer, car elle a beaucoup à t’apporter.

X… – J’ai encore beaucoup de chemin à parcourir …….les archanges et les rayons de couleurs… c’est pas encore arrivé jusqu’à moi … je dois « bloquer « quelque part !

Dom – Continue le cheminement et la pratique, tu verras la progression est toute aussi belle. La lumière est au bout du chemin….

X… – Merci encore pour ton enseignement et tout ce que tu m’apportes et me fais découvrir.

Dom – c’est du partage !

*******************

bonsoir Dom…J’ai beaucoup apprécié cette harmonie gentillesse et calme. Je suis revenue sur un petit nuage qui dure encore, car pendant cette initiation j’ai ressenti que chose d’indéfinissable. C’est un mélange de paix ,de joie  et je dirai d’amour. Samedi après midi ,je me suis remise à la peinture que je n’avais plus exercée depuis plusieurs mois. Je suis donc très motivée pour passer le 2eme voir le 3eme niveau…….si tu penses que je le peux.    encore merci pour ce que tu nous donnes

Dom – ce n’est en aucun cas à moi de savoir si tu peux passer le niveau 2, sauf cas extrême évidemment. Mais c’est toi qui te sentira appelée, et toi seule qui décideras.
**********************
Komyo

Z…- Je souhaite savoir dans le Reiki Komyo ; l’auto traitement doit il être pratiqué tous les jours ? 

Dom – Il est fortement conseillé de se donner du reiki chaque jour. Evidemment c’est toi qui décide du temps que tu accordes à ton bonheur….surtout pour la tt et la gorge…puis le corps

Z…-  Lorsque je m’adresse a l’énergie du reiki je sais pas vraiment comment le faire ou du moins quels sont les mots juste a utiliser?  

Dom – Sois simple, imagine comment tu parlerais à l’énergie si tu étais une petite enfant, c’est cette innocence là qu’il faut réinstaller en soi ; la pureté n’est rien d’autre que l’innocence. Ensuite, une fois entraînée, tu peux t’inspirer, pour les mots, de cette prière chamanique que j’ai adoptée et et que j’utilise pour faire les initiations :

Je m’élève pour recevoir la guérison pour mon plus grand bien et celui du tout.

Ou bien / Reiki élève mon cœur et mes intentions pour canaliser la guérison, pour le plus grand bien de …. « la personnes concernée »….ou bien «  et pour le plus grand bien du tout ».

Z… – Je pratique essentiellement le soir, plus particulièrement dans le bain c’est le moment ou je lâche prise …

Dom – C’est parfait dans l’eau ! tu traites surtout le coté émotionnel.

Z… – Je te présente mon rituel : Position Gasshô :  J’essaie de tenir 3 minutes plusieurs positions des mains, puis ; Tête, ventre, pieds en grande partie .

Dom – N’oublie pas la poitrine, région du cœur.

Z… – Pour activer l’énergie je chante les principes  » kyodakewa… etc. etc. ». Si je traite une zone bien précisé j’utilise à la fois le reiji, le symbole komyo « Z U « . J’ai pas pris mes notes volontairement pour rédiger ce mail, car mon but et bien sûre de l’exercer naturellement . Depuis le stage, mon pied va de mieux en mieux ..je ressens un peu moins de colère intérieure.

Dom – Tu vois, faut pas arrêter, tu posais la question ; tu as toi mm la réponse ; continue les auto traitements.

Z…- Cependant je passe par des phases de bien, de moins bien. Les émotions sortent parfois , s’accompagnent par des pleurs lorsqu’il s’agit de moquerie sur mes points faibles . Je ne supporte plus . Mes proches « mon frère  » par exemple est surpris . 

Dom – C’est un symptôme de guérison ; pour donner l’écoute à ton enfant blessé, apprendre à oser dire ce que tu ressens. C’est ça Grandir ; c’est dans la confrontation avec les autres qu’il faut utiliser le Reiki pour être à l’écoute des ressentis, qu’est-ce que tu ressens dans le corps lorsque quelqu’un en face de toi te dérange, ou est-ce que ça te touche, quelle est cette émotion. Et ensuite trouvé qu’elle est la méthode Reiki la plus adaptée pour transformer cette émotion.

Z…- En bref, j’aimerai travailler sur la confiance en moi, la prise de parole avec une communication fluide et claire .

Dom – Viens à l’atelier sur le chakra de la gorge vendredi 25 Mars

Z… – Je suis allée voir une kinésiologie , je n’ai pas vraiment ressenti d’amélioration. 

Elle a soulevé des points que je savais . Ce rdv peux t’il stopper ou perturber l’initiation au reiki ? 

Dom – Absolument pas ! Tu es initiée à vie quoi qu’il advienne. Seul le mental pour x raison, peut éventuellement bloquer l’énergie, en fait la refuser ou la ralentir. Mais ce mm mental peut aussi facilement la relaisser circuler. Mais aucune intervention d’une tierce personne ne le peut. Et encore -1 quelconque autre système énergétique. C’est impossible.

Z…- Je souhaite savoir comment je peux travailler sur ce qui est refoulé ? 

Dom – Je te donnes l’adresse d’une personne impeccable : Marie Claude Granget / 8 rue clairette / montpel / 04 67 41 21 55, tu peux l’appeler de ma part.

Puis, le jour où tu te sens prête, il y a le stage du 2ème degré Usui ; de belles techniques appropriées pour l’introspection et les « outils » pour réparer le passé. Et particulièrement celui que j’ai mis en place en juin sur 4 jours au lieu de 2 justement afin de mettre en pratique, en immersion durant 4 jours, avec des nocturnes pour des soins guidés.

Z…- Par quel processus parallèle en sachant que la méditation m’apporte sérénité ? 
Dom – La sophrologie est efficace, demandes au Reiki à être mise en relation avec une sophrologue d’envergure. Tu écris sur un papier « je suis maintenant guérie grâce à des séances de sophrologie avec une personne d’envergure qui me correspond parfaitement. En accord avec les lois de l’Univers », le tout entouré par les symboles Reiki auxquels tu es initiée. Tu mets ça sous l’oreiller et tu t’endors en récitant doucement ta prière, alternée avec, doucement, 3 fois de suite le symbole du cœur… En te visualisant guérie.Je t’envois également un autre texte sacré, (en pièce jointe) tache de le lire tous les soirs avant de te coucher, ou le matin, à voix haute jusqu’au bout. Il est terriblement fiable et efficace si tu le fais ts ls jrs pendant 21 jrs. C’est la puissance du verbe.

*****************

Y… – Je viens tardivement te remercier pour ce bel enseignement que tu nous a transmis sur le reiki Karuna. C’ est une belle énergie, très forte mais aussi  enveloppante…ce groupe était bien sympa et homogène. je pratique tous les jours et suis tes conseils pour bien intégrer ces symboles…je continue la grille ,les marathons….je travaille sur moi….je viens de trainer 8 jours avec une bronchite asthmatiforme…..je cherche ce qui m étouffe…..etc….

Dom – merci pour ce beau retour….mm si ça tousse un peu…..moi aussi j’ai cherché un mois ce qui m’étouffais car j’ai hébergé dans ma gorge une trachéite, elle sied bien plus MA squatté pendant un mois et demi. Mais c’est quoi un mois et demi dans une vie ? Si cette parcelle de temps m’a aidé à mieux comprendre mon moi intime grâce à ce que les ancêtres appelés maladies et que j’appelle moi « mal éducationnel » ?

Le Reiki, et encore plus le Karuna nous aide à accepter le mal pour nous faire évoluer, grandir.  Chaque jour on vit un évènement, une initiation qui fait évoluer, des petits riens qui font un beau fleuve d’amour en soi….à un moment on sait qui on est, et là,  on ne souffre plus. Plus de « ça ».

*******************************************

X… – Je passe mon oral d aide soignante le 10 mars je m envoi un soin pour que tous se passe bien ?

Dom – exact ! tu peux commencer l’envoi à distance dés aujourd’hui !!!!! tu recharges ts ls 3 jrs !

X… – Ok super merci je vais le faire alors ! C est vraiment génial le reiki et le 2 degré au top je vois vraiment le changement mes priorités et vois les choses différemment et avec gratitude

**************
Lors de la deuxième session de Reiki que nous avons fait en janvier concernant entre autre un retour sur les « petit papiers » demandant à nos guides de nous soutenir dans le choix d’un changement. Le mien était d arrêter de fumer . 

je dois avouer que deux jours après la formation j’ai fumé deux cigarettes et je peux te dire que je l’ai regretté car toute la nuit qui a suivie, j ai été malade à « crever » de honte avec moi même pour ne pas avoir respecté mon engagement vis à vis de moi , de mon être …. ( mal au ventre , cogitation avec mon âme ) …depuis …je n ai plus touché à une cigarette ni même eu l envie d entre reprendre une .

Et meme lorsque je suis en soirée avec des fumeurs je n en ai pas envie ! Donc , je voulais profiter de ce mail pour te dire : M E R C I !

je ne sais pas si pour les autres « ça  » a marché mais en tout cas pour moi oui et j’ai compris une chose : TOUT EST DANS LA TETE , et cela pour TOUT ! je continue le reiki sur moi et j en propose maintenant à d autre personne qui son hors de mon entourage. 

Le 21 novembre 2015 14:33, B…a écrit :

B…- J’ai fait quelque recherche sur Internet mais j’ai pas trouvé quelque chose de concret au sujet du soucis que j’ai depuis 15 jours. Il s’avère que la sciatique que j’ai eu été du à un déplacement de la hanche droite. Du coup évidemment cela a coincé direct le nerf sciatique. Est ce que tu sais s’il y a un problème direct au niveau énergétique ou émotionnel qui a fait que ma hanche s’est fait la malle ?

Dom – souvent c’est du à de l’indécision ; peur d’aller de l’avant et de prendre une décision, car l’inconscient peut avoir peur des conséquences de cette prise de décision, peur de perdre une liberté…
Voici une recette Planète Reiki :

1 – accepter les conséquences si on prend une décision ; avec SKSK

2 – HSZSZN + SHK pour apaiser l’émotion et le mental.

3 – 1er idéal Reiki ; au lieu de s’en pré occuper, s’en occuper. voir ce qu’il convient de faire pour que les conséquences possibles, de la prise de cette décision, soit – deviennent gérables…. 

Le fait que , comme tu l’EX PRIME (ex = extériorise)…. « la hanche se fasse la malle », veut dire que : face à cette décision tu te fais la malle….

La sciatique est souvent due à une peur de manquer, à un sentiment d’insécurité. Tu peux prendre conscience de tout ça. Puis trouver quelle est la situation dans laquelle tu créais ce stress , l’identifier , la nommer la peur de décider – dans cette situation précise – et bien entendu le plus facile restant à faire : un traitement mental, avec la phrase qui convient, plus un quartz et papier !

B… – Ok merci pour toutes ces infos Dom! Je vais rassembler tout cela trouver la décision qui me bloque et me faire une phrase en fonction ! C’est puissant le corps quand on veut pas comprendre quelque chose…lol…

***********************

C… – après le niveau 2;faudra t-il pratiquer 21 jours d’affilée comme on a du faire après le niveau 1??
Dom – Bonjour C…oui, si tu le désire dans ton cœur bien sur. fais fructifier le sacré des initiations 21 jours après passages de chaque niveaux Reiki. ça marque ton intention de changement de ton monde intérieur et intime. C’est une des façons de changer le monde extérieur et relationnel….en plus d’augmenter ton taux vibratoire et les surprises dans ta vie….surtout si passé les 21 jours tu continues à pratiquer ts ls jours pendant des années !!!

*******************
L.. – depuis une semaine g des aphtes dans la bouche. G aussi mal à une oreille et à la gorge, ça empêche d’évoluer. Je fais des soins Reiki 2 à 3 fois par jours, ça me permet de dormir assez bien, mais je sens que j’ai besoin de comprendre pour pouvoir être totalement libéré. Tu as un avis là-dessus, j’en suis sur.

Dom – les aphtes dans la bouche viennent en général de se sentir repoussée par la personne avec qui on voudrait vivre une relation intime et sexuelle… (bouche + baisers/sensualité). C’est représentatif de frustration et de tristesse , voir de colère remâchée…. vis tu cela ?

les oreilles = écouter/entendre….que voudrais tu entendre ? Que ne veux tu ou ne sais tu pas entendre ?

La gorge = parler, exprimer….sinon râler, tousser, quelque chose à dire qui est resté coincé…

continue tous les jours 1 h de Reiki…..et pratique les techniques apprises en stage.

En cas d’urgence contacte de ma part ton médecin traitant.

**********************

Merci pour ta lettre de nouvelles Reiki local qui fait toujours du bien et merci pour le mot d’Amma qui correspond à ce que j’ai pu ressentir après les attentats : ne pas se laisser submerger par des émotions négatives mais s’accrocher à l’amour et la lumière et les cultiver en soi et autour de soi…
Je pratique toujours le reiki au quotidien, j’ai aussi fini ma formation en géobiologie, j’ai commencé à pratiquer et le reiki m’y sert parfois. Je continue donc d’avancer sur mon chemin…
******************************

De mon Ami, mon Frère….

B… – Salut mon Dom
Comment vas tu mon frère ? Mon ami..

Pour ma part j essaie de sortir tjs de mes soucis ,et c est pas gagné…
On espère que bientôt le carnage cessera…
La santé très mauvaise aussi ,, rein gauche dead aorte bouchée 50%
Pbl cœur sûrement op. Bientôt..
Stres stress stress …
Séparé de C…. depuis 10 mois presque…
La je retrouve enfin un peu le sourire
Avec un petit loft atelier que je viens de louer…
Tu passeras ,????
Dis moi pourrais tu me passer le texte ou il y a les idéaux a suivre. ..
J en ai besoin j ai donné la mienne et je n ai plus souvenir …
Des bisous
On se voit quand ???

Dom – Salut B…. tu m’inquiète…..j’espère que tu vas trouver aussi un énergéticien, une sophrologue pour libérer le mental des ruminations des soucis…. enfin des soins parallèles pour te soulager ; va la voir avec ceci : les reins sont liés à une peur concernant la survie….les besoins de base…..et aussi à des personnes dans l’entourage qui nous empoisonnent….et la survie en dépendant de quelqu’un ça peut être une cause de mal-être…. et celui de gauche, coté du corps ou il y a le cœur, l’affectif ,donc il y a une peine qui est ajouté…. L’aorte c’est la mère nourricière du corps, celle qui nourri et oxygène l’organisme. te sens tu désabusé et révolté que malgré tes efforts tu sois obligé d’admettre la défaite… ton corps est ton allié et te dis qu’au niveau des pensées il y a des pressions à désemplifier. afin que le sang et l’oxygène se refluidifie , pour une vie plus souple…. et l’aorte est elle aussi à gauche. tu un sensible mon ami, comme moi, mais c’est simplement un message pour réveiller le Yang, le mâle intérieur, le guerrier, le viking en toi quoi !!! en ce sens la sophrologue va t’aider , suffit des fois d’un bon ménage. la prière je te la mets par mail, au cas ou je te mets les 2 prières. et oui, je vais passer à X…… te voir ! donne moi ton adresse.
Je viens te voir le wend prochain.
je t’embrasse mon frère, prends soin de toi.
 Dom
*********************************Un slam reçu suite à un stage !

j’adore ! Je vous le laisse découvrir.

Une rencontre inopinée
Et l’esprit se languit
Bientôt d’être éclairé
Au sujet du reiki

Un symbole qui danse
Et voilà l’énergie
Exaltation des sens
Vibrations l’âme guérit

Découverte d’une clé
De mon petit paradis
Passions acides libérées
C’est l’extase qui grandit

Mains jointes Ô silence
Vient l’heure du repli
Un instant de transe
Méditation sur la vie

Mais persiste une pensée
Alors je te le dis
Vénérable Sensei
Vraiment un grand MERCI !!

*********************************************

Nous ne dirons jamais assez merci.

Tu nous remercie mais je pense que c’est à nous à le faire! donc je te remercie pour ce stage, pour ta gentillesse, ton humilité, ton écoute, ton humour, pour tous ces échanges, ces partages, ces confidences aussi…j’ai passé un très beau week end ! un peu fatigant mais tellement enrichissant…Merci, merci, merci…je t’ai dit avoir changé depuis quelque temps…je suis de plus en plus positive et je vais par conséquent de mieux en mieux et ce week end m’a apporté encore et encore; je savais que ce week end serait « le week end » mais j’étais tout de même loin de la vérité! 

V…- bonjour dom question très personnelle d’une amie médecin très ouverte au reiki  son mari viens d’être hospitalisé pour un oap et eczema géant elle à reçu un SMS il y a quelques jours de son neveu la menaçant de tous les malheurs  (pb d’héritage ) et depuis son mari accumule les pbs de santé  (j’ai essayé le Reiki à distance sans grande efficacité )donc sa femme de pose bcp de questions si on leurs avait pas envoyé un mauvais sort ? ( leurs chien est mort d’un oap l’année dernière à la même date )  quand penses-tu  et que faire ? Merci V…

 Dom – l’œdème est généralement du à un sentiment d’être limité pour aller de l’avant, pour réaliser un projet, pour sa carrière, pour déménager….ect.

c’est le sentiment d’être limité qui est signifié par le liquide ds ls poumons. le liquide indique que c’est d’ordre émotionnel ( 2ème chakra/lymphe/reins/urine..tout ce qui est eau) et les poumons c’est la vie ! Vivre la vie à plein poumons !
un problème aux poumons indique de l’abattement. Et l’exéma signale une sensibilité à fleur de peu ; la crainte ou le refus d’exprimer ses émotions ( en l’occurrence le sentiment d’être limité ( de se sentir limité) sont concernés les 3 chakras : sacré/émotionnel -solaire/la peau (être bien ds sa peau – et cœur/prendre la vie à plein poumons !

 REIKI : il lui faudrait un soin d’une heure tous les jours, ou au moins d’une demi heure.

selon l’endroit ou il demeure il y a peut être quelqu’un qui peut s’en charger…

à distance : demande la guérison émotionnelle et l’expression des sentiments retenus (de la manière la plus puissante la plus positive et la lus divine)
pour éloigner les mauvais sorts : porter un oeil de tigre et en disposer ds la maison d’assez belle taille, surtout en sphère (5 à 10 cm diamètre).
*******************
« élève à questionsssss »…lol… mais vous le savez : j’aime les questions.… Lol. 

G…– Pendant le stage, nous avons chargé un cristal, mais sans écrire sur un papier. Nous devions le porter sur nous et dormir avec la pierre sous l’oreiller. Mais je ne me rappelle plus quelle était la trame générale de la demande. Etait-ce une demande liée à la santé ?

Dom  – tu peux charger un cristal avec du Reiki et les symboles sans aucune intention et le porter sur toi ou/et dormir avec pendant 4 jours comme une batterie Reiki pour le plaisir. c’était ça le but de l’exercice.

G…- Quand on a un nouveau cristal, il faut le nettoyer et le charger mais quel est l’ordre exact ?

Jaki Kiri Joka  puis  le rituel de préparation 2eme degré   puis    recharge du cristal    ou bien

le rituel de préparation 2eme degré   puis   Jaki Kiri Joka    puis   recharge du cristal.

Dom  –c’est pareil, l’un comme l’autre sont valable et parfois on le fait sans s’en rendre compte…à force. la logique voudrait la 2ème formule….

mais aussi : Conseil de Maître  : Ecriture Prière – puis….SHK mains/aura/espace – JKJ – et rituel R2 – et charge……(tu décodes ?!!…lol)

Jaki Kiri Joka est bon pour libérer les pierres des énergies stagnantes, s’il y en a. J’ai fais plusieurs formations de litho-thérapie ; il suffit d’en vérifier le résultat au pendule. Il y a des personnes qui ont peur de cette technique vis-à-vis des minéraux….Lorsqu’on fait jaki Kiri Joka sur un objet qu’on tient dans la main, inévitablement on se fait aussi la technique sur la main, n’est ce pas… ? Alors ? en avoir peur, c’est bête non ? Car nous avons aussi de la silice dans les celulles de la main….me font marrer les gens et leurs peurs !!!

G…- Lorsque l’on recharge un cristal ou des cristaux, qui sont en cour de traitement, (C’est le cas de nos cristaux que nous avons chargé pour la 1er fois dimanche avec toi) est il nécessaire de faire le rituel de préparation 2eme degré avant de visualiser les 4 symboles ?

Dom  –oui ! et pas les visualiser mais les tracer dans l’espace avant de commencer – tu visualisera après le  temps d’intégration.

 G…- Pour purifier les cristaux en page 33 (tu l’a également mis en page 59) , tu nous donnes l’astuce d’aller sur Youtube. Mais je n’ai pas trouvé les vidéos. Je sais je suis un peu manche …. Peux-tu me donner un lien ?

Dom – tu cliques « Jaki kiri joka » sur internet et tu chois dans les tas de sites qui font les démos….

G…- En page 34, tu évoques l’énergie bloquée. Pour moi (formation Tuina) une énergie bloquée correspond à une douleur physique. Est-ce bien ça ?

Dom  –ça peut aussi être une simple gene, un picotement récurent, une tremblement chronique alternatif, mais bien sur douleur aussi….ds ts ls cas de souffrance l’énergie s’écoule mal, en stage de 2 jours on dit « énergie bloquée » c’est un racourci, ensuite ds la pratique on aprend à discerner, à relativiser…et à me demander ! merci !!!

G…- En parallèle en page 41 tu proposes une méthode « en cas de douleur »

Comme ce n’est pas le même soin (Symboles différents) que page 34, quelle est la différence ? Je suis carrément perdu.

Dom  –là cette méthode permet de ne pas réfléchir ; on la fait systématiquement chaque fois que la personne a mal (douleur). il y a des gens avec zones corporelles ou l’énergie est bloquée sans douleur aucune….(mais ça gène) donc on fera la 1ere. et les 2, alternativement pour les DOULEURS

G…- Avant ces 2 soins doit on faire le rituel de préparation 2eme degré ?

Dom  –non, …Seulement CKR ds les mains/aura/espace………comme ds ls urgences.

Mes-opinions-surLundi 16 Novembre 2015
Trop c’est trop 

QUESTION / C – Je suis dans un mal etre énorme depuis le début de la semaine. J ai beaucoup pleuré notamment en me faisant du reiki a moi même. Peux tu me dire a quoi c est du? Ce que je peux faire. J ai l impression d être en phase de régression comme si quelque chose ou quelques un m empêchait d avancer.
Dom – peut être en rapport avec un envoie à distance pour toi ds la grille…!?!…ça ressemble à une purge émotionnelle : une mémoire remonte et demande à être comprise. Tu pourrais voir un sophrologue et lui demander de t’aider à comprendre. sinon je peux te donner le phone d’une amie médium assez douée..
C -Merci beaucoup. Je comprends mieux maintenant. J’accepte le bouleversement puisq ça me nettoie. Je voulais aussi savoir s il y aura besoin de cristaux pour la maitrise en decembre ? Si oui peux tu me les fournir ou je les achète ici?
Dom – juste tu amène ton cristal maître, et un ou 2 autres si tu le souhaites pour qu’ils s’imprègnent de la haute vibration des 3 jours et des intentions du stage « passage de la maîtrise ».
C -En tous cas, il faut que tu saches qu a chaque fois que je charge ma grille je pars en méditation profonde!!!
Très très bizarre, tu ne trouves pas?
Dom -c’est peut être pas nécessaire d’entrer en méditation lorsque tu recharge ta grille, tu devrais peut etre méditer avant, et charger la grille après. ou bien avoir une grille pour toi et tu médite à ton souhait en la chargeant. et une autre pour les autres en faisant juste un Reiki activation.
être et faire en pleine conscience éveillée est la façon Reiki.

******************

Trop en faire..
Cc
–  j’avais une petite question à te poser: Hier j’ai donné deux soins Reiki et je trouve que cela m’a vraiment fatiguée.. Du coup est ce normal..,? j’aurai pas du avoir plutôt un regain d’énergie..?

Dom – il est possible que durant le soin tu te sois laissée embraquer par des pensées de vouloir la soigner, lui faire du bien, du « pourvu qu’elle ressente le Reiki, pourvu que ça marche, pour vu que… ». possible aussi que tu trouvais ennuyeux, le temps long, les postures fatigantes, le mental trop vagabond…..du coup, au lieu de lâcher prise tu t’es fatiguée à « penser »…..sinon il est possible que le Reiki te dise « tu vois, tu manques de repos, tu en fais trop, pose toi et re pose toi ». Car dans 99,99% des soins on a l a pêche après en avoir donné !
t’as qu’a regarder ton riz !! (riz traité au Reiki dans un bocal durant 20 jours suivre le lien : https://www.facebook.com/photo.php?fbid=10206291359097876&set=pcb.10206291360217904&type=3&theater

Dom – lors d’un soin ; tu te dois de lâcher prise, tu fais le rituel, tu visualise le symbole à chaque position des mains, chantonner, visualiser de belles lumières, la connexion avec le ciel, avec la terre, réciter la prière ésotérique du symbole….respirer calmement et se détendre. Tu peux mm te laisser aller à rêver…mais….Surtout : ne rien attendre !!!

******************

Encore merci pour tes conseils du jour et ce beau moment passé avec le groupe. J’ai compris des trucs surprenants sur la fameuse loi d’Attraction couplée à la loi de résonance suite à notre échange. Tu es un maître éclairé, et je suis très heureuse de te connaître. J’espère avoir l’occasion de participer à un autre atelier chakra bientôt pour continuer à apprendre.

*****************

Le Reiki Usui est la base et l’origine de tous les « REIKIS ».

Le système, la structure, les fondations, la bâtisse Mère du Reiki.

*****************

Nettoyer les lieux

M – pourrais tu m’aiguiller sur comment faire pour « nettoyer « une maison d’abord à distance mais aussi sur place avec le Reiki (2 pour moi). La maison de mon chéri présente des nrj plutôt basses ki ralentissent sa vente et rendent apathiques et négatifs les personnes ki y vivent. Moi même quand j’y séjourne plus de deux jours je me sens déconnectée démotivée et pleines de pensées négatives. Merci d’avance.

DomAssure toi d’être seule pendant 1/ h sur le lieu. et suis cette façon de faire le nettoyage ;

– rituel complet ds une pièce avec CKR sur les chakras devant et derrière/prends ton temps : tu es en mission.

– puis SHK mains/aura/espace

Et tu fais, dans toutes les pièces, couloirs, placards, wc, cave, grenier, jardin, cabanes, puits…ect

– CKR dans les angles/sol/plafond/centre

– puis SHK en grand sur les murs /sol/plafond/centre
– Idem sur les portes et fenêtres: CKR ET SHK

– – à l’extérieur :

– CKR ET SHK sur les portes et les fenêtres.

– SHK sur les murs

– puis, tu tiens l’angle de la maison de ta main non dominante et tu fais Jaki Kiri Joka.

– et enfin tu visualise un immense HSZSN qui traverse la maison de haut en bas et la soude au cosmos et à la terre avec une lumière Divine, tu visualise cette lumière Divine remplir toute la maison, toutes les pièces.

enfin tu visualise un immense SKSK dans la maison, un gros qui la rempli d’Amour.

Un plus : Mets des tourmalines noires dans les angles des pièces / une pierre jaune dans l’entrée / un quartz transparent de belle taille que tu rempli de Reiki et de symboles dans la pièce principale ainsi qu’un rose et une calcite miel.

– si ça passe pas, je connais un radiesthésiste qui peux déterminer si la maison n’est pas construite sur un nœud négatif. Dans ce cas, la solution est : déménager.

************

Se nourrir c’est s’aimer

Le 9 novembre 2015 10:43, J N  <0@hotmail.fr> a écrit :

Bonjour Dom, Je voulais te faire part de mon ressenti pour la journée d’hier, C’est un groupe ou je me suis senti moins bien qu’avec celui du mois d’octobre « cercle émeraude ».

Mais surtout depuis hier soir je suis bloquée au niveau du sacrum je ne sais pas pourquoi ! je n’ai pas pu aller bosser tellement la douleur est intense. Je ne sais pas si cela à un rapport à la journée d’hier ou si c’est autre chose, grand mystère. te tiens au courant !

Dom – je comprends que d’un groupe à un autre on puisse avoir des ressentis diffèrent, c’est assez normal. Surtout que le groupe précédent était plus  intimiste avec juste 6 personnes.

Quand à la douleur ; es tu sure que c’est localisé au le sacrum ?

Alors si c’est bien ça, s’est la réaction de guérison en rapport avec la mise en route du changement de processus concernant ton choix sur l’atelier de ce stage Reiki 2 ; la nourriture ! Tu entame la guérison « je change nourriture en pensant d’abord à moi avant de contenter la gourmandise des autres ».
Le chakra sacré est en lien direct avec :

– la nourriture

– l’argent

– la façon dont on prends soin de soi

– et les rapports qu’on a avec les autres .  

Ors, tu es en train de passer de « servir les autres  » à « penser à toi ».

Petit conseil ; accepte – avec SKSK – que ça soit douloureux, difficile, et continue avec SHK le traitement mental, fais confiance au Reiki.

***************
Le mal est l’ami du bien

Merci beaucoup pour ce moment de partage intense et joyeux
Merci Reiki pour toutes les bonnes choses qui arrivent à chaque instant, et les moins bonnes qui refont surface ( on se demande pourquoi ? ? ? ?  ) et que je vais pouvoir guérir maintenant, car maintenant je sais faire  !

Dom – Parce que le Reiki n’est pas un antibiotique ni un anxiolytique, son énergie va à la source du problème, donc parfois il bouscule un peu, comme synthol ; ça fait mal là ou ça soulage ! Nous appelons ça « symptôme de guérison« . Et le Reiki fait remonter à la surface ce qui dérange afin de s’en occuper et le guérir.

***************

Un jour, quand tu seras prête, la porte s’ouvrira

Bonjour dom, Je prends ma plume pour la première fois de ma vie pour dire ce qui est dans mon cœur, et c’est pour toi, pour un être d’exception qui m’a fait connaitre Reiki voilà un peu plus d’un an. J’étais pleine de colère et de haine et recouverte d’une carapace de protection que tu  as fissurée avec la magie de reiki particulièrement ce weekend. Au fils des mois vous m’avez appris à accepter et surtout à pardonner, chose qui me semblait impossible pour moi en septembre 2014. He ben toi tu y es arrivé et pour ça je voudrais te faire un cadeau virtuel mais important à mes yeux : c’est le premier morceau de cette carapace qui se trouve au niveau de mon cœur. Je te remercie de tout ce que tu as fait pour moi. Les niveaux 1 et 2 de  usui et komyo ont été fort en émotions mais le niveau 3 usui a été une explosion de bonheur et d’amour partagés avec tout le groupe. J’espère avoir encore besoin de toi pendant très longtemps. Encore Merci Merci Merci…….
***************

Angoisses

V – depuis hier matin, des angoisses me remontent… (notamment liées à mes dépressions d’il y a des années). je suis d’habitude assez sensible aux angoisses mais là c’est un niveau au dessus. j’ai du mal à faire la part des choses entre ces émotions « habituelles » et ce qui pourrait faire partie des évolutions d’après initiation. Quoi qu’il en soit, c’est probablement pour moi le moment de dépasser certaines choses (dont certaines que je croyais déjà dépassées…). Est-ce que ça peut faire partie des symptômes des 21 jours ? As-tu des conseils pour les gérer ? Pour l’instant, je tâche de les accueillir sans trop m’y accrocher, et en prenant du recul et en posant mes mains là où je ressens le malaise. Mais puisque je suis une angoissée de nature, forcément ça me tracasse un peu. Merci de tes conseils !

 

Dom – oui, ce qui t’arrive est normal….appelle le « symptôme de guérison ». le reiki te montre des angoisses. les angoisses ne sont pas des émotions mais des signaux. Elles te signale qu’il y a une peur que tu ne vois pas. Accepte l’angoisse et avec l’aide du Reiki, du Symbole, du 1er des Idéaux ; demande à VOIR quelle est la peur ? De quoi as tu peur ? Et accepte cette peur, elle est légitime.

Une fois cette peur reconnue, acceptée et nommée, tu peux aller consulter une sophrologue ou un acupuncteur. le tout en continuant le Reiki, en commençant par la prise cosmique 15mn ts ls jours jusqu’à apaisement. Et je te conseille d’écrire tout ce qui te fais peur, dans le but de le sortir. En cas d’urgence si tu te sens submergée, appelle de ma part ma praticienne associée : Kat Massié.Praticienne Reiki Usui niveau 3 avancé et Karuna niveau 2.Massage aux huiles essentielles/Shiatsu/Fleurs de Bach
06 74 03 77 87   /   katerine971@hotmail.fr

…..elle a comprit, continué les auto soins et c’est un peu apaisée puis a appellé Kat qui lui a fait 4 jours de soins Reiki mixés avec les fleurs de Bach. Aux dernières nouvelles V, était beaucoup mieux.

**************************

Je ne cherche pas a l’expliquer juste a témoigner.

Hier soir au coucher tristesse que j’accepte je me laisse le droit de
ressentir cela et le droit de verser ma larme.
Mini séance de Reiki sans rien demander à mon « ange gardien » et ce
matin je repense à ce qui me rendait triste hier plus rien plus de
douleur plus de ressentis ni bon ni mauvais.
juste un sentiment de paix.
C’est fabuleux!!!!
Merci Reiki.

*******************

Et voili !

Un patient a 19h ce soir celui de l’opération du cancer de la prostate. Je fais comme tu m a conseillé et je me prépare avant comme tu m a appris….

Après la séance il y avait comme une atmosphère d’amour fraternel….

Il m’a serré fort et ma dit merci bon je suis croisée avec une madeleine alors j’ai versé ma larme et j’ai remercié le monsieur et reiki….

C’est fort. Merci

******************

 

Jeudi 24 Septembre 2015

Colère

Question  – Je ne pensais pas avoir des questions sans réponses aussi vite après le stage mais…J’ai vraiment ressenti une grande connexion, très belle lors du stage. J’ai poursuivi à la maison, avec moins d’intensité mais cette même sensation d’apaisement. Problème, aujourd’hui c’est la colère qui ressort, et pas une petite colère. D’un point de vu très logique, j’ai beaucoup de stress en peu de temps (préparation des examens et pas assez de temps pour bosser,  un ado qui s’affirme et notre chambre, que je considère comme un havre de paix qui est inondée pour la seconde fois donc gros travaux en perspective). Mais cette colère me semble venir de plus loin, elle est quasi irrépressible. Je retrouve un sentiment que je connaissais lorsque j’étais ado, une montée de colère sans raison apparente et violente. Je la ressens également au moment de faire le Reiki, je suis donc obligé de faire un effort de volonté. Je préférerai que ce soit plus fluide mais je ne sais pas comment faire, ni comment  » guérir » cette colère…Y a t’il un lien avec le stage ? Une résistance ? quelque chose à comprendre ? ou je prends de la valériane et je vais me coucher ! lol…    Merci d’avance de ton attention.

Dom, réponse – bonsoir S…..je te réponds vite…avant que tu ne te mette en colère contre moi….lol…mets ceci en pratique ;

1 – Prise cosmique / 15mn ts ls jours…et…

2 – L’intégration : au coucher : un soir cheville gauche sur droite (poignets l’inverse) et le lendemain soir tu inverses.

bon, c’est plutôt de la rage que de la colère ( vois la différence sur le net ) je te passe ce lien vers un site précieux à mon travail : http://www.redpsy.com/guide/colere.html

il s’agit sûrement de mémoires accumulées, accumulées depuis la petite enfance. Des émotions entassées les unes après les autres, des non dits, des « ça me gonfle » non dégonflées, refoulées, détournées…..la clé est l’acceptation. ça génère une grande force spirituelle de transformation. mais ça ne suffit pas bien sûr. trouve des moyens de l’évacuer ; va crier dans la foret, dans la voiture, au bord de la mer. De vielles mémoires, anciennes vies, qui viennent cette année pour être libérées et préparer ton avenir !!!! Accueille et bénis la vie !!!! tu vas apprendre quelque chose de Grand. Ecris sur tout ce qui t’irrite, t’agace, te mets hors de toi et en écrivant ne retiens pas tes mots ni tes émotions ni tes larmes….l’écriture libère. Le Reiki te montre qu’il te faut évacuer le trop plein de l’asthme, évacuer ce qui t’étouffait. Dis merci à ta colère, dis lui « je t’aime merci ». Et vas y aussi avec les tisanes, ça aide et c’est bon. Tiens moi au courant.

***********************************
L’horreur ! 

Question – Le 9 juin 2015 22:32, P…. <P…@free.fr> a écrit :

Alors que je m’étais endormie la fenêtre ouverte et les rideaux tirés, j’ai été réveillée par le bruit des rideaux que l’on déplace. J’ai ouvert les yeux et j’ai vu un homme accroupie sur le rebord de la fenêtre qui s’apprêtait à rentrer dans ma chambre. J’ai crié, ce qui l’a fait fuir. Je ne te dis pas dans quel état de choc je suis ! J’ai fermé tous les volets mais je n’ose plus aller me coucher. Quelle froussarde je suis.

Dom, réponse – quelle horreur ! j’aurais crié tout autant….tu es au rdc ? t’es sure que c t pas un rêve ? de toute façon ; c’est un Bon signe ! ça prouve que tu es protégée. Pourquoi ? Parce qu’il ne t’est rien arrivé du tout. Tu n’as été ni agressée, vi violentée…(…sic) ni blessée, ni volée….Le Reiki, avec la protection CKR c’est comme s’il t’avais montré  « vois, tu peux vivre pleinement, tu ne risques rien je suis là ! Je suis CKR. la seule chose que tu risques c’est une bonne frousse. Mais ça, vous humains vous aimez ça. » Qui a permis qu’il y ait assez de bruit pour te réveiller ? Le Reiki. Crois tu que si tu avais eu besoin de vivre une agression (citée ci haut) le Reiki aurait permis que tu soit réveillée et que tu puisse crier ? Non, sûrement pas. Or, ceci prouve que tu n’as pas a vivre ça, donc, tu ne le vivras pas. Tu es Initiée P…, ne pense qu’à ça et active le plus souvent possible CKR.

*******************************
Angoisses

Q – Bonjour Dom, depuis hier matin, des angoisses me remontent… (notamment liées à mes dépressions d’il y a des années). je suis d’habitude assez sensible aux angoisses mais là c’est un niveau au dessus. j’ai du mal à faire la part des choses entre ces émotions « habituelles » et ce qui pourrait faire partie des évolutions d’après initiation. Quoi qu’il en soit, c’est probablement pour moi le moment de dépasser certaines choses (dont certaines que je croyais déjà dépassées…). Est-ce que ça peut faire partie des symptômes des 21 jours? As-tu des conseils pour les gérer ? Pour l’instant, je tâche de les accueillir sans trop m’y accrocher et en prenant du recul et en posant mes mains là où je ressens le malaise. Mais puisque je suis une angoissée de nature, forcément ça me tracasse un peu. Merci de tes conseils ! Bises, A bientôt,

Dom – oui, ce qui t’arrive est normal….appelle le « symptôme de guérison ». le Reiki te montre des angoisses. Les angoisses ne sont pas des émotions mais des signaux. Elles te signalent qu’il y a une peur que tu ne vois pas. Accepte l’angoisse et avec l’aide du Reiki, du Symbole, du 1er des Idéaux ; demande à VOIR quelle est la peur ?De quoi as tu peur ? Accepte cette peur, elle est légitime. Une fois cette peur reconnue, acceptée et nommée, tu peux aller consulter une sophrologue puis un acupuncteur. Le tout en continuant le Reiki, en commençant par la prise cosmique 15mn ts ls jours jusqu’à apaisement.

Je te conseille d’écrire tout ce qui te fait peur, dans le but de le sortir. L’écriture libère et informe sur soi. 

En cas d’urgence appelle de ma part ma praticienne associée : 
Kat Massié. katerine971@hotmail.fr 
Praticienne Reiki Usui niveau 3 avancé et Karuna niveau 2
.
Massage aux huiles essentielles/Shiatsu/Fleurs de Bach
06 74 03 77 87   elle se déplace à domicile !

…suite…

Q – Après mon tsunami d’émotions négatives, vendredi ça a commencé à aller beaucoup mieux : ouf!

Dbonjour A…  je savais que ça ne durerait pas, mais je suis soulagé pour toi !!!

Q – J’ai vu Kat cet après midi, qui m’a fait un soin, ce soir, du coup je peux dire que ça va bien. Merci de m’avoir orientée vers elle, elle m’a bien aidée et elle est rayonnante !

D – je l’apprécie et la conseille aux cas d’urgences….!

Q – Cette semaine était très très chargée pour moi avec des déplacements, beaucoup de réunions et a posteriori, je me dis que j’aurais surement attendu un moment plus calme pour faire le stage si j’avais su qu’il pouvait se produire ce qui m’est arrivé.

D – non ! tu as fais le bon choix. souvent c’est dans le chaos que l’univers veut nous faire comprendre qu’on doit se prendre en main !

Q – Ceci dit, je ne regrette rien, cela m’a confrontée à cette épreuve certes difficile, mais riche d’enseignements et que c’était surement le moment pour moi de m’y confronter.

D – tu es courageuse…l’univers le savait !!!
**************************************
ha ! les autres ! Grrrrr

Q – Je voulais te parler de qqch qui m’a fait dresser les cheveux de la tête. Je viens de terminer ma formation de massage lomi lomi et lorsque je l’ai apprise au niveau de la tête il y a les mains à poser sur les yeux, ils racontent qu’on fait du Reiki!!!!

D – je sais…..dés qu’on fait du bien aux autres, qu’on se fait du bien, les gens disent Reiki. C’est parce qu’ils ne connaissent pas le mot juste qui pourrait parler de ce qui se passe lorsqu’ils font ça. Alors Reiki, c’est un mot tout cuit, prêt à servir. 
Q -A la fin j’ai discuté avec la formatrice qui m’a dit qu’elle avait fait du Reiki à sa mère tous les jours. Elle lui posait les mains sur différentes parties du corps mais ne sait pas trop ce qu’elle faisait….
D – c’est du magnétisme, mais chuuuuuttttt ! douceur et lâcher prise…on ne peut pas conquérir le monde.
Q -Elle m’a dit qu’elle n’a jamais été formé au Reiki !!!!
D – lorsqu’on masse beaucoup, lorsqu’on fait beaucoup de Qi Gong on a une belle énergie qui circule par les mains et qui soigne, souvent autant presque que le Reiki. Bien sûr c’est pas correct de dire que c’est du Reiki, mais ce sont des gens qui ne savent pas ce que c’est que le Reiki puisqu’ils n’ont pas fait l’initiation. mais toi tu sais, alors SHK et humilité. Travaille ce qui te dérange. Ainsi tu pourras le retransmettre lorsque tu enseigneras le Reiki…
Q – Je trouve quand même un peu déplacé de parler comme ça du Reiki ou alors mieux, j ai entendu des pers dire qu’elle pratiquaient du Reiki pendant les massages sans avertir le massé…
D – idem, si la masseuse n’est pas initiée au Reiki, c’est pas du Reiki, donc l’énergie qu’elle leur donne ne fera pas les mm effets que le Reiki, elle n’ira pas à la cause, elle traitera juste le physique, pas l’émotionnel, donc pas besoin de prévenir.

********************************
Cher Dom,
Je remercie tous les jours l’univers d’avoir fait croiser nos chemins.
La personne que j’étais, qui voulait sauver le monde a fait du chemin depuis bientôt 5 ans. J’ai en effet compris qu’il fallait me guérir avant de vouloir soigner les autres. Petit à petit les nœuds se sont dénoués, les liens sont devenus plus souples les larmes ont beaucoup coulé et coulent encore…….Mais quel bonheur de se sentir libérer, de sentir ce poids qui m’étouffait se retirer. Je respire enfin !!!! Comme tu le dis en stage, avec le Karuna les épreuves sont devenues des expériences. Oh combien d’expériences remplissent ma vie !  Douloureuses mais aussi merveilleuses !!!
En écrivant ces mots qui coulent tout seul je me repasse le film de ma vie. Je n’aurai jamais pensé atteindre cet état de paix. Un jour décembre 2010 …… Sur mon chemin ….. J’ai croisé un merveilleux maître enseignant reiki Karuna. Il est parfois direct mais surtout il est humble et rempli d’amour.
Merci DOM de m’avoir initiée.
Merci REIKI de m’accompagner.
Merci les ANGES Karuna de veiller sur moi.
J’AIME LA VIE. B

************************************************
Tristesse 

Q – Le 1 juillet 2015 09:12, <sandrine……@xb….fr> a écrit :
Coucou dom,
Aujourd’hui j ai le cœur rempli de tristesse:(la raison, le manque de correction des gens qui m’entourent qui on toujours une bonne excuse) j’essaye de faire preuve de compréhension, mais ou se trouve la limite…mais je me suis dit « qui mieux que dom pour me tirer un sourire….
ton humour et ta gentillesse  me réchauffe le cœur » .

D – Je te comprends Sandrine……. j’ai connu la tristesse toute ma vie, comme un clown bipoilant ; rire et tristesse. Un jour, de la comprendre suite à une rupture, elle m’a sauvé la vie. Aujourd’hui je ne suis plus triste. Sauf parfois, les gens qui souffrent trop…mais la tristesse est devenue mon alliée, l’alchimiste du deuil. je te passe ce lien, jette y un œil   http://www.redpsy.com/guide/tristesse.html

Mon opinion ; vois dans l’ADN de ces gens qui « te dérangent » ; leur programmation n’est pas celle de ton ADN en train d’être reprogrammée grâce au Reiki, tu as un niveau élevé maintenant, Reiki 3….songe que la réincarnation des âmes et des âmes est une succession….non une formation ou tous ensemble on apprend les mm choses en mm temps. Ceux là apprendrons plus tard, p’tr’ lors de cette vie, dans une autre ou dans d’autres vies….En vertu de ce principe ; travaille sur toi sur « ce qui te dérange » : où est ce que ça te dérange ? d’où est ce que ça peut venir ? et trouve la technique Reiki adéquate pour guérir la cause.
Le dérangement = la conséquence.
Une pensée négative, ou une mémoire négative = la cause.
La cause engendre la conséquence.
Et la conséquence peut s’aggraver, devenir maladie, accident, névrose, révolte colère et pire…

************************
Acceptation et passez muscade

Q – Je suis bien rentrée mais avec pas mal de péripéties… La dernière ce matin a l’aéroport. J embarque ( la dernière alors que ce n est jamais le cas) et la, la nana me refuse et m oblige a mettre mon sac a main dans ma valise car valise et sac ça fait 2/bagages a main. Si je ne le fais pas la valise partira en soute et sera facturée 55€.
Là,  je fais appel au symboles ; distance, mental et ce beau symbole du cœur Reiki pour garder mon calme ( merci Reiki) et je prends tout mon temps car je sais que ca ne passera pas. Au bout de qqs min, la nana furieuse me dit : bon c est bon, allez y comme ça, vous n allez pas retarder l avion, les hôtesses ferment les portes….
Merci Reiki !!!!

D – bravo ! Désormais l’idéal de Reiki n°1 « ne te préoccupe pas » est amplifié par les symboles du  stage que tu as fais !!!

*******************************
Pipelette dans la tête

Ce soir j’emmène ma fille chez son père et c est un vrai moulin a paroles. On discute et je lui dis, si tu parles autant c est pour telle et telle raisons …. Et donc c est une mémoire qui pourrait être enlevée . elle me dit d accord et me répond « mais je suis aussi comme toi !!! » Et là, la réponse me vient : « oui mais si je parle autant ce n est pas pour les mêmes raisons ». Le Reiki intervient et j entend : « tu parles bcp parce-que lorsque tu étais petite, tes parents ne se parlaient pas et donc je parle pour briser ce silence qui m a toujours dérangé ». Moralité : 1 mémoire du passe a transformer en moi.
Merci merci Reiki et merci dom pour ce stage magique car des ce soir je commence le nettoyage de mon enfance. Cette réponse m’ apporte les larmes car j ai compris la façons dont je devais écouter mais surtout entendre ; à l’intérieur.

D – et voilààààààà…merci CKS !

Et tu peux remercier ta fille ; elle a joué « à l’extérieur de toi » son rôle pour que tu entendes la voix de ta fille « intérieure ».

ce n’est pas pour rien que tu as laissé ici ton cordon…..de rechargement de ton mobile à communiquer !!!
je te l’envoie, donne moi ton adresse

********************************
Réconciliation

Q – … – Par ce mail je viens te demander si tu n aurais pas trouve une boucle d oreille que j ai certainement perdu vendredi lors de la soiree partage. Soirees qui sont tellement  pleine de partage de joie etc;;;;
je rends grace tous les jours d avoir mis le reiki  et toi Dom  dans ma vie, celle ci se remplit d amour de lumiere  merci merci merci……
Une véritable thérapie!!!!   moi l assoifee d amour  , de calins de tendresse j ai enfin pris conscience du pourquoi , je me regarde enfin  et je m aime telle que je suis. Merci de cet amour de cette joie de cette lumiere  qui emane de toi .
merci pour ces  beaux stages pour ces soirees. A…

D – C’est le but, l’un des multiples buts du Reiki ; se laisser remplir, d’amour, de joie, de compréhension du mal pour l’éduquer et enfin ne plus juger, ne plus jalouser, juste observer ce qui « avant » dérangeait et rayonner.

***************************
ça va mieux….

Nouvelles de notre doyenne Praticienne Reiki 1 initiée ce printemps, 88 printemps…

Grâce à l’autosoin Reiki les gestes quotidiens qui me semblent moins dérisoires (« à quoi bon »? )

D – la pleine conscience qui re-germe en toi, l’unité avec le tout qui se reconstitue

Ma marche est un peu plus assurée, moins inégale,

D – aller de l’avant est le seul but de l’univers

Plus de calme intérieur tout au long de la journée.

D – j’en suis divinement heureux pour toi….

******************************
L’intégration

Q – en cour d’une soirée Reiki j’ai appris une technique d’intégration, mais par manque de temps on n’a pas trop développé sur ce sujet. Donc je suis allée sur le internet je suis tombé sur un site qu’ils parlent que s’est bien pour les personnes qui ont du mal à s’exprimer ( c’est mon cas) et sa me pose beaucoup de problèmes à mon sujet. Je suis au niveau du 3e degré Reiki. Je le pratique depuis mercredi tous les soirs dans mon lit mais je sais pas ce que je doit prononcer comme phrase et quel signe, pour le moment je fais les symboles SHK DKM CKR . Donc je viens à vous pour que vous m’en disiez davantage et que me conseillé vous. C’est un gros handicap. pour moi j’en souffre énormément. Merci pour votre aide
Jocelyne

D – Bonjour…suite à votre question…l’intégration est simple :
Sur autrui :

1 – Le patient est allongé sur le dos.

2- Sa cheville droite sur la gauche.

3 – Ses bras croisés sur sa poitrine (ses mains sont proches de ses épaules).

4 – Nos mains de praticien sont posées sur les cotés du dessus de sa tête.

5 —————–Traitement de l’Esprit avec tous les symboles  selon le niveau de votre pratique  = 20 minutes……

6 – Changez les croisements des chevilles et des bras (inversez)

7 – Continuez 20 minutes ce traitement Reiki.

 ———-  Plus vous chanterez les Kotodamas, plus votre soins sera efficace.

Sur soi : 1 – On croise idem ; cheville l’une sur l’autre, nos poignets, croisés à l’inverse des chevilles – sont sur notre tête, 20 minutes.

2 – On décroise et on inverse, 20 minutes.

pas de phrase à prononcer exceptées les mantras des symboles dans cet ordre (selon le niveau de votre pratique) : HSZSN – SHK – SKSK – CKR  – DKM   – 3 FOIS LE MANTRA DE CHAQUE  SYMBOLE !

et bien sur, vous vous faites un envoie a distance durant 63 jours avec par exple cette prière :  « je m’exprime librement et joyeusement ».

si un jour vous passez par ici, je vous initierais au symbole de la gorge et vous guiderais pour neutraliser puis transmuter le blocage de communication. 

**********************************
Bonne volonté

Q – …. »bonjour, après des années de questionnement, j’en suis arrivée à me dire que la bonne volonté et la sincérité ne suffisent pas à changer ce qui en nous nous conduit à commettre des erreurs. Il me semble indispensable de bénéficier d’une aide pour sortir du labyrinthe. Encore faut-il qu’une telle aide croise notre chemin. Pour cela, j’ai cru comprendre qu’il fallait que notre intention soit authentique mais si no us sommes en pleine confusion comment avoir une intention claire et donc trouver cette aide ? C’est le poisson qui se mord la queue ».

D – Bonjour…pour tenter de répondre à votre commentaire laissé sur le site…Tout dépend ce qu’on va appeler « bonne volonté ». Je dirais volonté de comprendre ce qui fait faire et refaire les mm erreurs. Comme vous l’exprimez vous mm, il faut une aide. Oui mais l’aide d’une personne d’envergure ! voilà ce qu’il faut souhaiter, demander, exiger de L’univers. Exiger dans le sens « décision ferme de changer ». C’est cette façon de demander et d’obtenir que j’enseigne en mm temps que le Reiki.
Quand à la confusion, elle se dissout avec la pratique du Reiki et des 5 idéaux combiné à l’activation de CKR, du symbole (Saint bol…avoir du bol…lol…!…) dés le 1er niveau Usui ou Komyo pour aller dans l’infinité. Plus tard (3 mois) avec les outils et symboles du 2ème degré Reiki, pour des outils plus performants afin d’aller dans la profondeur.
Et savoir que chacun a un rythme de changement et de résistance au changement qui lui est propre….mais si on pratique, ça change en dedans et autour de soi, c’est absolu.

****************************************

 

******************

Jeudi 14 Mai 2015         Punition dénonciation trahison

B : Je me trouve face à la prise cosmique qui m’appelle, colère et peurs, voilà ce qu’il me faut…. Et bien oui, une histoire de mon enfance revient à la surface et correspond à ce que j’ai vécu hier. Un grand merci pour l’aide que tu m’as apporté hier.

En classe de 5ème j’ai eu un professeur de maths qui venait de prendre sa retraite de l’armée, avant de pouvoir nous enseigner il faisait son cours pour lui par manque d’expérience, toute la classe s’est ennuyée ce qui fait que nous avons décidé d’enregistrer un de ces cours (sans le prévenir bien sur, le but était de lui faire écouter le lendemain afin qu’il se rende compte combien il ne nous apprenait rien) et je me suis portée volontaire pour apporter le magnétophone de mes parents (sans leur dire bien sur !). Ce fait remonte à la même période de l’année, au mois de mai. A la fin de ce cours , une fille (Laurence Baumann) de la classe est allé lui dire, de là, ce professeur est allé à la gendarmerie pour porter plainte comme quoi nous étions des espions !!!! La directrice du collège m’a convoqué et m’a mis des heures de colle…. Je ne peux pas décrire la peur dans laquelle j’étais face à mes parents, et aux  adultes du lycée. Comme d’habitude à la maison aucun mot de réconfort, par contre la directrice m’ a supprimé mes heures de colle en voyant dans l’état dans lequel je me trouvais, je pense que la « punition » a été et est encore aujourd’hui face à la situation d’hier de faire mon chemin de conscience, j’ai tous les outils nécessaires pour cela, EXISTER et prendre ma place sur cette terre….

Merci et belle journée

Dom : une émotion remonte à la surface, submerge, et ça créait une crise. En effet la prise cosmique est idéale et va calmer la crise. Par contre, pour guérir la mémoire du traumatisme vécu « dans le passé », ça coule de source ; tu fais la technique « guérison dans le passé »…tout simplement ! Il conviendra que tu la fasse 5 ou 6 fois – étalée sur 2 semaines, elle prend 3 minute à peine – sur les 5 ou 6 événements tels que tu les décris…jusqu’à ne plus ressentir d’émotion dérangeante.

**********************
Infection pulmonaire

V : Je viens de me guérir d’une infection pulmonaire et comme tu me l’a expliqué j’ai compris que je me suis laissé infecter par mes proches, ma famille, ma sœur plus exactement. Je voudrais me faire un envoie à distance pour ça et je ne trouve pas la phrase qu’il faut. Tu comprends je veux me guérir mais je ne veux pas que mes proches en souffrent, tu peux m’aider s’il te plaît ? Merci.

D : quand tu dis « je ne veux pas que mes proches en souffre » c’est comme si tu disais « je préfère souffrir à la place de mes proches ». Ça veut dire « je n’ai pas ma place dans ma famille, je ne la mérite pas » alors ils viennent te le rappeler en t’envahissant et comme tu ne t’autorise pas à leur dire « NON PAS MAINTENANT », tu te laisse infecter par peur de ne plus être aimée.

En Qi Gong les poumons représentent la famille et la protection c’est le tigre blanc.
Tigre = agressivité – blanc = qui est libre de toutes obligations terrestres.

Avec le blanc, il y a une correspondance avec le chakra de la gorge ; la liberté d’expression.

Agressivité blanche = Non, pas maintenant, merci = Fermeté et douceur, le meilleur antiseptique !!!

L’amour, s’aimer, c’est et ne peut être qu’inconditionnel !

C a d   « je me libère inconditionnellement de toutes pensées incompatibles à la libre expression de mes sentiments et de mes vrais désirs, dans ma vie en général et dans mon entourage familial. J’en suis rayonnante de joie et de générosité nouvelle. Merci « .
Et n’oublie pas de mettre CKS, Gnosa et Iava en avant !

******************
Reiki et protection physique

S : j’ai fais un soin à une dame qui souffrait d’une sciatique. Dés le début du soin j’ai senti une pression au niveau du chakra du cœur qui ne m’a pas lâché.je lui en ai parlé après et elle m’adit qu’elle avait un blocage de ce chakra. Je lui ai donc fait un rééquilibrage des chakras et la pression a peu à peu disparu. Existe t il une méthode pour que je ne ressente plus ce genre de douleur ou est ce normal ?

D : La méthode existe oui ; révise le cours du stage, relis le paragraphe dans le manuel Reiki 1er degré de Planète Reiki !
C’est un soin quantique le soin Reiki ; vos énergies, vos chakras sont mêlés avec la patiente, une fusion émotionnelle d’amour et de compassion inégalable. Et la compassion se tisse avec l’empathie, inévitable. Vous venez en stage pour aider les autres, le Reiki vous apprend la compassion par le ressenti. Il convient d’être présent en pleine conscience lors d’un soin Reiki, être à l’écoute des sens, des sensations. Et des Signes !
Ce que tu as ressenti est un Signe. Un message non verbal que ton corps t’a adressé « écoute S…, cette personne ressens ‘ça’ : un blocage au chakra du cœur ».
Si on n’écoute que le mental, on s’affole et on se dit « haaaa, j’ai choppé une douleur dans le cœur » et ça, ce n’est pas de la compassion, c’est de l’apprentissage.
La vie de l’apprenti   sage   en devenir.

Donc, à l’avenir, accueille les sensations et dis toi « tiens, c’est peut être ça que le personne ressens. Je vais m’occuper de cette zone sur elle » et tu verras, ça disparaît de suite.

***************************

Le pied !

Question : j’ai une douleur au pied, comme une épine dans le talon  gauche.
Dom, Réponse : Le talon ; ta structure, la base de ce que tu es, d’ou tu viens, c’est sur ça que tu t’appuie pour marcher et avancer.
à gauche : cœur = une peine de rajoutée (à ceci ci dessus).

Q : Ce soir, je rentre du travail, encore une entorse à la cheville toujours à gauche.

D : entorse = ligaments : liens, engagements, ce qui te retient…

à la cheville : te sens tu retenue dans un engagement ? Dans un ou des principes ? Alors que peut être tu préférerais avoir du temps pour toi…
gauche : cœur = une peine de rajoutée (à ceci ci dessus)

Q : J’ai un problème de pied récurrents…..

D : Pieds : compréhension de soi et des autres pour avancer.

Q : Reiki depuis 30 min, ça n’a pas l’air de gonfler plus On verra demain.

J’ai du mal à marcher? avancer?  Je m’arrête moi-même?  Je ne sais pas trop ce que je dois comprendre.

D : Ce sont des principes inscrits dans ta mémoire, des liens tissés avec quelqu’un, ou avec l’employeur…tu dois te retenir surement au lieu de lâcher et d’aller de l’avant, écouter son cœur ; aller vers ton but.

************************
Les mains sèches.

Q : Quelques mots pour te donner quelques nouvelles ! Ce week end d’initiation a été pour moi très intense et très fort plein de résonances ! Une véritable philosophie de vie qui correspond à mes attentes spirituelles. je pratique le Reiki depuis au quotidien sur moi si bien que je n’arrive pas à ma lever le matin. Est ce normal ? J’ai aussi pratiqué sur des proches autour de moi et ça à l’air de fonctionner puisqu’on  m’en redemande !
Le seul problème c’est que j’ai les mains qui sont très très sèches.

D : pour l’instant, le Reiki fait rejaillir ce qui a besoin d’être vu ; peut être un manque de sommeil à rattraper, peut être en fais tu trop (faire faire faire) et besoin de prendre le temps de se détendre, ou bien peut être un manque de motivation pour se lever chaque matin, quelque chose en toi effondré qui serait à remonter….ce sont des suggestions…
Quand à la peau sèche elle peut traduire un sentiment de crainte d’être jugée sur ce que tu fais, que tu touche, que tu manies (manipuler =main)…

Et n’oublie pas ; bois un grand verre d’eau après un soin.

**************************
Menstruations

Q : Le Reiki peut il faire qu’à une amie à qui j’ai fais un soins ait des douleurs plus fortes pendant ses règles ?

D : et oui, des fois le soleil peut mettre en lumière des zones d’ombres !….les menstrues représentent la féminité à assainir, à nettoyer, à harmoniser….et les femmes en France ont du mal avec « ça »…..alors le Reiki vient « déranger » pour les aider à mieux comprendre. Système du travail et de la production, toujours aller vite, là encore, manque de connaissance du symbolisme.
solution : continuer les soins Reiki sans relâche durant 4 jours ou plus, jusqu’à résultat. Guider la personne si possible vers quelqu’un qui l’aidera à mieux assumer sa part féminine.

***************************
Menstruations bis

X : Je pratique le Reiki en auto-traitement, régulièrement depuis 6 mois. Je souhaite vous faire partager mon expérience du Reiki face à la douleur ! Un exemple, J’avais  d’intenses douleurs lors de mes cycles menstruels! De fortes doses de médicaments Antadys et piqure de viscéralgine forte étaient mon lot!

Depuis que je pratique le Reiki, je ne prends plus que très rarement voire très peu de médicaments! Dans les moments d’intenses douleurs, il me suffit de positionner mes mains sur mon ventre. Dés le 1er contact, je ressens déjà une apaisement. La douleur s’affaiblie, je crois qu’elle est bientôt partie, mais elle revient, je reste un moment en répétant CKR, et je demande à l’univers de me faire vivre, l’apaisement de la douleur et qu’elle cesse définitivement!

Au bout de 20 minutes, je ne ressens qu’un souvenir de cette douleur. Mon ventre est paisible et doux. Je peux vaquer à mes occupations, tandis que toute douleur à disparue. Ainsi, je voulais vous dire que de 6 ou 8 Antadys par jour pendant 8 jours, il peut m’arriver, aujourd’hui d’en prendre qu’un tout au long du cycle !!! Je dis GRATITUDE AU REIKI! MERCI A MOI MERCI AU REIKI. NAMASTE!!!!!!!

***********************
Rétention d’eau

Q : Le 12 mai 2015 05:31,  <chris@….> a écrit :

Bonjour Dom quel est le soin le mieux adapté pour une personne qui fait de la rétention d’eau ? Merci d’avance pour tes indications . A bientôt fin M… pour stage Reiki 2. Bonne journée. C.

D : Bonjour C. Les problèmes liés à l’eau concernent le 2ème chakra, donc les émotions. Cette personne retient ses émotions.  à quel sujet ? Pourrait elle préciser ? Quelle partie du corps est touchée ? C’est cette partie du corps qui indiquera ou se situe la cause. la rétention n’est que la conséquence. il y a peut être une peur d’exprimer, peur de dire…
Personnellement Je travaillerais en soins Reiki sur l’esprit ; toute la tête et la gorge ; 30 mn.
Puis 6 à 9 mn sur le chakra du cœur et sa région.
Et terminer sur le bassin/bas ventre….Ce traitement au moins 4 jours de suite, jusqu’à résultat quoi !
*************************
Q : Juste pour vous remercier de l’échange en fin de soirée partage sur la crainte que mon petit papillonna virus revienne me titiller, et bien depuis je suis en attente de mon frottis donc physiquement ça va pas mieux ,mais moralement je vais très bien. Le fait d’en avoir parlé j’ai entendu vos conseils, donc beaucoup réfléchi sur le problème et dans la nuit du vendredi au samedi, j’ai rêvé que Dom ouvrait un bouquin et me montrait le nom de ma maladie « le syndrome d’A… et un nom suivait imprononçable!!! j’en ai conclue en me réveillant qu’il fallait que je bosse sur mon mental et j’ai commencé la guérison du passé pendant mon auto traitement, j’ai des outils maintenant à moi d’en faire bon usage. Encore merci pour votre générosité et votre gentillesse. A….

****************************
Je pratique l’auto-soin régulièrement, j’utilise les symboles régulièrement dans la journée…. SHK est devenu mon nouveau meilleur ami!

Au début, j’ai ressenti beaucoup de tristesse et ensuite j’ai enfin ressenti ce sentiment de joie et d’être « guidée », et ça fait un bien immense.

J’ai programmé également 4 cristaux ; j’ai obtenu de bons résultats sur mes réactions face à l’incompréhension des autres….je me sens plus sereine…
****************************
Les animaux 

Q : Comment fais t on pour donner du Reiki à un animal qui a une maladie ?

D : pour le traitement d’un animal c’est pareil que pour un humain ; l’esprit d’abord, donc toute la tête et la gorge – les animaux ont aussi des chakras et une aura, penser à traiter l’aura et les chakras !! et le corps ensuite….et on s’adapte aux postures de l’animal …

****************************
Acnée 

Q : Mon fils à de l’acné, puis l’aider avec le Reiki ?

D : l’acné vient d’une abjection de soi….tu traite le visage 15 à 20 mn…..plusieurs positions sur le visage….et si tu peux ; traitement complet, sinon : tête / cœur / bas ventre. et ce, pendant 4 jours d’affilé voir plus si nécessaire.

et tu photocopie l’estime de soi du livret Planete Reiki 1er degré,  et tu lui donne à lire : à voix haute chaque soir avant de dormir pendant 21 jrs…de ton coté prépare toi à accepter que ton fils va changer suite a ces traitements Reiki.

******************************
Médiumnité « la chasse aux sorcières ».

X : Il est important pour moi (que ce soit les Ateliers ou les initiations) que cela se passe dans un certain cadre : le respect du protocole (sinon ça part dans tous les sens).

D : De quoi s’agit il, pour vous, lorsque vous évoquez « le respect du protocole », pour vous…?!

X : Que le Maître Reiki soit capable de guider les gens en stage, que ce soit au niveau des réponses aux questions posées ou aux émotions qui peuvent jaillir en cours, par exemple.
D : Je suis animateur depuis plus de 20 ans et je ne sais pas faire autrement que d’être connecté en permanence à Mes Guides Reiki quand j’anime, sinon j’aurais aretté depuis longtemps. Etre canal, c’est la merveille du Reiki.

X :J’ai noté ceci : « Les ateliers ont lieu le vendredi, le prochain est consacré au chakra Ajna, le centre du discernement, le 3ème oeil, le vendredi 24 Avril, de 9h30 à 17 h »
= c’est très lourd de sens pour moi. Je m’explique. Depuis trois quatre semaines environ, j’ai la sensation qu’il se produit chez moi, au niveau du 3ème œil, quelque chose de nouveau … exemple : une personne se met à côté de moi, je ne la connais pas et je me mets à lui parler de son anniversaire et du gâteau au chocolat qui allait accompagner cette fête. Et comme par hasard, son anniversaire va effectivement avoir lieu dans les 48 h, et elle est en train de cogiter sur le fait de faire un gâteau au chocolat … idem, la semaine dernière, une personne approche sa main de la tête d’une autre (y), et tout d’un coup j’ai des pensées de problèmes de santé relativement à la personne (y). Quand je ferme les yeux et que je regarde la zone du 3ème œil, je vois un œil au milieu et il est à chaque fois différent (je ne voyais pas cela avant).
Pour l’instant, je mets cela sur le compte de l’intuition … mais je ne sais pas encore.

D : je m’interroge depuis plus d’un an car ces « phénomènes de médiumnité » sont de plus en plus fréquents, y compris d’autres cas ;  les personnes « envahies par des entités négatives« , ou celles qui voient des « fantômes » ou des « revenants« , entendent des voix, ressentent des choses….etc…de plus en plus nombreux.
Certaines personnes mal avisées, qui ne pratiquent pas le Reiki c’est sur, prétendent que le canal Reiki facilite l’entrée d’entités dans la personne initiée au Reiki…c’est impossible ; le Reiki c’est de l’amour inconditionnel. Les entités ne peuvent entrer que chez les personnes ayant des pensées très négatives. Et le Reiki est idéal pour rétablir les pensées et « chasser » d’éventuelles entités.

Par contre, ce que je pense, c’est qu’entre 1643 et 1644, le pouvoir des médecins et des pharmaciens était menacé par des gens comme nous ; médiums, herboristes, rebouteux, guérisseurs, liseuses de cartes et de filtres, les chamanes françaises….on les avait nommées sorcières car ça dérangeait le pouvoir. Et ça dérange là ou va l’argent, toujours. Ce pouvoir là. Ce fut un tragique et regrettable génocide ; « la chasse aux sorcières ».

Aujourd’hui, après 400 ans de terreur, nos âmes peuvent enfin « revoir clair ». Comprenez vous ? Le 3ème œil est moins voilé par la peur de la mort infligée violement. Car ce qui, entre autres choses, empêche l’ouverture du chakra frontal, ce sont les peurs obsessionnelles, comme la peur de mourir brûlé, écartelé, assassiné, peurs inscrites dans l’ADN. Et, grâce au Reiki qui agit sur l’ADN, son énergie d’Amour dissout le voile. Et aujourd’hui, le problème vient du manque de connaissance puisque à l’Ecole Nationale On n’enseigne pas la médiumnité…..donc, lorsque ça leur arrive la plupart de gens en ont peur.

*****************************

février 2015 Demandez, je réponds

Un grand Merci à toi de prendre le temps de nous lire et de nous répondre avec sincérité et un grand Merci également pour ton intervention sur mes poumons en souffrance lors de la soirée partage! Très bonne soirée et semaine. Amour, Paix et énergies positives made in my heart!!!

****************************************
Cristal de roche et Reiki

Question  – Je vais commencer un auto traitement à distance longue durée et  je voudrais savoir s’il faut que je nettoie mon quartz à chaque fois que change de tranche d’âge.

Dom – non, tu n’as pas à nettoyer le cristal puisque tu n’y mets aucune autre intention que les symboles. Simplement fais SHK dessus avant de commencer pour renvoyer les basses vibrations éventuelles à la terre, puis CKR. Ensuite laisse le reposer le temps juste de faire ton papier, et vas y, charge le de ton amour et des symboles.

***************************
Colère

Q –   J’ai beaucoup de colère en moi-même alors si, en plus de mes auto-soins reïki, tu peux me conseiller sur la voie à suivre pour l’apaiser, je suis plus que preneuse et motivée!

D – Fais la prise cosmique 15mn tout en récitant tranquillement les 5 idéaux et tu finis les deux mains sur le chakra du cœur…..7 jours de suite et chaque soir tu lis la prière de Luis « estime de soi » a voix haute (les 2 pages) avant d’éteindre la lumière et dormir. C’est une vraie alchimie ! Elle se trouve à la fin de mon manuel de praticien Reiki 1er degré que je donne en stage.
****************************************
Colère, encore….
Q – ce weekend end je me suis sentie très en colère contre moi, contre beaucoup de choses en réalité, je n’ai pas réussis à pratiquer le Reiki pendant 2 jours…puis j’ai compris, à travers la pratique du Reiki et certains échanges lors de discussions que j’étais en colère contre un sentiment de culpabilité que j’ai et que je n’arrivais pas à exprimer et à m’avouer, et tout durant ce weekend end m’a amené à cela…..(j’ai donc appliqué le désolée, pardon, merci, je t’aime!) merci à la vie pour cet apprentissage !!!

D – c’est aussi de cette façon que le Reiki nous préviens qu’on a quelque chose qui cloche ; en nous y mettant bien dedans, comme ça on le Voit ! et on s’en occupe.
Q – « Les événements que nous ressentons comme mauvais sont ceux dont nous ne comprenons pas encore le rôle dans notre formation » nous dit le Maitre Wingate Paine […..] Quoi qu’il arrive dans ma vie je ferai face. Par faire face j’entends: je vais en tirer un enseignement, cela va me faire progresser, je vais trouver une façon de l’utiliser pour enrichir ma vie. » dixit Susan Jeffers dans la Vie à bras le corps.(le fameux livre retrouvé!).
************************
Colère, rage, agressivité….

Q – Depuis quelques jours, j ai l impression de régresser, je suis agressive avec mon partenaire que je n arrive plus asupporter.
D –  le Reiki agit sur la cause profonde. Si il détecte une rage refoulée, enfermée par convenance, le Reiki va la mettre en lumière pour que vous la voyez et puissiez la guérir.
cette agressivité était en vous, quelque part dans un placard de la conscience. à mon avis elle est dirigée vers le père de la petite enfance (quand ??? le 2ème degré permettra de le retrouver) et non envers le compagnon, qui lui joue le rôle de déclencheur….le comprenez vous ?

Q – qu’est il advenu de ma patience et de ma tolérance?..je suis pourtant quelqu un de humble , qui aime mon prochain et qui ne recherche pas les conflits.

D – ne pas les chercher, les conflits, est un fait, les fuir, les éviter alors que parfois (pas tout le temps bien sur) parfois ils sont utiles pour résoudre un non dit et avancer dans la paix et le bonheur…..si la communication est non violente dans un conflit (et c’est possible grace au Reiki) l’idéal est que les eux conjoints fasse le Reiki ensemble.

Q – Longtemps , je me suis écrasée, je me suis effacée, je n osais m affirmer et dire les choses ; le stage m a apporté l assurance qui memanquait et dans mon travail c’est plutôt positif;

D – il n’y a pas d’affect dans le travail ! donc l’assurance de soi est  la bienvenue.

par contre dans mes relations privées (mon partenaire avec qui ça n allait déjà plus)

le Reiki va directement à la cause de ce qui n’allait plus pour la guérir.

Q – c est le désastre :une incompréhension totale ce qui aboutit à des conflits et des agressions verbales.

l’agression est de la rage, CaD le résultat des colères non exprimées, les non dits accumulés.

D – aujourd’hui derrière cette agression se cache peut être de la tristesse qui n’est pas exprimée. et surement des frustrations non exprimées.

Q – Difficile d en parler par mail car la situation est complexe . Je pensaisqu avec le Reiki et mon éveil naissant, mon désir profond de paix et d amour…

D – oui, c’est le but….mais pour y parvenir vous devez guérir une colère qui dormait en vous.

Q – …, je parviendrais justement à éviter les conflits;

D – on ne doit pas éviter un conflit, on doit les affronter calme, posée, et surtout en mettant toute la volonté à bien écouter l’autre, veiller à ce qu’il est le temps de tout dire ce qu’il a a dire sans l’interrompre, avec le plus d’amour possible cette écoute, et faire l’effort de le comprendre au lieu de se protéger et de vouloir avoir raison….alors a son tour on poura posément expliquer son point de vue.
tant qu’on ne sait pas le faire, on fuit les conflits. Mais voilà, un jour ils nous rattrape et nous fracasse ! C’est pour nous purger de vielles mémoires en nous.
je bénis le Reiki qui nous réveille et nous éveille.

demandez au Reiki de vous aider à vous exprimer calmement lors des confrontations, demandez lui d’exprimer vos sentiments au fur et à mesure et ne plus les refouler.

c’est ce que j’enseigne au 2ème degré, mais dèja entrainez vous à demander au Reiki ce que vous avez besoin.

Q – j ai tendance intellectualiser les choses et je sais que j ai des progrès à faire dans le lâcher prise ; je viendrai aux soirées partage en janvier sinon que me conseillezvous?

D– de faire beaucoup de Reiki, de demander pardon a votre compagnon, de lui expliquer que vous êtes en période de nettoyage et que de vielles mémoires demandes à être guéries, qu’elles viennent surement de la petite enfance et qu’il faut laisser le temps au Reiki d’agir……

S’il peut l’entendre ; lui aussi porte cette raisonnante en lui ; des non dits avec la mère de l’enfance mais il ne suffit pas d’en parler, il faut nettoyer……il faut des outils pour ça, ou consulter une spécialiste.

la relation amoureuse ne sert qu’à ça ; transcender (aller au-delà de la vie ordinaire) les blessures de l’enfance remontent en couples pour qu’on les voient et les guérissent, avec le Reiki on y met l’amour qui convient.

*****************************

IPE – Intervention psycho énergétique, technique Reiki étudiée et pratiquée en atelier lors du stage niveau 3.

suite au stage reiki 3 de ce wend et à la tecnique de l’IPE que j’ai reçu pour mon hernie discale je n’ai plus mal du tout au dos. Tous les matins au réveil, quand  je tousse, me baisse, me lève d’une chaise je m’attends à avoir mal, mais plus rien……..C’est génial et je n’arrête pas de remercier.
*****************************

Dépression

Table de massage commandé sur Ebay ! Merciiiii de tout cœur pour ces précieux renseignement !
Une femme va venir me voir lundi pour une dépression !
Px tu me conseiller pour le soin ?

D – Tout est noté dans le mon manuel de Praticien Reiki 1er degré que je donne lors du stage ! Relis un peu, cheche ma chère M….

Ouiiii j’ai vu ! lol
Mais c’était juste si tu avais quelque chose à rajouter !!! 😉
J’ai déjà fais un soin à une personne en dépression, elle ne sortait plus de chez elle et broyait du noir, sans emploi et sans logement qui lui est propre et depuis le soin, ouahouuuu, elle sourit, voit positif et sort !!!! C’est magique !
J’ai fais un soin complet et la prise cosmique !
J’adoreeeeeeeeeeee le Reiki !!!!!!!

*****************

la fatigue

F – je suis bien pris par mon travail qui me fatigue physiquement et spirituellement lol.

Je vais être obligé de décaler ma formation niveau 2 pour l’année 2015 pour faute de disponibilité le week-end que j’avais réservé. Je m’excuse d’avance si ça te porte préjudice.
Amicalement. F

D – la fatigue n’est souvent due qu’à de la démotivation, peut être face à la somme de travail à « faire » et que « c’est pas com’on voudrait ».

Tu as le pouvoir d’y remédier, en faisant de temps en temps dans la journée :

* un auto-rayonnement sur les chakras, puis, *tantôt 1 position à la tête, 2 à 3 mn, puis une a la poitrine, et une au bassin…..*et le merveilleux idéal de Mikao ; juste pour maintenant, ne te préoccupe pas….occupe toi…..et * « juste pour aujourd’hui gagne ta vie honnêtement : mets y tout ton coeur et toutes les ressources que la vie t’as apprise, ce privilège là… les idéaux aident à recadrer nos pensées, le Reiki nous mets en stage dans des situations ou on a besoin d’apprendre à recadrer nos pensées, nos façons d’embrasser ou de rejeter les situations difficiles ou qui nous dérange. ces situations sont des professeurs, ne l’oublie jamais ! et donc :

*  juste pour maintenant, honore tes professeurs ( les situations ou tu t’y distords).

* chante le Kotodama du symbole, en boucle comme un mantra, le son égaye les cellules comme lorsque ta maman te chantait des chansons pour te voir sourire.

* et bien sur le plus de Reiki possible en auto-traitement le soir ou le matin tôt….compense le manque de repos et de sommeil. ces outils de changement du 1er degré sont déjà un merveilleux et puissant cadeau, il serait dommage qu’un homme de ta valeur les néglige (si c’est le cas bien entendu, sinon, oublie mon conseil et soutient). Les outils du 2ème niveau Reiki sont encore plus puissants puisqu’ils vont agir dans le passé et dans le futur pour un meilleur présent par une pleine conscience ……sur la conscience et le coeur….Tu seras le bienvenu à la date que tu choisira pour le Reiki 2ème niveau et qui te conviendra au mieux.

F – Merci pour tes mots qui font toujours du bien. Disons que je préfère venir avancer sur mes niveaux de Reiki l’esprit tranquille et le coeur libre. J’ai aussi beaucoup de mal à méditer en ce moment et à garder l’esprit focaliser sur un point. Forcément ce que je craignais arrive. A moi de faire face à ce nouveau test que la vie me demande de passer. Ce n’est pas par hasard qu’on me replonge dans cet enfer ! 🙂 On me demande très clairement de faire face à mes anciens démons que j’avais préféré fuir.
*********************************************
la fatigue

J’ai besoin de tes lumières quant à un soin que j’ai fait récemment. Je t’explique… Il y a quelques jours, une amie m’a contacté pour que j’y fasse un soin. Elle se sentait pas bien du tout, très fatiguée et toujours avec l’envie de pleurer sans raison apparente. Cette personne a un don de soigner avec ses mains, travaille les énergies, possède beaucoup d’intuition et a la faculté de voir les défunts. Je lui ai fait un soin, d’abord le scanner avec fuite au niveau de la gorge et plexus que j’ai comblées, et arrivée aux positions gorge, cœur, et plexus, elle se sentait vraiment pas bien, oppressée, elle avait du mal à respirer et des émotions sont ressorties sous formes de larmes. Quatre cinq jours après, elle m’envoie un sms me disant qu’elle se sentait à nouveau très fatiguée. Ne pouvant pas aller la voir en direct, je lui ai dit que je lui enverrai un soin à distance le soir même. Lorsque je l’ai fait, elle travaillait sur elle-même en même temps sans le savoir mutuellement et elle a ressenti le Reiki que je lui envoyais. Pendant que j’envoyais le soin avec Kotodamas, j’ai demandé à mon guide pourquoi elle se sentait si fatiguée, j’ai eu en réponse que c’était une attaque. Après le soin, j’étais pas très bien, j’avais mon plexus qui me brûlait. Le lendemain, elle me contacte et me dit qu’elle avait eu très mal au plexus elle aussi et qu’elle pensait que c’était une entité qui était accrochée à elle car elle avait vu physiquement à côté d’elle une forme brumeuse.
Je l’ai revue hier et je lui ai fait à nouveau un scanner avec encore une grosse fuite au niveau du plexus. Pendant que je travaillais sur elle, elle me dit qu’elle sentait que c’était passé dans le dos. Je lui ai demandé de se mettre sur le ventre pour que je regarde et effectivement fuite aussi au même niveau dans le dos. J’y travaille dessus, plus rien mais cela s’était déplacé au bas des reins, puis c’est remonté au plexus, puis épaule gauche ( à ce niveau elle a eu mal quand je travaillais sur son épaule) puis épaule droite puis plus rien.
Alors franchement je me suis demandé ce que cela pouvait être pour que ça se déplace comme cela. Mes sensations dans les mains sont les mêmes que pour les fuites énergétiques. En revanche, elle m’a dit que ce n’était pas la première fois que cela lui arrivait, que d’autres thérapeutes lui avait dit la même chose. Qu’en penses-tu ? As-tu vu ce genre de choses sur quelqu’un toi aussi ?
J’ai prévu de lui faire une IPE+ soin complet lundi prochain, est-ce la bonne solution pour la soulager ? Et ma plus grande interrogation, si c’est réellement une entité accrochée à elle comment je peux faire pour l’aider ? L’IPE sera-t-elle efficace pour cela ?

D – la fatigue vient généralement d’un manque de motivation réelle. Il faudrait qu’elle parle de tout ce qui l’ennuie, la dérange, lui pèse…la fatigue ! ou l’écrive. Ensuite qu’elle se remotive pour faire ce qu’elle a a faire. l’IPE est très bien pour ça.
Pour les entités ; avec une baguette de sélénite blanche ; faire des mouvements dans l’aura : les symboles, des 8, des cercles, des triangles…ect   tout autour d’elle.
il me semble que cette personne soit très mentale et fasse circuler en elle les énergies dures à son insu…..qu’elle en fabrique car elle doit avoir des peurs non conscientisées.

Q – Je viens te donner des nouvelles suite au soin donné hier. L’IPE a très bien fonctionnée, cela lui a permis de faire sortir ce qui la pesait. Je lui ai fait également le dégagement d’entité, sur le coup elle perdait d’équilibre mais tout est rentré dans l’ordre après le soin complet. Merci encore pour tes conseils. Sinon, j’aimerais savoir s’il te reste encore de la place pour passer la maitrise sur Cabrière à la fin mois et si bien sûr je pourrais m’y inscrire ? Si oui, peux tu me donner l’adresse exacte que je puisse réserver un hôtel au plus vite.
************************
Q – Petite question un peu personnelle…..Que peut-on faire comme soin Reiki pour problème de fissures anales et hémorroïdes ?

D – les hémorroïdes sont dues à des restes de colère du passé, aussi à une peur des échanges….le sentiment accablement….

Fais la prise cosmique 15 mn par jour, et si tu as encore de la place ; traitement complet…..ensuite ; ça concerne le chakra racine…..donc 3 à 15 mn par jour les 2 mains sur le chakra ( chakra et anus) en récitant la phrase : « je me dégage de tout ce qui ne ressemble pas à l’amour. J’ai du temps et de la place pour tout ce que je veux faire ». et porter une hématite ( on en trouve des petites, parfois plates ) , colée avec un pansement sur la fesse….ou sur le chakra la nuit….et dans la journée un grenat, en pendentif ou/et dans la poche pour le toucher souvent.
********************
Sommeil

Aujourd’hui j’ai vécu une drôle d’expérience grâce au Reiki….Les jumeaux de presque 4 ans, que je garde le soir et le mercredi apm, ne voulaient absolument pas faire la sieste. C’était colère et toute la suite…Les ayants isolés chacun dans une chambre, je me suis attardée avec un des deux. Je lui ai posé la main sur la tête en pensant et visualisant fortement CKR, puis sur le plexus solaire. En peu de temps, je pense 5 mn maxi, il a commencé à se frotter les yeux, paupières lourdes, et il s’est endormi. N’entendant plus le second je suis rentrée dans sa chambre et lui aussi s’était endormi presque en même temps que son frère…..Voilà !!!! J’en suis restée agréablement surprise.
****************************

Energie et énergie
Q – Lors de la formation que nous avons terminé le 1er module de formation en allant visité les ruines d’une ancienne chapelle du 12ème siècle dans le but de s’entrainer avec les baguettes. Dès le départ, avec une autre fille (qui pratique aussi le Reiki ), nous ne sous sommes pas senties très à l’aise à l’intérieur de l’enceinte de la chapelle… J’y ai ressenti une énergie assez forte mais ça m’a perturbé.  D’après notre enseignant, ces cours d’eau, souvent recherchés pour implanter des lieux de culte, retire notre force vitale quand nous sommes au-dessus… Et pourtant, dans les lieux de culte, ils auraient l’effet de modifier notre état de conscience et de nous rapprocher du divin… !!! De cette expérience, j’étais un peu perturbée : y-a-t-il dans la nature des énergies négatives qui pompent notre force vitale ?

D- A mon avis il n’existe absolument rien de négatif sur notre planète, ça serait contradictoire avec les lois d’Amour de l’univers. ce qui existe, se sont les mémoires qui sont inscrites dans l’humain. Certains lieux, même des animaux, des objets et bien sur des humains vont jouer le rôle de déclencheur ; vont réveiller ces mémoires car ils ont choisi ce rôle avant incarnation. Mikao lui mm nous a enseigné que TOUT est esprit avant manifestation.
Ce lieu t’a attiré à lui afin que tu saches que tu as une faiblesse au niveau de tes énergies….et….L’amie avec toi…vous avez toutes 2 les mêmes résonances et vous vous êtes attirées l’une à l’autre pour vous retrouver à cet endroit et vivre la même expérience. je trouve cette leçon très ludique. Certains nœuds de Hartmann font baisser l’énergie mais il s’agit juste d’un point et dés qu’on en sort nos énergies remontent de suite….peut être y avait il à cet endroit un gros nœud …??…toutes les autres personnes l’auraient ressentie comme vous ?
tu es « débutante » en Reiki, avec une faille à réparer, et pour cela il convient de faire un soin chaque jour et de tracer une à plusieurs fois/jours le symbole sur les 7 chakras, et ceci durant au moins….10 ans pour arriver à la maîtrise. C’est pareil dans tous les domaines.
Quand je  vais dans ces lieux je n’y vais JAMAIS sans faire mon rituel de préparation complet et y avoir envoyé du Reiki à distance pour moi.  Transcender est notre devoir sur la terre.

Q – ok merci Dom pour ta réponse. Pour la prochaine fois, je m’enverrai du Reiki à distance et j’essaierai de prendre un peu plus de recul par rapport à mon ressenti…

D – Ressentir : qu’est ce que je ressens ? ou est ce que ça me touche ? Que puis faire avec le Reiki ? Est ce que j’ai peur ? si oui ; de quoi ?
**********************************
Spondylarthrite ankylosant 

Q – Merci pour ce stage Reiki 3 d’amour et de partage ! Ceci dit, une question… Ma maladie, Spondylarthrite ankylosante , qui m’a laissée en paix depuis un an s’est réveillée hier ; une forte poussée difficile à supporter. Penses tu que c’est en lien avec les initiations du degré 3? Un conseil?

D – il me semble bien que le Reiki et les symbole du Reiki 3 viennent réveiller ton enfant intérieur ; des choses à EX-primer, à dire, à sortir. GRANDIR QUOI !!!
la Spondylarthrite ankylosante, si elle se situe dans les lombaires est due à de la dévalorisation de soi avec besoin de soutient affectif ( d’ou être touché par le tableau du Dojo qui représente le cœur uni à l’esprit père divin). La Spondylarthrite ankylosante, si elle se situe dans les sacro-iliaques et le sacrum est due à de la dévalorisation de soi sur le plan sexuel et y compris « votre sexe et votre sexualité. Questions à te poser :

z’aurait on préféré avoir  un garçon ?

M’a t’on dit que j’étais nulle ?

Aurais je compté sur le soutient des proches et ne l’ayant pas obtenu je me sens sans valeur….?

Solutions Reiki : L’autotraitement + 1 rééquilibrage des chakras/semaine + les 3 méditations Reiki 3.

+ la guérison du passé longue durée !

+ des guérisons dans le passé !

et contacte les personnes du groupe Reiki 3 pour qu’elles te fassent des IPE ! A… est décidée.

Q – Merci Dom.
C’est tout ça ! sacro iliaque et lombaire !
Mère persuadée jusqu’à ce qu’on me mette dans ses bras que j’étais un garçon puis élevée comme un enfant de remplacement ( avt moi fausse couche d’un garçon ..)comme un garçon
Grosse déception désillusion affective.
J’ai déjà beaucoup travaillé dans le passé je pensais en avoir terminé …Merci pour tout ces précieuses indications

D – charge papier quartz un gros 1/4 d’h, laisse infuser une nuit et mets le ds la grille :

Un cristal pour : avant la naissance ! (charge/laisse infuser une nuit/mets ds la grille)

– 1 autre pour la grossesse !

– 1 autre à la naissance.

– 1 autre de 0 à 3 ans…………………au fur et à mesure tu les laisse ds la grille….

************

Thyroïde
Q – Je voudrais savoir quel soin apporter a une personne pour l amélioration du fonctionnement de la glande thyroïde ? Puis je le faire ? je ne suis que Reiki 1 depuis une semaine, Merci.
D – Bien sur que tu peux, je t’ai correctement formé pour soigner les autres ! Je ferais 15 mn à la gorge après un bon scanner, ts ls jrs jusqu’à sentir un changement. Bien sur après ce 1/4 d’h de soin, l’idéal, si tu peux ; faire le traitement complet. Mais ce n’est pas obligé ds la mesure ou tu traite chaque jour.
la personne devrait porter une lapis-lazuli, ou une améthyste au cou, voir les 2 et une pierre de lune.
Les problèmes de thyroïde viennent souvent d’humiliations qui engendrent le sentiment de ne pas arriver à se réaliser et que c’est la faute à.
************
Un Chaman vient faire une formation là ou je travaille au mois d’avril suivit par des soins . Puis je la faire ? Cela ne va pas « contrarier » le Reiki ? Merci pour ces réponses à bientot C.

D – La formation chamanique, il n’y a pas d’incompatibilité avec le Reiki si il y a quelques jours entres deux formations.

Mais chaque jour fais CKR sur toi et surtout sur ts ls chakras avant de commencer, un bon ancrage.

Et…. méfie toi car souvent les chamanes dénigrent le Reiki en essayant de faire peur, que c’est dangereux……bien sur il s’agit de ceux qui eux mm ne savant pas ce qu’est le Reiki  puisqu’ils n’ont pas fait la formation…..
******

Celle là elle est terrrrrible !!!! j’adore !

Q  – Je voulais te poser un question concernant le traçage des symboles dans les mains, et oui j ai eu un gros doute pour la main gauche je pars de la gauche, mais pour la main droite je sais pas si je dois partir du côté gauche ou du côté droit? je te pose cette question car notre ancien maître Reiki m’avais expliqué que qd on tapait ds les mains il fallait que les symboles soit fait ds le même sens pour qu’ il fusionnent sinon sa marche pas.
J espère que sa te paraît assez clair?!!!

D – ça me parait surtout assez con de dire des trucs aussi insensés !!!!
Trace les symboles sur tes mains exactement comme si c’était des feuilles de papier ; tu pars toujours de la gauche….en frappant des mains les symboles sont imprimés dans les chakras des mains dés le traçage et tu peux y aller, frappe !!! ça MARCHERATOUJOURS, et ça marche avec tous les symboles. Et si tu fais les symboles à l’envers, la tête en bas, et bien ça marche aussi. Et si tu les visualise seulement, frappe, ça fonctionne très bien.
Je te souhaite un merveilleux wend à l’envers et à l’endroit ou tu sera le mieux TOI !!!…lol.
Amicalement.
Dom
******************************************
R 3 de fevrier 066   Février 2015  VOS retours de stages

1000 fois merci pour ce magnifique stage. Avec Angélique on a été ravies. On s’est appelées dans le week-end pour échanger… Ça a répondu à nos attentes. Personnellement je trouve que l’on a été hyper bien reçus, c’était un vrai moment d’échange et de partage. Cela apprend à aimer les autres et à nous aimer dans cette démarche. Merci…
*************************************
MERCI pour ce stage Reiki 3, je suis littéralement transformée, j ai déjà bcp de demande reiki ( 5 pers depuis que je suis rentree). Mon ami radiesthésiste m a senti remplie de lumière avec un taux vibratoire relativement élevé.
*******************************************
Juste pour te remercier et te dire que cette soirée partage était vraiment réconfortante, apaisante et enrichissante !
***********************************************
Revoir les « bébés Reïki »  du stage 😉 et découvrir de nouvelles et belles personnes lors de la soirée partage est un cadeau inestimable qui existe grâce à toi et la belle personne que tu es…..nous faisons le reste et cela donne de très belles connexions et énergies! Merciiiiiiiii   ****************************************
Un grand Merci à toi de prendre le temps de nous lire et de nous répondre avec sincérité et un grand Merci également pour ton intervention sur mes poumons en souffrance lors de la soirée partage! Très bonne soirée et semaine. Amour, Paix et énergies positives made in my heart!!!
****************************************
Je viens par ce mail te faire un petit retour de mes premières semaines de pratique du Reiki (ayant fait mon stage le 23 et 24 septembre). J’ai suivis ton conseil de continuer pendant plus de 21 jours la pratique quotidienne de cet « outil » et cette philosophie, dans l’idée d’une continuité de stage et pour le coup…cela devient une évidence de tous les jours!!! Aussi, je ne cesse de relire ton petit livret qui m’accompagne partout, que je trouve très bien et qui m’est d’un précieux secours en cas de doute ou questionnements! Je tiens vraiment à te remercie pour ton enseignement.
*******************************
Aujourd’hui, après 20 jours de pratique de cette belle découverte que fut le Reiki, je me sens rééquilibrée, un peu plus apaisée et….je dirais disponible à moi (étrange!) et du coup beaucoup plus aux autres et au monde qui m’entoure ! J’avoue avoir fais de belles expériences ces derniers temps et avoir su….je dirais: attirer ou/et laisser venir et surtout apprécier les bonnes choses….j’apprends à avoir du recul sur les choses et du lâcher prise (c’était mon premier objectif en venant à ta rencontre et celle du Reiki) et à faire confiance aux énergies, à l’instant, à mes ressentis et en la vie.
********************************
Mmerci pour cette invitation à cette soirée partage ! je ne sais pas ce qui m arrive ; après mon stage niveau 1 ( en novembre) , je me suis sentie en pleine forme, sereine et HEUREUSE !
*******************
je voulais te remercier encore pour ces 3 jours de Maîtrise Reiki enseignés et animés avec une main de « Maître » ! simplicité, écoute, présence, amour     … merci…La voie est maintenant tracée, dans la lignée et dans ton sillage
****************************

Merci pour la générosité de ton enseignement et merci pour les photos de ces moments si  précieux en stage

*****************************

Il est des lieux magiques

Déconnecté pour mieux se connecter.

Il est des des rencontres

Il est des âmes

Il est des rires 

Il est des regards

Il est des partages

Il est des échanges

Il est des enseignements

Qui apportent à vos journées 

Des étincelles de lumière

Et il y eu ce wend le stage de Maîtrise Reiki

Alors je sus…….. 

Merci à vous tous de m’avoir accompagné durant ces quelques jours

V

**************************************
merci pour ces initiations à la maîtrise de la semaine dernière, je me sens vraiment bien avec Le symbole de Grand Maître Tibétain, c’est très serein (enfin très souvent…) et c’est le 1er symbole qui m’accompagne vraiment. Je tâtonne vachement sur les 2 autres, mais un peu comme d’hab à chaque nouvelle étape.
******************************
ce petit message pour te donner des nouvelles de S……, la nounou des mes enfants qui est venue avec moi lors de la dernière soirée partage Reïki. La nuit qui a suivi la séance, elle a dormi 5h d’affilée, ce qui ne lui était pas arrivé depuis des années. Elle en était agréablement surprise évidemment ! Depuis, elle se sent moins fatiguée, comme si une entrave qui pesait sur elle avait disparu. Je la trouve effectivement plus sereine.
******************************
Je me suis régalée pendant ce REIKI 3 ; et appris de très belles choses. Merci, encore pour ces deux jours , avec un groupe très homogène,  tellement EN OSMOSE, que nous ne faisions plus qu’un dès la fin de la première journée.
**********
JE TE REMERCIE DE TON ACCUEIL ET DE CE STAGE reiki 3 TRÈS ENRICHISSANT AU COURS DUQUEL J’ AI REÇU 2 CADEAUX MERVEILLEUX (DEPUIS LA GUÉRISON I.P.E, JE NE « CALE »PLUS SUR MON TRAITEMENT MENTAL AU MOMENT DE DIRE QUE J’ AI BEAUCOUP D’ ESTIME POUR MOI-MÊME ET MA RENCONTRE AVEC TON AIDE DE MON GUIDE REIKI AVEC LE MESSAGE QU’IL M’ A DÉLIVRÉ ; AUSSI AVEC MON GUIDE REIKI, JE ME SENS VRAIMENT PROTÉGÉE ET ACCOMPAGNÉE, AUSSI, JE CROIS QUE JE DEVRAIS AVOIR MOINS PEUR DE LA VIE MAINTENANT. JE ME SUIS SENTIE HEUREUSE AUSSI AVEC LE GROUPE, IL Y AVAIT UNE CONNEXION ENTRE NOUS.
********************
Je viens te remercier pour ce merveilleux we passé en « mode Reiki, sagesse et compassion »  en ta compagnie ! D’un point de vue personnel, je me sens plus sereine, un peu plus sûre de moi ! je sais que je vais encore beaucoup apprendre en ta compagnie !
*********
suite au stage reiki 3 de ce wend et à la tecnique de l’IPE que j’ai reçu pour mon hernie discale je n’ai plus mal du tout au dos. Tous les matins au réveil, quand  je tousse, me baisse, me lève d’une chaise je m’attends à avoir mal, mais plus rien……..C’est génial et je n’arrête pas de remercier.

********************************************************************************************************

Octobre 2014……beaucoup d’eau d’un coup dans le sud est…..

Inondations à Saint Laurent le Minier, vallée de la Vis.

Inondations à Saint Laurent le Minier, vallée de la Vis.

 

 

Nous envoyons du Reiki à distance aux victimes afin que l’Univers
leur donne ce qu’elles ont réellement besoin de recevoir,
pour le plus grand bien de tous les êtres.
Dom.J

 

 

 

Polarités du corps inversées.
B – C’est un jeune homme très, très stressé qui faisait des crises importantes d’épilepsie et il y a quelques mois il a été opéré au niveau du cerveau, depuis des acouphènes se sont développés dans ses 2 oreilles. Voilà pour la situation. Ce matin il a reçu sa 2ème séance, un peu mieux que la 1ère au point de vue stress, par contre un effet plus que bizarre pour moi, je ressens l’aide de « guides » et dans le cas présent la sensation que sa droite et sa gauche sont inversées ….. prise entre le doute de mon petit diable mental ou de mon vrai ressenti, j’ai besoin de t’en parler. Que ux-tu me dire ? as tu vécu quelque chose de similaire,  j’ai besoin de repères et surtout de t’en parler.

Dom – Oui ce genre de chose arrive, haut et bas aussi…Continu les soins assez rapprochés.
Fais chaque fois un scanner méticuleux pour renforcer son aura. Trace Ckr sous la plantes de ses pieds et sur le chakra du cœur, puis trace Hszsn dans son aura pour annuler toutes distances avec ; l’univers et lui, lui agité et lui apaisé, avec son yin et son yang ; tu dois émettre cette intention a chaque fois que tu trace les symboles…puis tu trace le serpent de feu sur son aura, lui debout, puis couché, fais le plus souvent possible….après  le serpent trace  Shk et enfin DKM tibet pour la guérison spirituelle ; tous en grand dans son aura ! Et chante les kototamas pendant le soin, assez fort pour pénétrer au cœur de ses cellules. Je pense que cette personne a inversé ses polarités masc/fem pour se protéger ou pour essayer de comprendre ce qui lui arrive….insiste avec Shk…

*

Reiki à une infirmière

X – Je t’explique, je donne du reiki, je me sens bien avec ça. Dimanche soir, mon épouse qui a traversée un longue période très difficile, m’a demandé un soin. J’ai fait ce soin en demandant que tous ses mots refoulés ressortent elle qu’elle s’en débarrasse définitivement, un bon lacher prise.

D – cette façon de faire est incompatible avec le Reiki. Je ne l’enseigne pas de cette manière, n’est ce pas ….On ne fait pas de demande en faisant un soin car dans ce cas le mental s’en mêle et le Reiki circule moins librement, au risque que le donneur donne son énergie et hélas celle de ses attentes. Un soin Reiki se fait en laissant aller, on active le symbole , on chante le symbole, on récite en boucle la prière du symbole….et c’est tout

X – Elle est infirmière au CHRU, partie hier matin elle est revenue avec de gros mots de ventre hier vers 10:00, pour qu’elle s’arrête, c’est que c’est très très douloureux,..L’après midi elle a fait des cauchemars autour de son problème de rejet dans l’enfance (enfant subie et non désirée, elle ne s’en débarrasse pas, ça revient de manière récurrente avec des effets plus ou moins importants).

D – on peut demander au Reiki, au symbole, au guide spirituel d’aider la personne à comprendre les cauchemars – qui en réalité sont des messages très importants que la personne doit comprendre pour guérir de quelque chose – mais on ne dit pas au Reiki « que tous les cauchemars cesse et que la personne dorme profondément« ……….le Reiki n’est pas manipulable comme l’est l’énergie du magnétisme. avec des séances d’hypnose érikson. la sophro, elle devrait arriver à nettoyer et neutraliser ces souvenirs d’enfance et ces émotions récurrentes….

 X – Hier soir, elle était très mal.  De nouveau un soin de 1:30 dans de bonnes conditions. Ce matin, maux de dos importants, moral au plus bas, découragement….

D – il convient parfois d’aller voir un ostéopathe pour savoir quelles vertèbres sont en souffrance et agir en conséquence, sur le chakra concerné avec la phrase affirmative qui est dans le livret Reiki du stage sur ce sujet et en regardant dans l’un des livres conseillés en stage Reiki afin de faire un travail sur la conscience, avec l’esprit et le Reiki agir sur la cause.

X – Ma question : Est ce que mon soin peut avoir eu cette conséquence ?

D – non ! Néanmoins, peut être que si tu as trop de VOULOIR la guérir….ta force peut « forcer  » quelque chose….qui peut induire une tension…

X – Dois je continuer, à quel rythme, et avec quel type de message.,

 D – continue en ne faisant rien !!! Fais le rituel, au centrage fais une demande à ton guide  » s’il te plait fais en sorte que mon mental soit écarté de Vouloir la guérir à tous prix, et que seules des pensées d’amour occupent mon esprit durant le soin. Merci. » commence le soin par un scanner méticuleux. puis la prise cosmique 15 mn et enfin un soin complet recto verso.

 X -comment réaliser ce travail d’expulsion définitif indispensable,

D – voilà ! les mots que tu as écris et qui sont représentatifs de ta force : « expulsion définitif indispensable » ! Je rappelle que le mal vient d’abord de l’esprit et qu’ensuite le corps le manifeste dans son langage non verbal appelé douleur… Ton épouse est infirmière et la médecine soigne la mécanique pas l’émotionnel. Le Reiki soigne la mécanique l’esprit et l’émotionnel, et la cause. Cela demande un soin d’1 h ts ls jrs, mais aussi un peu de responsabilisation de soi, à savoir ; faire un travail convenable sur le mental, rectifier les pensées qui sont à la base des maux. Quitte à se faire aider par un psychothérapeute psycho-corporel…..

 X – en lui permettant néanmoins de ne pas avoir le moral à 0 ?

 D – avec beaucoup d’amour accompagne là en lui faisant comprendre qu’elle doit accueillir et accepter les messages que son corps veut lui transmettre afin de changer sa vie.

*

Merci à vous tous pour ces 2 jours! Je suis arrivée au stage, ne sachant pas trop ou je « mettais les pieds », et j’en suis repartie sereine, Heureuse, le cœur débordant d’Amour pour Vous, pour le lieu qui nous a accueilli, pour Tout ce qui a fait de ce stage un moment inoubliable (et au Reiki aussi )
En repartant je m’Aimais et c’est grave à VOUS. MERCI. Je vous embrasse de  tout Mon Cœur

*

migraines

G – mon fils a souvent des migraines en semaine et le  week end,  et doit passer son bac. Le 14 et le 15 juin,  je fais la prise céleste sur lui ,  mais  il a toujours des crises.  Je souhaite le soulager  voire le guérir  afin  de lui dire que je fais du reiki.  Que  dois  je  faire contre cette migraine ? Depuis le stage, je pratique  chaque jour  le soin complet,  c’est devenu  automatique….et je préfère le faire le matin. – avant de faire l’initiation reiki, j’avais des intuitions. Il y a 2 semaines  j’ai  pensé  à la fille  d’une copine  et  pour la 1 ère  fois  j’ai eu  en réponse :  comme un éclair,  des taches noires ……ça  m’a fait sursauté  de peur . A ton avis,  qu’est ce que ça veut dire ?

D – les migraines peuvent venir d’un dénigrement de soi ; autocritique, auto jugement, culpabiliser…ou bien être sous pression et ne pas tolérer d’être sous pression, résister au courant de la vie….parfois aussi cela peut venir des peurs sexuelles… ce qui serait efficace, c’est de lui faire un soin normal, commence par la tête, et doucement le questionner…il ne s’agit pas d’obtenir quelque chose, mais que lui parle, qu’il se décharge de ce qui lui met la pression. Quand aux intuitions, ça effraye au début, il faut accueillir, apprendre à regarder sans broncher, questionne ton guide, le Reiki , le symbole, demande à savoir, à comprendre….des taches noires ; le noir c’est ce qu’on ne voit pas, c’est l’ombre, le recueillement, ça peut être ce que le personne refuse de voir…

*

Email non corrigé volontairement.

B – bonjour Dom……Merci pour les témoignages que je lis pour comprendre ce qui m arrive…J ai la gorge qui me sert avec impression de gonflement depuis un mois et pensées négatives en boucle dans ma téte.;;;;;;;;;;Un collégue syndical de mon travail m a tenu par ses coups de fil un mois avec des menaces de m engueuler sans jamais vouloir me donner les explications avec le tél du bureau parce que sur écoute;;;Je rentre du cure thermal et méme sur le mont bugarach je n étais jamais tranquille..Je rentre ce mardi..Il vient me voir me parle de c problémes et repart…Il m a déstabilisé sans s en rendre compte sur un moment ou j étais épuisée..J ai été trés fatiguée et méme complétement épuisée quelques temps aprés le stage..Je suis restée en contact avec une personne du stage..Elle ne pouvait pas me venir en aide car comme moi nous avons besoin d un rapel et recommencer tout un wk ta formation du 1er niveau.. J ai compris que la gorge ct la parole non dites…Aprés le stage il est vrai que mon don de voyance a été beaucoup plus loin mais peut étre aussi trop loin..A remuer la m…. c a éclabousse..J ai remets tout cela a l univers mais tout reste dans ma gorge quand méme..Mon kiné m a vu hier et a constater que méme ma machoire est contracté a fond….J ai perdu aussi ma joie de vivre parce que tout me stress..J ai toujours autant de foi ..Et comme dans un témoignage de ton éléve je ne recois plus grand chose au niveau spyrituel…Je reviens sur Nimes vidé.Sans motivation…Je suis consciente de mon état…A bientot Dom de te retrouver en septembre..

D – Porte sur toi un quartz citrine naturel en pendentif la pointe vers le bas !!!!
Les quartzs de citrine ou quartz avec de la citrine aident à se sentir bien en nettoyant le plexus solaire. Mets aussi de l’œil de tigre dans la maison et de la tourmaline noire pour éloigner les mauvaises ondes envoyées par les autres.

IMPORTANT : tu as écris « ma gorge me sert« …..alors rends lui ce service, donne lui du Reiki.

Il y a la phrase du chakra dans le chapitre des chakras sur le livret du stage, utile là avec la technique apprise….ce qui t’arrive est normal. on appelle ça , rappelle toi ; « symptôme de guérison ». le passé a besoin d’être guéri, et ça passe par un certain chaos, accepte le et prends toi en main en faisant l’autotraitement quotidien. Puis, 2 fois par semaine offre toi un grand et beau rééquilibrage des chakras – prends la fiche du stage et suis la méthode qui est si facile ! Pour les angoisses et la dépression une fois par jour fais-toi une prise cosmique 15mn. Et tous les soirs au coucher et tous les matins au réveil récite à voix haute les 5 idéaux. Chaque fois que tu te sens mal, n’hésite pas : chante le Kotodama , le mantra C K R.

*

Je tenais a te remercier pour le diamant herkimer, que tu m as offert lors de la soirée partage, il m a touché en plein cœur!!! C est magnifique de travailler avec!!!!ne sachant pas si j aurais l occasion de revenir avant la fin de la saison, j’éprouvais le besoin de t exprimer ma joie et ma gratitude d avoir passé mon deuxième degré auprès de toi…bouddha Gautam a dit concernant la confiance en ver un maître: fiez vous au message du maître et non a sa personnalité…dans ton cas le message a fusionné avec la personnalité et ça crée un maître avec une énergie magnifique, alors merci de tout mon cœur de m en avoir fait profiter. Je te souhaite une très belle fin de semaine. a très bientôt. Sandrine.

*

plus aucune douleur vive

S : je tenais à vous signaler : depuis samedi après-midi, plus aucune douleur vive. un peu de fatigue, mais un grand mieux, plus trop de saignement depuis aujourd’hui dimanche: besoin de tranquillité totale, aucun mouvement (ni sortie, ni activité). aujourd’hui : prise de conscience: « j’accepte » (!!!) (c’est pas trop mon genre pourtant, j »en suis surprise moi-même). grand mieux-être juste après, grande compassion, détachement à la colère et irritabilités …paix sérénité interne, sécurisation, qq chose s’est passé, je ne sais pas quoi, c’est profondément intégré en moi, ça ne partira pas, c’est durable, c’est très stabilisant, protecteur, réparateur je ressens la confiance en toute chose, chaque événement semble avoir trouver sa raison d’être, même les pires, je suis simplement bien. je pense que si moi je ne sais pas, vous, vous le comprendrez. bien fraternellement, je suis de tout cœur avec vous .

*

je fume moins, je dors mieux etc…

Bonjour Dom, Merci pour le contact de R…..pour des soins Reiki à Lyon, et pour ce week-end précieux de rencontre avec le Reiki 1er degré à Juvignac ! Une semaine après il m’apporte déjà des choses incroyables, ça me rend de plus en plus « boulimique » de reiki !! Je suis arrivée à Juvignac fermée et bloquée… Pour ne rien arranger, j’ai toujours eu tendance à m’effacer et disparaître dès que je suis en présence de plus de 3 personnes…Depuis quelques jours, je crois que les choses sont plus fluides et plus simples, certaines choses se débloquent. J’espère enfin parvenir à m’encrer. Je sens également que des émotions douloureuses sont sur le point de remonter à la surface, mais le calme et la plus grande clarté que m’apporte le reiki me permettront de gérer tout ça, quand il le faudra. Il m’arrive depuis pas mal de « coïncidences », petites et grandes ! Pour l’anecdote, je disais à un ami que mon prochain contrat de travail se termine mi-janvier, mais que j’ai toujours eu confiance en l’avenir pour ne pas m’en préoccuper. Le lendemain je recois une proposition de l’opéra de T….à qui j’ai envoyé un Cv il y a 4 ans, sans ne jamais les avoir recontactés !!! La vie est dingue ! Bref, le reiki m’a aussi énormément détendu pour mes leçons de conduite, plus de stress. J’espère qu’il sera avec moi la semaine prochaine quand je passerai mon permis !! Je crois que mes sens sont un peu plus développés, je fume moins, je dors mieux etc…Beaucoup d’autres choses à découvrir encore j’imagine, en tout cas je suis très heureuse d’avoir rencontré une nouvelle approche qui s’accorde à mon chemin de vie, et une autre manière de compléter le développement de la voie du cœur ! Merci à toi et Isabelle. Et à bientôt pour le 2e degré ou pour une soirée partage. Bonne soirée et plein de belles choses à venir, M…

*

L – Je t’écris un peu en retard, merci pour les lectures. Depuis ma maîtrise Reiki avec toi en Juin, je me suis ouverte à beaucoup de lecture et de découverte, notre ame , nos guides, Ainsi qu’aux pierres et aux quartz. Tout change, tout est plus fort, l’énergie est multiplié par 10. Je te remercie encore pour ce merveilleux stage, et cette belle rencontre. Amicalement. L.

Dom – S’occuper des autres est une nourriture délicieuse pour notre âme. Initier, enseigner, permettre aux autres de comprendre et de relativiser, leur donner une voie d’espoir de progression, leur retransmettre des « savoir se prendre en mains »…tu comprends pourquoi j’aime enseigner le Reiki ?…voir les gens heureux….

*

Ho ! Le stage 3e niveau, je l’ai beaucoup apprécié !  J’ai ressenti un effet plus fort et la force du symbole de la gorge je m’en suis   rendue compte le lundi matin, quand très tôt, j’ai transformé à vitesse grand V, une discussion qui s’annonçait sous de mauvais auspices,  grâce à l’imprévu de l’humour (merci Chi Ka So), en bienveillance. Merci Reiki ! Bisous à toi, M.

*

Des petites news de la vie parisienne bien tumultueuse depuis l’initiation du symbole de Cœur ! Pour imager…. l’océan de ma vie c’est déchainée…. mais j’ai gardé la tête hors de l’eau en pratiquant ce bel outil qu’est le Reiki 2ème degré, et surtout le symbole du Cœur qui m’a beaucoup réconfortée ! Alors Merciiiii

*******************************************************************************************************

Juin 2014….après les fleurs de l’abricotier en Mars….
…les Abricots !!!

abricots-juin-sud

Les problèmes de cervicales.

– C : Bonsoir Dom. Depuis le stage de Reiki fait a Nîmes, j’en fais tous les jours sur des durées variables selon les possibilités. Je m’en trouve mieux mentalement et physiquement. Depuis deux jours j’ai des douleurs très fortes au niveau des cervicales (lieu de mes problèmes de santé) je me pose donc la question : au bout d’un certain temps de soin concentré sur une région bien précise, faut il espacer les séances ? Ou bien ne faire que certain soin et non la globalité ?

Dom : si cette région du corps est TA ZONE DE SOUFFRANCE, le Reiki réactive un message non verbal – appelé douleur – te signale de beaucoup t’en occuper. Au moins un quart d’h tous les jours sur cette zone. le must serait que certaine personnes du stage viennent t’en faire aussi (en échange de soins par exple).
Ça doit prendre le temps que ça doit prendre un tel soin…..regarde aussi au niveau du chakra correspondant – sur la fiche que je t’ai remise lors du stage il ya des indications sur ce chakra – la gorge n’est ce pas, organe d’expression, de réalisation de l’essentiel de soi. Ensuite tu devrais aussi consulter un ostéopathe, lui demander quelles vertèbres ( C N°….?) et avec ça je pourrais te donner des pistes der réflexion…

C : merci de ta réponse, cela me conforte dans le fait de continuer régulièrement le Reiki et pour répondre exactement a ta question ; j’ai un rétrécissement du canal rachidien a hauteur de c4 c5 c6 qui sont soudées entre elles par de l’arthrose, d’ou inflammation ; d’ou douleur.
je vais donc persister pour me soulager déjà de la douleur et a ce propos suffit il de faire le rituel de préparation suivi de la zone a traiter assez longtemps et le plus souvent possible ou bien 1 fois par jour faire le processus complet d’auto traitement.

Dom : si tu peux…le traitement complet en plus du traitement local.
sinon : Traitement local : tous les jours minimum 15 mn et 2 positions à la tête + 1 position poitrine + 1 position bas ventre / le soir : les pieds.
< la région des cervicales est souvent liée à de l’insécurité, de la peur, sentir une menace planer sur soi : sentiment d’avoir une épée de Damoclès suspendu au dessus de la tête, danger qui peut s’abattre à tous moments…
c4 : colère, culpabilité
c5 : ne pas dire, ne pas s’exprimer
c6 : porter la croix de l’autre
< et l’arthrose : traduit souvent un endurcissement, fermeture du cœur ; pensées devenues froides et dures envers une personne, une situation ou la vie en général.

Avec le Reiki ; pour ré-ouvrir son cœur, scanner toutes les personnes et toutes les situations, une à une ou on s’est endurci – durant un autotraitement Reiki par exemple – et demander l’aide à l’Univers, au Reiki, au symbole pour réparer et ré ouvrir.
L’importance de guérir l’esprit. Avec le Reiki chanter le symbole et dire à voix hautes les 5 idéaux du Reiki matin au réveil (sous la douche !!!???!!!) midi et soir au coucher, avec la sophrologie, les fleurs de Bach sont efficaces pour lâcher et comprendre….ect, et tenir un morceau de quartz rose tenu dans la main pendant le chant ou la récitation des idéaux va aider, équilibrer. Ainsi qu’une Rhodocrosite sur le chakra du cœur pour la douceur.
La voix est l’expression de l’âme, le verbe résonne dans l’univers et nous en recevons l’écho. Chanter les idéaux renforce notre pouvoir de guérison.

Faire du Qi Gong/du yoga/du chant et des choses qui permettent de prendre la parole, de dire, de décider.
_______________

L : j’ai un petit kyste, je vois le chirurgien dans 15 jours. Mais j’ai l’intention d’utiliser ces 15 jours pour faire du Reiki ! Dans tes doc et dans les notes que j’ai prises lors du stage Reiki 1, il y a plusieurs façons de faire. Tu peux me dire quelle est la meilleure dans cette situation? Merci

– Dom : bonjour L.
la technique laser-Reiki marche bien sur les kystes, c’est pratique cette précision.
Quoiqu’il en soit c’est un traitement local, donc : 15mn ts ls jrs + au moins 15 mn de Reiki sur la tête et le cœur, soigner l’esprit, y compris l’esprit du cœur. Et les pieds pour le retour à la terre des énergies indésirables. Recycler !

L – 2ème question: je fais un soin pour ma fille pour sa période intra-utérine. j’ai déjà réactivé 5 x le cristal. est-ce qu’il y a quelque chose qui m’indiquera que c’est suffisant?

Dom – 5 x réactivé ; donc tu as fais 5 x 4 jours = 20 jrs…..c’est une bonne période ! Écouter ton cœur pour savoir si c’est assez, avec Sksk

L – et ensuite comment on fait pour la fin du soin, comme d’hab? (brûle le papier et nettoie le cristal) ou quelque chose en particulier?

Dom – c’est ça !

___________________
J : Bonjour Dom, J’ai eu l’honneur et le plaisir au cours d’un séjour de donner 4 soins à un ami de 75 ans qui était bloqué au niveau du cou par de l’arthrose cervicale. Il est satisfait du résultat et moi de faire connaître l’efficacité du REIKI.
< Notre fils W… dont j’avais eu l’occasion de te parler au cours du stage de REIKI 1 (accident de moto ) est resté à la maison. A notre retour nous constatons côté gauche de son cou que la glande parotide est démesurément enflée. Il pensait que ça venait d’une dent. Hier matin, le dentiste après radio, lui a conseillé de voir son médecin traitant avec la radio et le nom d’un spécialiste à l’hôpital d’ORANGE. Notre médecin étant absent hier, j’ai pris RDV pour 14h30 aujourd’hui. J’ai consulté PATHOLOGIE DES GLANDES SALIVAIRES sur internet. J’ai aussi consulté les ouvrages dont je dispose sur le REIKI. J’attends le diagnostic de notre médecin, je pense qu’il va commencer par des antibiotiques. et si Willy est d’accord, je lui ferais 4 soins complets, plus à chaque fois 20 mn à 1/2 heure au niveau du cou.
Je te remercie humblement pour ton soutien dans le développement de mes capacités spirituelles et de guérison, pour le bien-être de ma famille, de moi-même, de tous et de l’univers ! Merci REIKI, merci Dom !

Dom : Bonjour J…; les glandes salivaires, les parotides, sont représentatives d’une perte de gout de vivre, une perte de saliver devant les plaisirs de la vie, peut être associé avec une colère rentrée, refoulée ( envie de cracher son venin = salive = cracher).
peut être cette personne est elle un peu dépressive, même sans le savoir.
– as t elle perdu le gout de vivre ?
– est-elle heureuse ?
– est-elle triste ?
– qu’est ce qui la rend triste ?
– qu’est ce qui lui provoque de la colère ?
– quel est la chose qui la rendrait heureuse et qu’elle se retient de « savourer » ( de savourer un met, saliver au plaisir de…)
Tiens cette liste de questions près de toi et, fais lui un soin en commençant par la tête, et, arrivé au niveau du cœur, commence doucement à lui poser les questions. le but étant qu’elle se vide, qu’elle se décharge….qu’elle exprime ce qui est comprimé en elle. Rien ne vaut la parole pour ça.
___________________

C : bonjour dom, je suis dans le cas ou je vais faire un soin reiki complet, pour une personne qui ne pourras que s’allonger sur le dos. comment dois je m’y prendre pour finir correctement le soin, sans occulter kenoyoku de fin de soin,ainsi que le balayage des energies lourdes.
merci pour ton conseil et ton aide. A tres bientot…….C. (reiki 1 eloquence)

Dom : bonjour C…dans certains cas comme celui ci, on s’adapte ; tu oublie les finitions, tu fais un scan très correct en début de soin pour réparation de l’aura, et un bon lissage en fin de soin suivi d’un remplissage par rayonnement.
Ensuite, tandis la personne descendue de la table de Reiki est debout, une fois à peu près réveillée, LA ! Tu fais Kenyoku dans son dos, et le balayage (plus en douceur évidemment) comme tu peux !

________________

Bonsoir Dom,
Mille merci pour ton aide d’hier au salon sésame. Le soin m’a apaisé et la citrine que tu m’as conseillée et aidé à choisir a été come un baume sur mon ventre.
Aujourd’hui, l’orage est passé… Ta présence a vraiment été un cadeau pour moi
A.M de Nimes
________________
S : Bonjour Dom. Pourrais-tu me dire comment me nettoyer après mes journées de travail en psychiatrie. J’ai la sensation de revenir avec des énergies négatives. On m’a parlé de la douche Reiki. Peux tu me l’enseigner ?

Dom : Bonjour S…tout d’abord, révise les notes du stage reiki 1 sur CKR : avant d’arriver au travail ; trace ckr dans les mains/aura/espace et trace Ckr sur les 7 chakras. pendant ce temps tu t’imagine enveloppée dans une bulle dorée et tu te vois ainsi le reste de la journée au travail. ça te permettra d’être protégée….
< De temps en temps ( disons 4 fois dans la journée/ poses pipi par exple, ou avant d’allumer la cig) isole toi et recommence ; trace un petit ckr sur les 7 chakras, pendant ce temps tu t’imagine enveloppée dans une bulle dorée et tu te vois ainsi le reste de la journée au travail. > Et, en fin de journée, prends le temps de te doucher : la douche reiki :
La douche de Reiki.
1) Tenez-vous debout ou assoyez-vous confortablement.
Fermez vos yeux ou laissez-les à moitié ouverts.
Respirez lentement, naturellement.
2) Gassho (Mains jointe sur la poitrine)
Ecartez les mains et levez les le plus haut possible.
Imaginez que vous recevez une douche de vibrations Reiki et de lumière de la source de l’univers.
En même temps dites fortement dans votre esprit;
– Ckr …ou Dkm.
3) Sentez les vibrations de l’énergie du Reiki.
Baissez les mains devant le corps, les paumes faisant face au corps.
Le Reiki émane des mains, ainsi que la Douche de Reiki qui continu à tomber de l’univers.
De cette façon, l’énergie inutile est nettoyée et les « restes » rendus à la terre
Refaites cette pratique plusieurs fois.
4) Gassho en remerciement pour terminer.
_______________________
S : Bonjour Dom, Encore un grand merci pour le stage degré 2 de Reiki de ce week-end, très intéressant et très intense:)
Je te contacte car j’ai une question pour laquelle j’ai besoin d’avoir une réponse, concernant la programmation du cristal lors de l’envoi de Reiki à distance pour soi. En fait, lorsque je me centre et me concentre sur le cristal et le rituel, j’ai souvent des pensées que je qualifierai de « parasites » (des pensées, mots, idées qui n’ont rien à voir avec l’instant présent, et qui seraient plutôt des choses angoissantes et négatives) et qui justement viennent me gêner dans ma recherche de concentration.

Dom : ça arrive presque à tout le monde, impossible de ne pas être perturbé en méditation, car l’envoi à distance en est une.
Solution ? Activer et utiliser SHK pour apaiser le mental et dire à voix haute le nom des symboles et une phrase affirmative très positive comme : « énergie de lumière entre et remplie ce cristal de ton amour infini….cette énergie est pour moi….toute la journée je suis entourée de l’énergie des symboles et de l’amour du Reiki tout est bien beau et grand pour moi.. ».ect, avec beaucoup d’amour.

> Puis, peu à peu, tu diras au mental, doucement mais fermement « tais toi, tu n’as rien à faire ici » en ajoutant CKR pour le rassurer.

au bout de quelques temps tu devrais arriver à faire tes rituels dans un calme….tout relatif.

> Fais aussi le rituel de préparation à voix haute ? forte et claire, sois guerrière, de lumière, mais guerrière !

S : Ma question principale est donc celle-ci: est-il possible que ces pensées involontaires se programment malgré moi dans le cristal ? (c’est cette éventualité qui m’angoisse également, à vrai dire), même si je suis consciente qu’il faut certainement un peu d’entrainement et de pratique pour que ce phénomène s’estompe.

Dom : il te suffit : en position Gasho, d’affirmer ceci avant de commencer : « je suis praticienne de Reiki Usui de niveau 2 et je vais remplir ce cristal d’amour et de Reiki et le programmer pour mon plus grand bien et pour le bien du tout. Seules mes idées et mes pensées bienveillantes entrent dans la mémoire du cristal, je suis protégée à tous les niveaux. Merci et…Ckr 3 X fois ».
__________________________________

F : J’ai suivi le stage REIKI 1 des 11 et 12 janvier 2014 et j’aurai un conseil à te demander.

Ma nièce vient d’accoucher d’une merveille ! petite Eva ! et pense déjà à ses premières vaccinations pour lesquelles elle a une certaine réticence. Puis-je l’aider par des séances de REIKI (et comment) pour gommer les effets secondaires éventuels de cette vaccination ?
Je pratique régulièrement sur moi et j’essaie, dès que j’en ai l’opportunité, d’en faire profiter mon entourage. J’ai notamment bien aidé ma nièce pendant sa grossesse et surtout j’ai soulagé sa douleur après l’accouchement.

Dom : bonjour F. l’idée serait de pouvoir faire 3 à 5 mn de Reiki au vaccin avant l’injection….mais le toubib le voudra t il …!!
Sinon, tu feras un soin au BB durant les 3 jours avant, et un soin durant 3 jours après, 10 mn chaque soins ; 3 mn tête/3 mn cœur/3 mn ventre/ 1 mn ou 2 pieds.
bons soins

F : Merci beaucoup pour ta réponse. Je pense que 3 mn de Reiki au vaccin avant injection sera possible.
Une autre question me vient à l’esprit : peut-on faire du Reiki à distance sur une personne que l’on connait bien et à qui on aurait déjà fait une ou plusieurs séances en direct ?

Dom : oui, aucun souci….peut être la prévenir, il peut se passer des choses, même agréables….

F : Parfait, merci beaucoup
____________________

A : bonjour Dom ; j’ai fait plusieurs soins à distance et à chaque fois je me sens « vidée »
si j’ai bien compris ce que tu as dit ce n’est pas normal. je ne sais pas quoi faire. c’est dommage parce que dans l’ensemble les résultats sont plutôt satisfaisants
t’as une idée de ce qui ne va pas?

Dom : ça peut venir d’une intention trop importante, un vouloir guérir trop impliqué.
Relâcher, faire la pratique et laisser le Reiki et les symboles faire la guérison.

A : ça c’est fort possible! D’autant que j’ai fait les soins à des personnes proches (la fille de C, ma fille…)
j’essaye de rester présente à mes sensations et à la personne à qui j’envoie le soin. je me rappelle que tu as dit que ce n’était pas nécessaire mais j’ai l’impression que je suis encore trop débutante pour y arriver. Idem pour l’auto-traitement.

Dom : Trop débutante dis-tu !!?!! je pense alors que ça peut être….. le rituel de préparation, incomplet ou fait trop mécaniquement, trop technique quoi ! (révise pour voir…la copie du stage sur le rituel R 2…)

A : incomplet non, je fais le rituel avec la feuille sous les yeux. mais peut-être mal fait. je le connais presque par cœur mais parfois j’ai un trou de mémoire. (faudrait vraiment que le reiki me donne un coup de main pour ma mémoire) c’est vrai que quand je jette un coup d’oeil sur la feuille ça coupe un peu le fil du rituel…
Dom : avec les proches, il convient de se détacher de l’affect, c’est primordial ; s’ils guérissent c’est bien, s’ils ne guérissent pas c’est bien aussi : c’est leur histoire….pas la notre. Leur karma est personnel, secret, intime. On met l’amour dans nos intentions de praticiens Reiki, mais aucune attente, on laisse faire le Reiki entre les personnes et le Reiki.

Le symbole HSZSN, lui seul suffit à te connecter au Reiki, il annule la distance et « il envoie lui même » le Reiki….toi tu es l’instrument dans lequel coule l’énergie, tu n’es pas l’énergie, donc ; tu ne fais rien. Ce qui signifie :
> Tu ouvre le canal ; 1 avec le symbole, 2 avec la prière « je prends la décision d’ouvrir le canal Divin….je pose mes mains en toute confiance… », tu chante si le cœur t’en dit, et le Reiki fait le reste.


 

Vos retours de Stages !

stages-reiki-2eme-degre-Montpellier-nimes

Merci Dom pour cette belle élévation à la maîtrise ! Merci pour la qualité de ton enseignement et de ton relationnel. Ce stage fait désormais partie des moments marquants de ma vie. Je sens que ma pratique du Reiki va se modifier profondément. J’ai pris conscience aujourd’hui d’une « sphère » de chaleur permanente et intense dans la paume des mains. J’adore ces manifestations sensibles !

Je vais m’inscrire à ta newsletter et initier mes cristaux ensuite !

Bonne soirée et à bientôt, JL.

*************

Bonjour Dom, Je viens de prendre connaissance de ton mail, et viens d’imprimer, tes documents, c’est précieux. Je te remercie encore pour ce très beau week-end qui restera gravé, tout au long, de ma vie, dans la pratique du REIKI 4 !
Tu es un sage, un être de lumière, j’ai beaucoup aimé faire ce stage de Maîtrise avec toi.
Je remercie l’énergie Reiki, et par ma foi le Seigneur, de me trouver sur ton chemin.
J’ai aimé le groupe, l’ambiance, la synergie, et le lieu.

************************

J’ai encore la tête à Cabrières et le coeur dans DKM Tibétain…

Un petit miracle de douceur, de paix et de lumière….

Merci encore pour ta patience…. de maître.

************************************************

Merci pour les coordonnées du groupe! 😉

J’en profite pour te remercier encore une fois de cette belle initiation, j’avoue que ça brasse pas mal de choses encore une fois surtout sur un niveau émotionnel, je pense que sksk que je n’avais pas reçu et que tu m’as transmis y est pour beaucoup! 😉 même si ça fait mal, c’est libérateur, alors j’accueille !
Je calerai ma prochaine venue à Montpellier pour participer à une soirée d’échange, se sera un grand plaisir d’y participer 😉
Alors merci merci merci!!!!! Très belle journée ensoleillée, À bientôt, P.

**************************************

Depuis  mon initiation a la maîtrise reiki Usui Tbet, je suis envahie d’une sérénité et d’une paix incroyable. Au bout de quatre jours d »auto-traitement , pour la première fois….. j’aime et  je deal avec mes entités….le tout géré et canalisé par moi…….  Merci DOM…..merveilleux  weekend-
Bise
Encore merci pour cet apprentissage de la technique du pardon.  Je la pratique de temps en temps et commence à ressentir cette paix intérieure mais je sais que la route est encore longue.

___________

Bonjour Dom! Tout d’abord à nouveau un grand merci pour ces deux jours formidables et cette fabuleuse transmission! Quel beau moment! Je suis très heureuse que le Reiki t’ai placé sur mon chemin!
Mes anges m’avaient envoyé le message suivant: « nous vous enverrons de l’aide sur Terre sous formes de maîtres et lectures afin que vous puissiez développer vos dons… »
Je les en remercie: te voilà;-)
La route n’est pas finie…j’ai encore du boulot… Et j’espère que tu accepteras de m’accompagner dans mon apprentissage!
…et pour finir, merci pour les contacts;-) A très bientôt!

_____

merci à toi pour ton e.mail,et un grand merci à tous ,pour ce que chacun à apporté au groupe lors de ces deux journées du stage, joie d’echange et de partage d’emotion et d’énergie du Cœur ! …..J’ai moi aussi commence à pratiquer et j’ai eut la chance d’avoir vécu coup sur coup ,dans les 2 jours qui ont suivis, plusieurs experiences  formidables,que l’on pourras echanger j’espere sur Skype ou lors de nos prochaines rencontres à la planete reiki,!!!
…..ces experiences don’t je vous parle, m’ont amenées à m’inscrire des à present au stage reiki 2 des 14 et 15 juin prochain.
….comme ont c’etait promis de s’en tenir informés, çà c ‘est fait.
…au plaisir de vous revoir les uns et les autres ,soit sur Skype ,soit ailleurs….à la planéte reiki ,par exemple,lol
Nous avons la chance d’avoir un Maitre  du Coeur en la personne de Dom, et çà c’est une Bénédiction!!!.(.merci Dom pour l’ecoute, ton enseignement et ton Coeur)
bonne soirée et bon w.end à tous!…..

*******************************

il est tard , mais je viens de vivre des instants emotionnels tres forts en l’espace d’une heure!!..houa!!…..merci pour la force et la foi avec laquelle tu nous a souligné l’importance du : ICI ET MAINTENANT, l’instant present, ……et de l’ Amour avec un grand A ,don’t tu as commence à nous imprégner!…..voilà, çà c’ est dis.
Pour les emotions, je te les expliquerais de vive voix, ce seras plus facile que sur l, ordi.
A TRES BIENTOT……………merci…pour ton accueil chaleureux,et ta disponibilités envers chacun d’entre nous.

C

 


 

 

 

Mars 14. Abricotiers en fleur !
La bête du printemps !

Les Crampes

– Je dois faire une séance de Reiki à une personne qui souffre de crampes à la main. Peux-tu me dire comment je dois m’y prendre ? Mrrci.
Dom – fais un scanner approfondi, en toute conscience, très important, puis : prise cosmique 15 mn puis traitement local sur la main 15 mn….puis 5mn à la tête, idem au cœur, sur le sacrum et fini par le chakra racine….et CKR sous les pieds.
– Avant le soin, discuter avec elle pour qu’elle « ex-prime » ce à quoi elle se cramponne, s’agrippe…qu’est qui est important pour elle et qu’elle ne veut pas lâcher ?…crampe = se cramponner à, s’agripper à….
main = manipuler, les objets et les situations…
Avec Shk (entre elle et toi ) faire en sorte de l’écouter, éviter de proposer des solutions toutes faites….mieux vaut la questionner et re-questionner. Propose lui, après le soin, le lendemain par exple, un « traitement M ». /établir une phrase affirmative positive de ce qu’elle veut à la place de « se cramponner, s’agripper à .. » / et compléter avec un Reiki à distance avec la même formulation positive.


La soirée Karuna…un mot pour vous de notre chanteuse bien aimée…

Merci à toute cette bienveillance hier soir

je suis sur le départ pour jouer… le grain de la voix sera là mais je suis tranquille, accompagnée

biz fabiola
ps: je n’ai pas les mails des participants d’hier soir


Les grandes questions sur les doutes de soi face au Reiki.

– Les bienfaits du Reiki, depuis mon initiation je suis plus en paix avec moi même beaucoup plus sereine, le seul hic est que je doute toujours de moi, j attends toujours quelque chose de concret que mes mains chauffent ou fourmillent etc. Parfois, je me demande si je suis vraiment canal ? Comment le savoir ?  

 

–  c’est une vue d’esprit que je vous invite à changer ; n’attendez rien, acceptez l’énergie telle qu’elle s’offre à vous pour le moment, ne rien sentir c’est une façon de sentir, avec le reiki il faut poser les mains et laisser faire, ne rien attendre…visualisez de belles lumières entrer dans vos organes, dans vos os, irriguer le sang, voyez vous rayonner de lumière, entourée d’anges….une h de reiki ; une h de bonheur et de rêve.


Reiki à distance pour soi

– Sur un polycop du cours du 2ème degré, tu dis que pr activer un symbole en particulier il faut LE tracer ds les mains etc etc. On ne trace pas CKR ? Je croyais qu’un symbole était activé que conjointement à CKR ?

– chaque symbole est indépendant, on les active en les traçant dans l’espace. P
our augmenter le contact avec son énergie lorsque l’on désire faire un travail en pleine conscience active avec un symbole en particulier ; on le trace dans les mains/l’aura/l’espace.
ckr n’active pas les autres symboles, il active son énergie à lui.


 à distance pour soi 

– Tu peux me résumer qd on brule le papier (ou la photo) ? Tu dis par ex de le bruler après que le rv soit passé (N.M le fait tt de suite après l’envoi). Bref, je me mélange les pédales.

 – de suite après l’envoie pour un envoie  sans quartz.

– après le rdv si envoie avec quartz  pour un rdv, de même pour la journée, ou pour plus longtemps.


 à distance pour soi 

–  Qd tu dis “charger un cristal 15mn”. C’est à faire avant de l’utiliser avec le papier ou en fait c’est lorsqu’on envoie le soin pdt 10/15 mn qu’il se charge ?

– on charge le papier et le cristal ensemble 5 à 15 mn, et après on les laisse ensemble, à l’abri des indiscrets.


 à distance pour soi  

– Est ce que je peux charger plusieurs cristaux pour moi même ou pour autrui : par ex, j’en ai chargé un pr travailler sur les 9 mois avt ma conception (je continuerai avec le m^me crisal pour “les 9 mois de la période utérine “ etc) et un autre pour ma dépendance à la cigarette. C’est ok ? je peux même en charger d’autres pr d’autres prbs ?

–  autant que tu veux !!! pour toi et pour les autres.


Initiations à distance…

– Une personne sur un forum me propose de m’initier gratuitement au niveau 3 (branche traditionnelle où le 3 et le 4 sont fusionnés), mais bon je te fais plus confiance pour la transmission de l’énergie des symboles.

– Les initiations à distance ça ne fonctionne pas du tout. Un autre cas ; les gens qui font ça gratuitement ne s’engagent en rien, ils ne prennent aucun risque ni aucune responsabilité, n’assument aucun suivi en cas de « remue méninges ». En général ce sont peut être des personnes qui ont très peu travaillé sur eux en profondeur les énergies du Reiki 4, déjà ils ne respectent pas l’éthique qui est enseignée lors de la maîtrise. Je le sais car je ré-initie des personnes initiées « gratuitement »….d’autres personnes passent un degré Reiki et se font eux même la maîtrise avec un livre, ça ne fonctionne que dans l’illusion, et idem ; pas de suivi en cas de remontée d’émotion ou de décollage.


énergie ; trop plein ou jamais assez !!??!!

– j’aimerai pouvoir avoir à ma disposition toute l’énergie du Reiki. Est ce que tu proposes juste les initiations des symboles 3 et 4 mais pas les cours ?

– ça ne sert à rien de recevoir des initiations aux symboles et ne pas savoir s’en servir ! et c’est très dommage.
Par contre je fais le Niveau 4 sans la partie « enseignant », ça se fait en une journée, et les symboles sont puissants, car dans cette journée je transmets toutes les façons de les utiliser ; la façon traditionnelle, et celles de mon vécu.

– Je voudrais juste faire mes Auto-Traitements ou des soins avec la totalité de l’énergie. Etre maître ne m’intéresse pas du tout, le reiki est plus pour moi un outil pour mon chemin spirituel (et les soins à autrui en font partie).

– tu viens d’être initiée avec leniveau reiki 2, c’est une très belle énergie, et de nombreuses techniques éprouvées et appréciées dans le monde….faudrait peut être déjà faire avec ce qui est à faire….
Le Reiki n’est pas un enseignement du livre….mais du vivre !
Pour augmenter ton énergie Reiki, va souvent dans la nature, marcher, t’asseoir par terre, te connecter à la source et prier doucement, communier, et faire du Reiki pendant ce temps, dans les bois, au bord de l’eau, sur le sable face à la mer…prends des bains de pleine lune, ça active l’énergie de vie du 2ème chakra…Et si tu peux venir aux ateliers chakras tu bénéficieras aussi d’outils très complémentaires au Reiki. Et, à ne pas manquer ; l’atelier du pardon.


 

 

 

Février 2014 ; premières fleurs d’Amandiers !

émerveillement du retour du printemps

émerveillement du retour du printemps

T : j’espère que tu as passée une belle journée sous cette bénédiction du ciel et ces nuages duveteux qui nous cochonnent telle une douce couette pour nous protéger du froid !!!!!!!! (hihihi le bon côté des nuages, c’est qu’on a des températures douces ! ).
Je voulais partager le fait que ce soir j’ai fait une séance de rééquilibrage de chakra dans le bain ! c’est top ! L’eau devient une grosse bulle enveloppante de Reiki !
Et puis aussi Seb s’en est fait une ce matin dans le train. Nous avons passé un super week end, et sommes très content d’avoir reçu ton enseignement !
Je voulais te demander aussi si tu peux me rappeler comment on fait un nettoyage de pierre avec  le reiki ? je te remercie.

Dom : Continuez de coincer la bulle Reiki ! C’est trop beau, merci du partage.
Pour nettoyer une pierre avec le reiki 1er degré ; on trace le symbole dans les mains/l’aura/l’espace devant soi (au centre de la pièce par exple) puis on place la pierre dans la main non dominante, on trace le symbole au dessus et on « l’enfonce » dans la pierre en prononçant 3 fois le nom du symbole avec cette pleine conscience que l’énergie du ciel et de la terre purifient la pierre.
On peut faire ça avec n’importe quel objet. Au 2ème degré on rajoutera le symbole Mental-Émotionnel, plus la TJR Jaki Kiri Joka-ho : tenir la pierre dans la main non dominante et se centrer sur Swadhisthana chakra/ grande inspir/ passer 2 fois au dessus de la pierre avec la main dominante et s’arrêter dessus au 3ème passage. Ce geste s’accompagne du souffle continu. Suivez ce lien pour avoir une idée…mais je préfère pratiquer en un seul souffle continu.


Le symbole du coeur du 2ème degré, SKSK, qui était nouveau pour moi , m’a surpris ; un effet bœuf !  plutôt comme une bulle de savon au niveau du cœur blup ! ; en application personnel bien sûr. Bien  très bien.
X.G


S –  J’ai besoin de toute ta sagesse. Depuis la formation Reiki 1 du 10 novembre, je me sers du Reiki pour soigner ma vésicule qui dysfonctionne. Ça marche forcément car je sens que ça bouge pas mal. Mais ces derniers jours, elle est devenue très susceptible, voire douloureuse. En fait, elle préfèrerait que je ne mange pas du tout, ce qui est incompatible avec ma survie quotidienne ! Tous les soirs, en voiture aussi ! et le matin je lui fais CKR + position des mains. Je suis persuadée que ça l’aide. Mais hier j’ai préféré consulter mon toubib, qui m’a prescrit Radis noir et artichaut en homéopathie + une échographie. D’après lui on se dirige droit vers l’ablation compte tenu des résultats de l’auscultation. Et moi je ne suis pas d’accord. Je l’ai dit au Reiki, mais je crois que je ça ne suffit pas! Peux-tu me faire part de ton avis ? Dans l’attente de ta sagesse, Belle après-m, S.

– Dom : bonjour S. la vésicule est liée à de la colère, de la rancœur ou/et de l’inquiétude…
il serait peut être bon de consulter une hypnothérapeute pour connaitre l’origine de l’émotion.
Je te conseille d’écrire tout ce qui t’as fait vivre de la colère ou/et de la rancœur, ainsi que tout ce qui t’inquiète. Tout en continuant ton auto-traitement reiki et les soins en « traitement local »et de manger selon les recommandations du médecin. je reste à ton écoute. Amicalement. Dom

S  Merci. Je pars en vacances de noël dans ma famille, rassurée, ça a beaucoup bougé en moi, je te recontacte en janvier.

Un peu plus tard…. 

S : Je t’avais contacté avant Noël car j’avais quelques soucis au niveau de la digestion (vésicule). Je pense en fait que j’ai vécu les fameux symptômes de guérison. Dans la nuit du 23 j’ai eu un malaise vagal et depuis tout va bcp mieux, comme si mon corps avait fait un « reset ». C’est un peu étrange, depuis je suis devenue plus sensible, malgré moi, à ce que mon « corps » me dit au sujet de ce que je mange, c’est une expérience intéressante. Merci Dom.


Suite à un décés et la difficulté qui s’en suit…

Dom :Pour supporter le deuil un peu mieux, tu as le droit de décider que la mort n’est pas une disparition mais une transformation. Ta mère se trouve là ou elle doit se trouver, rappelle toi qu’avant tout nous sommes esprit et que le corps nous est confié pour une expérience limitée. En tant que tel, ta mère est en lien avec toi, rien n’est changé, sauf sa forme. Parle lui, d’esprit à esprit.

Prière à écrire sur le papier puis charge le quartz 15mn tous les 4 jrs pendant 21 jrs : « Avec amour je me libère du schéma de pensée qui avait créé cette situation. Mon état émotionnel s’apaise de jour en jour de la manière la plus positive et de la manière la plus Divine. Merci »

Pose toi et ressent en toi ; OU est ce que ça te touche ?

à quel niveau ?

au niveau de quel chakra ?

cela te rappelle t il quelque chose déjà arrivé ?

Souvent ?

dans l’enfance peut être ?

dans le même temps, met tout dans le coeur (avec SKSK pour y aider) et pardonne lui d’être partie, pardonne tout, sans cesse…et pardonne toi à toi de subir ce deuil.


Un Rêve….

V : Slt dom, J’aimerais te faire part d’un rêve et le donner ton avis si possible.
C’ est assez strange comme beaucoup de mes rêves. Ça se passe à mon boulot avec pour commencer un collègue que je croise et qui me parle d’un bruit qu il ya dans une pièce .il me dis c’est….. (Je ne me souviens plus du mot exact) je lui réponds que ça vient du masque de fer.de là, je continue mon chemin et passe devant un résident mort et en fait dans la salle il y avait d’autres patients  .. ..ils étaient tous de cire même le mort.et là flippe jr me réveille.
Qu’en penses tu. Je suis allée consulter le dico des symboles mais difficile…

masque-de-ferDom : à priori cela me semble assez Facile à interpréter…
masque de fer = emprisonné pour qu’il ne prenne pas sa place, se taise et ne soit pas reconnu !

ton yang ; l’action, l’agir….un peu dans la cire, figé comme mort…se tait, ne donne pas , n’affirme pas son avis…ne prend pas sa place…

cire à faire fondre doucement mais surement….


Quelques lignes pour te tenir au courant des résultats de mon apprentissage reiki auprès de toi. Dans l’ensemble, je continue d’aller mieux.

Avec les auto-traitements de Reïki, cela va bien. Si je n’ai pas le temps de faire le matin, je ne me sens pas si bien que les autres jours. Mes énergies continuent de
bien re-circuler, je me recharge bien et il me semble que je ressens beaucoup moins les peurs qui paralysaient ma vie, je reprends goût aux choses simples et je reprends
soin de moi, sans aucune culpabilité, juste pour moi et mes relations avec les autres s’améliorent. J’ai repris doucement mes petits travaux ésotériques tranquillement.

Avec les cristaux, j’ai des résultats au delà de mes espérances. Mon cristal de réparation du mental refusionne mon mental et mon émotionnel si bien que je ne sais pas depuis combien de temps, mais ça a été très rapide, aussi, je ne pense même plus comme avant et le mot parasite « c…e » a quitté mon esprit. Le cristal est toujours en charge et il m’aide beaucoup pour l’estime de moi-même que je semble retrouver et mon manque de mémoire ne me préoccupe plus autant, d’ailleurs, j’ai gardé mes habitudes
de travail avec mes notes et ma mémoire photographique et mémoire de ma main, et avec le symbole SHK à la fin de ce qui est important, ça va bien et j’ai même des facilités…
Aussi, lorsque je charge un cristal, je le prends et avec la pointe comme si c’était un crayon, il enregistre sa mission et cela imprime ma mémoire aussi et me permet d’avoir
un lien intime avec celui-ci.
J’ai maintenant 6 cristaux pour moi dont celui de réparation de vie longue durée qui m’aide beaucoup, car mes chagrins et mes peurs semblent s’estomper tout doucement.
Aussi, j’essaie de prendre soin de mes cristaux autant qu’ils le font pour moi …mais je ne pensais pas avoir un jour une relation comme ça avec des minéraux …
Je les recharge maintenant tous ensemble, mais comme la charge énergétique est répartie sur tous, ils ne tiennent plus 3 jours, je les recharge tous les jours si je peux sinon le plus rapidement possible, car ils ne tiennent pas 48H00 et je suis obligée de tout recommencer.
Avec l’atelier chakra racine, ça va bien. J’ai un peu tardé à faire les exercices énergétiques que tu y enseigne, mais je m’y suis mise. Cela m’intéresse beaucoup et je peux aussi commencer de lire certains livres que j’avais et qui me paraissaient compliqués. Les exercices énergétiques complètent bien le Reïki, même si je ne les fais sûrement pas toujours comme il faut. Pour l’exercice de l’arbre qui s’enracine dans le rouge, j’ai un problème énorme avec cette couleur, d’ailleurs m’est revenu tous les détails d’un traumatisme épouvantable de mon enfance (mais je n’ai pas ressenti trop de gêne émotionnelle, un peu comme si je n’étais que spectatrice, ce qui m’a permis de remettre le film et les détails convenablement c’est le Reïki qui m’aide, alors, j’ai fini par changer la couleur qui est devenue rouge/orangé avec du jaune comme la lave des volcans ! Aussi, mes pieds sont moins froids et moins souvent.


Bonjour DOM, Je remercie le jour où j’ai pris la décision de découvrir le Reiki qui m’a permis de te rencontrer. Je te remercie pour ton initiation au premier et second degré et pense continuer plus loin mais plus tard. Je me laisse le temps d’avoir l’esprit plus serein, ce qui est compliqué depuis plusieurs mois, pour être prête. Je te remercie de m’avoir permis de participer à des moments d’échange, de partage avec toutes les belles personnes des stages et soirées. Je te remercie pour ton enseignement et tes messages qui m’ont permis de passer des épreuves et d’apporter aussi le réconfort auprès d’autres personnes. Je te souhaite une belle année 2014, une excellente santé, beaucoup d’amour et de partage, de beaux moments de vie. A une prochaine rencontre DOM. Bise. N.


A.B : Cher/e/s ami/e/s, Je vous souhaite une belle année 2014 pleine de santé et de bonheur… et de magnifiques expériences reiki en espérant que vous êtes tou/te/s en bonne forme.

Dom : bonjour Annie, je te souhaite à toi et ton Amie Yudit, le meilleur pour 14. Comme pour toutes choses, la vie nous montre qu’en insistant, en persistant, on obtient des résultats. Le miracle c’est ça ; agir. Et le reiki est un miracle dans ce sens, qu’il nous permet d’agir, pour créer nous même des miracles. je pense ce matin après lecture de ton mail, qu’une initiation devrait encore améliorer sa santé. En effet, lorsqu’on est initié, et qu’on pratique un peu régulièrement, et que quelqu’un nous fait du reiki cette énergie est plus forte. La preuve est montrée lors des soirées partage…En comptant aussi sur l’effet des 4 initiations. Si cela posait un problème, je peux lui faire les 4 initiations sans faire « un stage ». Juste l’énergie des initiations. Puisque sur ton mail tu nous souhaite de belles expériences reiki, je suis prêt à tenter celle ci ! Ces initiations seraient particulières, si Yudit est d’accord je pourrais mettre les faire un vendredi avant, pendant, et après la soirée partage.

…et Yudit fut d’accord, je l’ai initiée au canal Reiki, en privé, 4 fois dans la journée conformément au protocole Usui, sans lui donner aucune informations autre que si elle le voulait elle pourrait poser les mains sur elle et sur son entourage, rien d’autre ( si l’on peut appeler ça rien…!)
voici le retour que j’ai reçu par texto : « Bonjour Dom, juste pour t’annoncer la MERVEILLEUSE nouvelle que ce matin Yudit s’est réveillée avec beaucoup moins de douleurs pour la 1ère fois depuis 2006 !
Merci ! Je n’oublie pas le Reiki et tous les amis qui ont œuvré dans le silence. Je vous embrasse. Annie. B

-Dom…voilà ; Planète Reiki, l’énergie du coeur.


Merci pour ce week end
Merci de nous faire grandir
Merci de nous aider
Merci d être la pour nous
Merci pour la lumière
Merci pour l énergie
Merci pour l amour

Merci du fond du cœur
Richard


Décembre 2013

– L : Juste 2 questions : Concernant l’Auto Traitement, moi qui ressentais bcp de chaleur dans le corps de suite après le stage, je ne ressens plus rien. Sauf une légère chaleur sur plexus, sacré et pubis et le chakra racine. Cela veut il dire que mon corps s’équilibre en énergie ?

2ème question : 21 jours d’Auto Traitement qui je l’avoue sont ennuyeux à faire bien que j’en profite pour méditer en me concentrant sur mes mains ou ma respiration.  Mais ensuite ? Comme je ne fais pas de soins sur autrui, il faudrait que je continue les AT ou juste quand j’ai un problème de santé, d’énergie etc ?? Merci et à bientôt (Je vais apprendre à tracer les symboles du 2ème niveau avant de venir pour ne pas galérer comme au 1er degré. L

– Dom : bonjour L. l’AT des 21 jours sert à purifier le corps. Et aussi, à prendre l’habitude de pratiquer au quotidien. Le fait de ne plus ressentir ou peu, l’énergie Reiki, peut venir d’avoir pratiqué 21 jrs « parce qu’il fallait » et non par plaisir. Ce qui peut expliquer que tu trouve ennuyeux. Maintenant le traitement au quotidien va entrer dans les couches profondes de la psyché et de l’émotionnel pour les préparer au 2ème degré.
Je crois que tu dois trouver en toi le plaisir de pratiquer, en ressentant ou pas. Le plaisir de donner de l’amour à ton corps, le plaisir du bien être, musique, encens, bougies, calme, huiles essentielles….beauté…cherche de ce coté là.
Je ne suis pas sur que tu es la dernière version du symbole de distance, étant donné que tu es inscrite pour le 2, la voici en pj, exceptionnellement. 

– L : Euh…., en fait je n’ai pas fait les 21 jours…. Inconsciemment j’ai l’impression que je refuse de faire ce qui me fait du bien. Mais je m’y suis remise depuis 3 jours consciencieusement (et avec plaisir) pour être prête pour le 2ème degré.  Merci pour le symbole. J’avais vu le même sur le livre de J.V sauf pour les 2 derniers ptts traits qui ne touchent pas celui du bas. Par contre j’aime bien ton exemple, car il trace le symbole en plusieurs parties et c’est plus facile à mémoriser. enfin c’est vite dit étant donné la complexité du symbole.

– Dom : Evidemment sur un livre les symboles ne peuvent pas être « réactualisés » ! D’où l’intérêt de venir en stage pour être sure d’avoir la bonne calligraphie…et le bon enseignement sur les façons infinies de les utiliser.


 

– V : j’ai une question a te poser : t’es-t-il déjà arrivé qu’une personne te demande de ne plus travailler à distance ou travailler tout court sur elle car Reiki la perturbe ?! C’est mon cas par rapport à mon compagnon… Je reçois inconditionnellement la réponse de l’univers mais me sens néanmoins « mal » dans mon être intérieur. Je reçois ceci comme une épreuve qu’il m’est demandé d’accepter et de gérer. J’aurai besoin s’il te plait de ton avis !

– D : ce qui serait correct de sa part serait de m’en faire part, de ce qu’il ressent à ce sujet, étant son maître enseignant ça me concerne…qu’il aille au mieux. Et je garde le secret professionnel bien entendu. Tu n’en saurais rien, ça resterait entre lui et moi, normal.
Ensuite il peut arriver qu’entre pratiquants en couple l’un d’eux ressente un besoin de coupure ou un trop plein de fusion et croit qu’il faut arrêter les échanges de soins. Je pense plutôt qu’il y a un manque de savoir poser les mots justes, suite à une difficulté voire impossibilité à identifier l’origine du ressenti dit « désagréable ». Cette origine étant certainement d’ordre émotionnelle, affective, un « quelque chose « qui remonte du fond de soi, du passé » sans doute, et notre culture prouve encore une fois notre INCULTURE émotionnelle.
De toutes façon l’occasion pour ton compagnon de pratiquer sur lui jusqu’à éclaircissement.

Un grand merci pour tes conseils avisés. J’ai transmis à R. En travaillant avec C K S j’ai su trouver les mots hier afin de ne pas rentrer dans sa colère et merci au Reiki pour tous les degrés de conscience que nous cheminons, enfin dans la sérénité.


 

Questions ; ressentis :

-V : Dans d’autres cours, sur des livres Reiki, ils parlent de lisser l’aura en premier sur une personne, alors qu’en stage tu nous apprends à lisser l’aura en dernier, après un soin.

– Dom : a mon humble avis, lisser l’aura avant de faire un soin à une personne, ça ne présente aucun intérêt puisqu’on va plonger les mains dans son aura, les ressortir et recommencer durant une heure ou plus.

– V : Par contre ils ne parlent pas de “scanner” l’aura pour déceler les “trous”, mais je trouve cela très bien.

– Dom : Le scanner (Biosen pour ceux qui aiment bien « parler » Japonais ; se traduit par « scaner intuitif » en Français)se fait, lui, en début de soin,et cet acte énergétique, aussi subtil soit il, guéri l’aura, donc guéri le corps ; voilà un intérêt. On le constate en stage lors de l’atelier « Scanner » quand des personnes travaillant ensemble le Scanner intuitif, ressentent le passage de l’énergie et ses effets, des guérisons spontanées parfois.

– B : une question ; lors du rééquilibrage des chakras, c’est bien de dessiner CKR sur chaque chakra ? A l’endroit ou à l’envers puisque c’est sur nous donc sur l’aura ?

– Dom : TON DOIGT le dessine sur toi….tu pars EN HAUT, de ta droite, au centre tu descends, en bas tu vas vers ta gauche pour la spirale. En petit sur chaque chakra, en partant du Racine.

– T : Quand j’harmonise mes chakras, je ne ressens rien au niveau du chakra racine alors que c’est celui là chez moi qui a besoin de s’ouvrir…”normal” ?

– Dom : tu ressentira dans certaines situations, sois sans attente et nourri le généreusement, mais sans oublier les autres puisque les chakras sont tous en relation permanente.

– Il faut mettre la main devant au niveau du périnée ou derrière au niveau du coccyx ?

– D : devant, en direction du coccyx, ou sur le coccyx (selon la posture que tu prends)

–  si cela chauffe sur un chakra, il faut attendre jusqu’à ce que l’autre chakra chauffe de la même façon pour les harmoniser ?

– D : ça n’est pas obligé, ça pourrait durer longtemps, mais ça n’est pas interdit non plus. Le mieux est d’être intuitif mais à savoir que pour qu’un équilibrage soit remarquable, il convient dans tous les cas de donner la même durée de Reiki à tous les chakras, sauf au n°4, autant qu’on veut.

– Je ne ressens rien sur les positions de la tête, par contre beaucoup de chaleur à partir du thymus, cœur etc. Normal ?

– D : oui, c’est assez exceptionnel de ressentir l’énergie au niveau de la tête au début de la pratique Reiki. Les ressentis de l’énergie augmentent au fur et à mesure de l’ouverture du 3ème œil, c’est-à-dire au fur et à mesure que notre vision du monde et de nous même devient plus réelle et objective. A ce moment là les perceptions extra sensorielles ( au-delà des 5 sens) deviennent impressionnantes, lumineuses, délicieuses. C’est une des récompenses de l’assiduité à la pratique.

– Problème de dépendance au tabac. Je voudrais savoir si avec le niveau 1 Usui je peux faire qqchose. Je pense que c’est plutôt avec le niveau 2, mais on ne sait jamais.

– Dom : au niveau 1 tu y gagnera en travaillant matin et soir les idéaux de Reiki, ils apportent le calme et la clarté d’esprit. Tu pourrais déjà accepter que ça soit dur, difficile d’accepter de fumer. Au 2ème degré on apprend une technique pour se libérer des addictions, et je la fais réaliser en atelier lors du stage.

– tu me connais, le lâcher prise n’est pas encore pour moi.

– D : travaille les 5 idéaux du Reiki et sois sans attente….ça aide au détachement.


Vésicule biliaire

 – S : J’ai besoin de toute ta sagesse. Depuis la formation du 10 novembre, je me sers du Reiki pour soigner ma vésicule qui dysfonctionne. Ça marche forcément car je sens que ça bouge pas mal. Mais ces derniers jours, elle est devenue très susceptible, voire douloureuse. En fait, elle préfèrerait que je ne mange pas du tout, ce qui est incompatible avec ma survie quotidienne ! Tous les soirs, en voiture et le matin je lui fait CKR + position des mains. Je suis persuadée que ça l’aide. Mais hier j’ai préféré consulter mon toubib, qui m’a prescrit Radis noir et artichaut en homéopathie + une échographie. D’après lui on se dirige droit vers l’ablation compte tenu des résultats de l’auscultation. Et moi je ne suis pas d’accord. Je l’ai dit au Reiki, mais je crois que je ça ne suffit pas !

Que puis-je faire d’autre? Peux-tu me faire un soin ? Dans l’attente de ta sagesse, Belle après-m, S.

– Dom : la vésicule est liée à de la colère, de la rancœur ou de l’inquiétude…il serait bon de consulter une hypno thérapeute pour connaitre l’origine de l’émotion.

 je peux te faire un soin spécifique, oui, j’ai guéri une fois un cas identique, un ramoneur en colère qui souffrait de la vésicule, mais il faudra y mettre le paquet en reiki qu’on te donnera, en plus de tes propres auto-soins.

Je te conseille d’écrire tout ce qui t’as fait vivre de la colère ou/et de la rancœur, ainsi que tout ce qui t’inquiète, tout en continuant ton reiki et de manger selon les recommandations du médecin. je reste à ton écoute.

– S : Merci Dom. Je pars en vacances de noël dans ma famille, rassurée, ça a beaucoup bougé en moi, je te recontacte en janvier.


 

Novembre 2013

Reiki 3…le guide…

Coucou Dom
J’étais en vacances la semaine dernière bien occupée et cela m’a permis de prendre du recul et de lâcher prise par rapport a mes soucis familiaux tout en continuant a pratiquer
Et tout s’est éclairé le poids s’est envolé les paroles justes ont pu être dites avec le COEUR.
Je ressens un grand soulagement et remercie 1000 fois le reiki,
Merci a toi aussi pour ton aide qui m’est très précieuse.
Ce qui est formidable c’est de savoir que je ne suis pas seule et que dans les moments de brouillard il y a toujours la lumière qui m’ attends et me fait signe. Mon guide me l’a dit et je lui fait totalement CONFIANCE.
B


Au creux de la gorge, la paresse spirituelle.

 

I – en parlant de Reiki, j’ai des doutes  en ce moment……tu vas m’étrangler mais j’ai l’impression que ça sert à rien…..pas de résultat….pourtant je pratique…..exple : la j’ai mal à la gorge, toux enfin un peu la crève quoi……et bien pourquoi ça ne passe pas avec le Reiki ? en plus cette mini crève me fatigue et bien même pas ça me donne la pêche…….rien…..en fait je ne vois pas de résultat qui me prouve que ça fonctionne et qu’on peut guérir ne serais-ce qu’un petit truc…….j’attends le miracle pour vraiment dire oui ça fonctionne……je sais par contre que quand on demande on obtient……n’est ce pas…..j’ai pas demandé le miracle de guérir quelqu’un je devrais peut-être…..depuis 9 mois je reikise une mamie – 90 ans – elle ne devrait plus avoir mal à son poignet…..et courir comme un lapin…..elle y met les moyens quand même pour aller mieux et j’ai pas l’impression d’être super compétente…..j’aurais aimé avoir de meilleurs résultats…voilà je me pose des questions sur l’utilité du Reiki…..je sais c’est dur…..surtout de dire ça à un maître Reiki ….surtout que je viens de passer avec toi mon 3ème degré. Je suis déçue…et ça m’énerve.

Dom – Je sais pas quoi dire, des fois ça arrive…..mais je pense qu’il faut lâcher prise…surtout au niveau de la gorge ;sa spécificité est de ne pas avoir d’attentes…. continuer, persister.  reiki et reiki, activer le symbole Cks et accepter ses messages avec Sksk.

I – Bien sûr je continu, parce que je suis têtue…..le problème c’est qu’il n’y en a plus de messages…..j’ai pas de réponses claires à une question…..rien, …pareil pour mon intuition….plus rien, le vide, le néant….
D – accepter de guérir c’est parfois aussi accepter de voir la cause, avec Shk demande au Reiki de te montrer la cause et accepter…avec Cks
I – il me fait la gueule je te dis il ne me répond plus…..
D – c’est peut être un moment de mise à l’épreuve par le vide du au passage du 3ème degré. Parfois l’intelligence universelle nous coupe les vivres non pas pour nous punir, mais pour nous Stopper. Arrêter et observer, voir, perce-voir, percer les ténèbres pour voir clair. Ces événements ne sont pas des catastrophes mais des bénédictions façon Univers ! pour nous faire grandir, ne plus rester en retrait de nous même.
Tousser c’est comme …..un besoin d’aboyer. Par la technique d’envoi à distance, fais comme tu as appris en stage ; il te faut trouver les mots justes pour dire ce qui ne peut pas se dire.

I – ouais après l’univers……je ne sais pas pourquoi je suis là et ni où je vais et ça m’énerve grandement………………..encore le néant……..

D – j’ai 2 questions pour toi. Combien de temps reste tu lorsque tu te fais un soin à ta gorge ? Il s’agit de traitement local, vu au 1er degré n’est ce pas, et il convient de rester 15 mn minimum, puis si possible faire le traitement complet et le faire chaque jours pareil pendant au moins 4 jours.

I – j’avoue que je ne fais pas comme ça, je fais à ma sauce, au ressenti…je reste 5, 6 mn sur ma gorge et je passe au cœur, pareil, et je mets mes mains ailleurs.

D – Donc ; active Cks une fois fait le rituel de préparation et reste 15 mn sur ta gorge.
Pendant ce temps répète la phrase affirmative positive appropriée, celle que j’enseigne au 1er degré avec l’auto rayonnement sur les chakras – il y a une phrase par chakra – tu peux réciter la phrase 3mn, faire 1 mn de silence, puis réciter la prière ésotérique du symbole une fois et recommencer le processus, en boucle pendant les 15 mn ou plus. Puis tu fais l’autotraitement complet. Ceci pendant 4 jours consécutif. Au moins.
Les antibios, c’est 3 fois par jours durant 8 jours, non ? Si on le fait « à sa sauce », ça marche… ?

Peu après….

I – ces derniers temps, j’y mettais un peu moins de conscience, c’est peut-être pour ça que j’ai eu ce petit passage avec bcp moins de sensations…..ça m’a servi de leçon….hier soir, j’ai eu un beau Reiki…..commencé par poser la planche multiple A. sur la poitrine (elle est touchée) et pendant ce temps 15mns Reiki sur la gorge avec ta phrase magique. J’ai ressentis toute la chaleur descendre le long des deux bras en passant par les omoplates (presque une sensation d’être initié), ça a duré un moment, très agréable, à ce point ça ne m’était jamais arrivé. Et après autotraitement entier en terminant par les pieds….. et j’ai passé une bonne nuit.


Fils de lumière.

E – Je suis tristounette ce soir. J’ai eu mon fils au tel et j’ai réussi à lui sortir les vers du nez. En ce moment il me dit tjs qu’il ne fait rien, je pensais qu’il disait cela parce qu’il n’avait pas envie de parler mais non il ne fait rien. Disons qu’il ne voit plus ses copains et qu’il ne sort plus. Il dit qu’il s’emmerde ….en fait je le sens seul et déprimé…..ça me fait souci, ce n’est pas son genre…….j’ai trop les boules en fait, dans ces moments j’aimerai être près de lui……je vais lui faire un envoi à distance. Tu peux m’aider à le formuler stp. Merci.

Dom – Lorsqu’un adolescent s’em…s’ennuie, tout comme un adulte d’ailleurs, il se peut qu’il y ai un manque en lui qui n’est pas formulé, pas exprimé. Si on lui demande « qu’est ce que tu as » il répondra « je sais pas ». Il y a des chances pour qu’on lui propose alors des phrases toutes faites genre « fais ceci, fais cela…ect. », des recettes pour combler le vide, un peu à la manière de la fumée ou de l’alcool ; combler le vide, le manque. Il conviendra de faire un petit effort ; se détacher de la volonté maternelle et considérer ton fils plutôt comme un fils de l’univers – abnégation du « Mon ».
Déformation du langage. «Le langage nous fait mal, et seul le langage peut nous nous en sauver ». Hervé Piekarsky. On ne nous pas apprit à dire ce « qu’on a » ou ce « qu’on n’a pas », on nous a appris à bosser pour produire. Hélas sans jamais demander si l’univers n’aurai pas une autre idée sur ce qu’on fait, ou sur ce qu’on fait faire, ou comment on doit le faire. La peur de l’inconnu, la peur du vide, possédés par « avoir ».
Mais si l’on continu à avoir peur de l’inconnu, alors on risque de faire du Reiki sans conviction. Les ados s’ennuient ? On leur donne un cadeau électronique, une fringue de marque pour plaire…une promesse illusoire.
Le Reiki est créé pour éveiller, pour sortir du conditionnement muet. Avec l’envoi à distance on va demander ce qu’on veut d’une façon affirmative et y croire ! Ensuite on lâche prise et on laisse faire l’Univers, un peu façon…« que sa volonté soit faite, moi j’ai fais ce que j’ai appris… ». De cette manière, ton fils recevra surement exactement ce qu’il a besoin. Au risque que ça soit une parole ou une action difficile à accepter pour un adulte –parents.
Je te suggère de procéder comme suit :

« Avec Amour……pour F…( + le nom de famille)
je demande la guérison totale, psychique, mentale et émotionnelle.
Sa relation avec la vie et les éléments, avec les êtres et les choses s’élève maintenant avec aisance et facilité.    La joie est en F…( + le nom) et autour de lui, une joie spirituellement non causale ; de la manière la plus positive et de la manière la plus divine. Merci « .
Lorsque tu as chargé le quartz avec les symboles et que tu as visualisé les symboles en lui :
tu le visualise joyeux en permanence et tu dis, à voix haute, claire, et calme :
« F..( + le nom)….est maintenant calme, détendu, serein et en paix. Le schéma de pensée qui avait créé cette situation, est maintenant totalement et définitivement dissout et est retourné à la substance universelle d’ou il l’avait tiré. »
Tu coupe en ouvrant les yeux et tu affirme : « Voilà ! Ce processus se réalise maintenant pour moi de la manière la plus positive, de manière Divine…et quelque chose de plus grand encore pour le bénéfice du tout ! Merci. »
Et tu termine comme d’habitude – Reiki 2 – ; tout remettre entre les mains de l’univers.

Si tu as un petit bout de quartz rose, place le dans les mains en même temps, ce merveilleux cristal amplifie les effets des phrases affirmatives.
Tu peux le laisser avec cristal après…c’est bon le cœur des F…


C’est la fête Reiki !

Nous avons reçu notre 1ère table de massage, c’est chouette!
J’ai des changements chaque jour de ma vie. Cela me rend vraiment HEUREUSE! Et tous les jours j’essaie de faire une technique différente. C’est très motivant car il y a un bon retour.

L’IPE du 3ème degré Usui

Ma 1ère expérience en soin IPE à domicile, 15 jours après avoir passé le Reiki 3. 

J’ai passé une excellente journée…..c’était divin.
J’avoue, c’est spécial comme technique….mais je leur ai expliqué grosso modo comment ça allait se passer et que ma respiration allait être bruyante, je les ai rassurées…… comme ça les personnes n’ont pas été surprises…..et donc tout c’est bien passé.
J’ai fait l’IPE sur ma cliente du jeudi. Au début je me suis dit « je suis mal barrée »….lol….il a fallu que je recadre en permanence parce qu’elle ne s’arrêtait plus de parler….le 2ème objet qu’elle voyait c’était le livre qu’elle avait lu le matin….j’ai failli connaître toute l’histoire….. ha ! je m’en souviendrais de ma 1ere IPE… par chance à la 2éme extraction tout est parti, elle voyait un vide et sa douleur du dos disparue !!! ….elle a été bluffée. Et après ; soin complet et méga hug à la fin (j’ai bien pensé à toi et à ce que tu dis sur le Hug qui ouvre le chakra du coeur), elle ne me lâchait plus….c’était super sympa. On n’a pas arrêté de se bizouiller et on se marrait comme des bossus….rire cosmique pour moi.

La dame du rdv d’après. J’ai commencé par l’IPE + soin complet, elle est stressée et elle mange tout le temps et elle veut stopper tout ça. Pour l’ipe ça a été magique, son objet un fauteuil en velours mauve de 45 kg……et qd j’ai fini le souffle et que je lui demande comment c’est maintenant…..elle me répond, il n’y a plus rien, c’est vide…..ça a été super rapide…j’étais même presque frustrée ; pas eu le temps de m’amuser beaucoup….
Je l’ai faite à nouveau cet apèm sur un jeune gars fatigué qui voulait un Reiki, je te laisse deviner..

J’ai dit à tout le monde que pour un résultat optimal et aller en profondeur,  le mieux c’était 4 soins consécutifs….ma  cliente du jeudi veut garder un par semaine, mais une qui fut bien convaincu ; la nouvelle dame qui a prit ses 4 rdv.

Voili voilou et maintenant je vais faire l’IPE sur le « mari »…..je suis au taquet….merci le Reiki 3 !


Sept. 2013

Beau retour de 2ème degré Usui.

I – Merci de faire une newsletter car ça m’aide dans mon cheminement, en fait ça nous aide tous.

Dom – C’est le but de mon travail, assurer un suivi. et partager la vie Reiki des praticiens. 
J’ai la tête trop pleine,

Faut la vider, méditer sur le vide, sur le rien, sur la paix, tu sais, en stage j’enseigne le travail avec les symboles, ok. Mais j’enseigne aussi les méditations, en silence avec les symboles, 20mn…

Première impression du deuxième degré : Je suis tombée amoureuse du Reiki, je l’ai dans la peau, je suis accro….même s’il met un grand chamboulement dans ma vie. La première semaine : J’ai eu régulièrement des nausées.

Plexus solaire !
Respirations, calmer le feu du centre solaire en faisant monter l’eau des reins, c’est-à-dire en accueillant les peurs (reins) au lieu de les combattre. 

Je n’ai pas été sur mon nuage, je n’ai pas plané non plus comme je l’avais fait au premier degré, dommage d’ailleurs car j’avais beaucoup aimé cette sensation. C’était complètement différent. J’étais là sans être là mais belle et bien les pieds sur terre. J’ai repensé x fois à la dernière initiation…..et oui forcément…donc j’avais souvent la larme à l’oeil, des fois un peu plus… J’étais calme, je pourrais dire à l’arrêt même. Certaines clientes m’ont dit que je n’étais pas comme d’habitude….ah bon !!! lol !!!

 Deuxième semaine : mal au plexus solaire accompagné d’un visage bouffi, boutonneux, génial !!! Plus une guerre dans mon couple (pas la guerre des boutons).

Réaction de feu ! boutons = minis volcans = feu de la puissance intérieure qui demande à s’exprimer ( ex = sortir  – primer/comprimée- sortir les non dits qui sont comprimés, compressés…) 

Autrement dit ; les non dits accumulés deviennent de la colère.

L’écriture peut libérer.
Consulter un psychothérapeute psychocorporel ou acupuncture…

Cette semaine : La troisième. Toujours mal au plexus, toujours boutonneuse, et en plus très souvent dans la journée, j’ai des picotements partout, ça passe d’une partie du corps à l’autre….et je me gratte comme une malade….j’ai bien regardé, je n’ai pas de morpions, ni de sansue, MDR. Le Reiki fait bouger des choses, j’en ai la preuve.

Démangeaisons = ça démange de, il me tarde que…agacements…

Encore le solaire ; Respirations conscientes, yoga, qi gong, sport qui ventile, footing et Reiki avec le cœur ! 

J’ai une grosse agitation. Je n’arrive pas à rester en place. Je passe d’une activité à une autre. C’est une horreur. J’ai la tête qui fume à donf. Je veux tellement profiter de la vie pour ne pas perdre une seconde………que je perds mes journées. C’est déprimant. Je pense gérer mais en fait je m’éparpille et je ne gère absolument rien.

Avec les idéaux de Mikao tu vas retrouver le bonheur de te poser de temps à autre, respirer, te poser dans tes racines pour DECIDER de faire une chose après l’autre…. 

Pour ma pratique, je m’éclate toujours autant. Depuis le premier degré, c’est tous les jours 45 mns sur bibi, par contre en ce moment je remets ma pyramide timer car je m’endors toujours, ça me permet de changer de position, et de me rendormir jusqu’à la sonnerie suivante, impressionnant d’ailleurs !!!

le fait de s’endormir beaucoup représente ce besoin de te poser, de calmer, de  t’accorder le droit au vide serein. 

J’allais oublier, ça tombe bien car ça me le fait, je ressens régulièrement un truc sur le dessus de la tête. Comment te le définir….. j’ai comme un air froid, un souffle subtil, comme si j’avais un trou dans la tête, la racine de mes cheveux qui bouge toute seule à un endroit bien précis. C’est quoi ça ?

Peut être le rapport avec le père qui est en train de se guérir (chakra coronal = père céleste/père-charnel/l’homme/le masculin et l’intuition qui se dégage)

Connecte toi avec Hszsn et demande le calme avec Shk, la paix, puis accueille dans le chakra du cœur avec Sksk tes intuitions.

Les cheveux = la force !

Elle vient de l’esprit, de la connaissance par soi même..

Plus l’esprit est calme, plus il est fort 

En sachant que j’ai aussi ce petit vent frais qui vient sur mon visage de temps en temps, j’ai vérifié s’il y avait des courant d’air, ben non pas de courant d’air, et après je suis envahie de frissons, ça ne dure pas longtemps.

C’est une belle façon personnelle de percevoir l’énergie en ce moment. Est-ce que ce vent frais a chassé les boutons !!?!!

J’ai limite assez de cristaux…..1 pour moi depuis ma naissance, 1 pour mon couple pour qu’on retrouve notre complicité et notre harmonie, et les 2 autres je m’en sers pour mes clientes après chacune de leur séance Reiki, je complète avec un à distance et je brûle le papier le 4eme jour….le papier seulement…et vu que je fais 4 séances par semaine en moyenne, et bien il m’en manque….bon, par la suite, j’en ferais encore plus, alors, je vais devoir garnir mon étagère de papiers et de cristaux…

Je vais S h k et ckr tous les soirs sur mon oreiller. Ckr sur et sous mes pieds matin et soir. Je purifie mon appart régulièrement. Derrière le dos de mes clientes de temps en temps, entre moi et une autre personne quand je discute avec elle je fais SHK, ça marche trop fort………….enfin, bref……..c’est un boulot à plein temps. Je vis avec le Reiki du matin au soir, je bouffe du Reiki…..et c’est super bon.
I.


Sept. 2013

Angoisse et Reiki

Bonjour dom

Tu avais dis en stage que tu étais disponible pour toute interrogation après le stage alors j’en profite. Je te remercie pour ce stage ; ton énergie associée à celle du groupe m’ont permis de retrouver une certaine paix intérieure. Paix intérieure qui avait tendance à diminuer fortement depuis ma dernière visite à Amma en novembre 2012. Cependant, cette paix intérieure retrouvée, a été fortement perturbée 2 nuits après le stage par des angoisses assez fortes : angoisses de faire du mal à autrui pouvant entrainer la mort. Cette angoisse a été déclenchée par le fait de que ma fille a cassé un verre en mettant la table et fatiguée par la journée je ne me suis pas assurée que tous les petits morceaux ont bien été enlevés de la table et notamment des assiettes. Si l’un de nous en a avalé un qu’allait –il se passer ?
Cette angoisse a été plutôt forte et je me souviens que quelques jours après la visite d’Amma alors que le darshan m’avait beaucoup apaisée, une angoisse identique (peur d’empoisonner des amis à qui j’avais donné des giroles) m’avait fait passer une très mauvaise nuit.  je suppose que c’est le mental qui se rebelle ?

Dom – Au 1er degré je vous apprends qu’il faut tout accueillir comme « symptôme de guérison », ce n’est pas facile mais il convient de s’y entraîner quotidiennement. Ainsi on arrive a ne surtout pas se « bloquer » sur une angoisse. L’angoisse n’est pas une émotion, mais un message : l’angoisse, comme la panique, tente de signaler une peur. Lorsque l’angoisse surgit, il faut l’accueillir comme une alarme et se dire : « de quoi ais je peur ? » ——-« ha, j’ai peur d’être responsable de la mort de » et… »ok, j’accueille cette peur, elle fait partie de moi aujourd’hui« . et…. »juste pour aujourd’hui, ne te préoccupe pas », donc :  »  « occupe toi »  c’est-à-dire : « qu’est ce que je peux faire aujourd’hui pour diminuer cette peur ? » ou l’apaiser, ou la comprendre… ?
N’hésite pas à poser la question au symbole, au Reiki – son essence-esprit, pense au Shintoïsme abordé en stage…- pose la question à ton guide, ce genre de questions :

qu’est ce que je peux faire aujourd’hui pour diminuer cette peur ? 

Quelle est la bonne technique pour m’en libérer ?

Quel thérapeute peut me faire avancer et grandir ?

Déjà la prise cosmique -Reiki 1 – pendant un quart d’heure 4 jours de suite devrait avoir une action positive.

Il se peut que la réponse t’apprenne d’où vient cette peur de faire mal, peut être un souvenir remontant à l’enfance, voir lors de la vie intra-utérine, la culpabilité inconsciente d’avoir fait souffrir la mère durant la grossesse ou l’accouchement…Au 2ème degré on reçoit les outils permettant de guérir ces chocs vécus dans le passé.

**************

Plus tu avances sur le chemin de la spiritualité plus le mental se rebelle en créant des angoisses fortes ?
Le risque n’est-il pas de tomber dans la folie avant d’atteindre la paix intérieure contraignant le mental à ce taire ? Cela me fait plutôt peur.

Calmer un mental avec des angoisses irrationnelles par une pratique faisant appel à l’irrationnel me parait possible mais qui sera le plus fort ?

Dom – Plus on avance dans le développement spirituel et moins on a d’angoisses et de peurs paralysantes, elles perdent leur pouvoir sur nous. Le but des symboles et de la pratique des différentes techniques et des idéaux du Reiki est d’accueillir, d’écouter, d’énergétiser, de transformer et de s’élever, c’est-à-dire quitter l’enfance tapageuse et insatisfaite.
Grandir.

Plus on « s’attaque au difficile » et ne pas le lâcher, plus la vie devient intense, les broutilles finissent par partir d’elles même.

Toujours se poser la question : J’ai un problème, quelle est la technique Reiki adéquate ?

Bouddha a lui aussi enseigné ça avant tout le reste.

Je te remercie pour ta réponse.

Maintenant tout va bien,  je pratique tous les jours avec beaucoup de joie et parfois des sensations de chaleur et de vibrations très agréables. J’ai l’impression d’avoir réveillé les chakras de manipura, et muladhara,  j’attends avec impatience un signe du chakra du cœur . J’ai le sentiment que le reiki a ouvert une porte sur le chemin de la spiritualité et qu’elle s’est ouverte en beaucoup plus grand que celle ouverte par le yoga. J’espère quelle ne se refermera plus.
F.


Juin 2013

C – « Je souhaiterai te faire part d une experience, que tu dois certainement connaitre.

Ce matin j ai fait un soin complet à I., ma femme. 
En mettant mes mains en V entre son cou et sa poitrine, j ai fait une erreur, sans m’en rendre compte ; j ai utilisé les 4 symboles au lieu des deux symboles CKR et  SKSK. 
Une minute auparavant, elle était très relax, elle avait les yeux fermés et respirait paisiblement. Et d’un coup, elle s est mise à sangloter, puis elle a fondu en larmes.
Bien sûr j ai immédiatement cessé en essayant de la calmer. 
Elle m a dit qu elle se sentait super bien et qu à partir du moment où j ai poser les main en V elle a senti une émotion et une tristesse irrépressible l’envahir.
Je me suis rendu compte immédiatement de mon erreur, On a fait une pause, ensuite j’ai repris le traitement.
A la fin je lui ai fais part de mon erreur. On en a bien sûr discuté, rediscuté, commenté. On apprend de ces erreurs, mais il y a des erreurs surprenantes qui vous confortent dans vos choix, votre nouvelle vision. Qui tord le cou au petit septissisme qui était là dans un coin du cerveau.

Dom – « Tu n’as pas fais d’erreur en activant les 4 symboles au niveau du thymus ; arrivé à ce moment du soin une émotion devait se déclencher et elle s’est déclenchée car c’est le résultat positif du traitement des positions de la tête, avec tes mains et avec les symboles : si une émotion doit avoir lieu il ne faut pas la refouler, ça serait dommage !
il n’aurait pas fallu arrêter, et encore moins paniquer. 
c’est ce que je dis en stages ; on accueille et on continu, on accompagne la personne à exprimer son émotion, pleurs ou rires ; c’est la glace du coeur qui fond.
c’est pour toi juste une question d’expérience dans le temps, plus tu donneras de soins plus tu connaîtra les réactivités, ou les passivités des gens.

en aucun cas il ne peut y avoir d’erreur :

tu peux à tous moments au cours d’un soin activer n’importe quel symbole selon ton ressenti, et sur n’importe quelle partie du corps ; Shk pour aller au delà des résistances mentales, Hszsn pour annuler la distance entre toi le patient et l’univers et bien sur Sksk et Ckr partout en permanence.

Les émotions que vit la personne soignée, et bien elles sont exactement ce que le reiki lui offre de vivre. Si elle résiste, si elle panique, dommage, elle se prive de la libération d’un vieux truc dont c’est le moment qu’elle en soit libérée. mais rien de grave ; ….on peut y revenir plus tard avec un autre soin ; il ne peut pas y avoir d’erreur avec le reiki et le fait d’avoir arrêté et fait une pose n’est pas une erreur, juste un manque de connaissance car ton expérience Reiki date de 15 jours à peine.

et aussi ; une peur ; la peur d’avoir fait mal. c’est humain.

Le Reiki va ainsi nous enseigner à aller au-delà des réactions humaines, d’aller dans l’infinité et dans la profondeur, laisser à l’amour la place qu’il lui revient : à la place de la peur !

on appelle ça Transcender, c’est à dire élever la crainte en un sentiment supérieur. Celui de faire confiance à l’inconnu, à l’invisible ; le KI.

et ainsi, peu à peu, cette confiance s’installe en soi, et devient aussi, par union, fusion du Yin et du Yang, la confiance en soi.
Et plus on fait confiance Au Reiki plus on se fait confiance et plus on se fait confiance plus on fait confiance au Reiki, ainsi grossi la boule de…lumière.
Merci de partager ton expérience.

*********************
– Le 5 juin 2013 11:29, C.M  a écrit :

« Bonjour Dom, Pour un soin : abcès à l’anus tu ferais quoi toi…? merci. « – Date: Wed, 5 Jun 2013 12:32:31 +0200
Subject: Re:
From: contact@planete-reiki.fr
1 – Faire un soin sur le chakra racine, si possible la main posée dessus, trés prés quoi, 15 mn, .
(- et si possible une tourmaline aux pieds, pour éclaircir la pensée et ancrer l’esprit,  et oeil de tigre au plexus solaire pour « écarter » le mauvais traitement mental reçu » et renvoi à l’expéditeur).
 
2 – puis faire rééquilibrage des chakras (- avec un bois fossile sur le foie pour éradiquer la colère et – un  quartz transparent sur le 3ème oeil pour éclaircir l’esprit – et enfin une malachite vers l’abcès pour dissoudre l’infection.
 
3 –  INFOS PRATIQUES :
Abcès : pensées qui fermentent suite à un affront, une blessure – pensées de vengeance ou suite à une vengeance (orale ou autre) reçues de quelqu’un…
 
Anus : point de relâchement, faut laisser aller , digérer et se décharger  au lieu de ruminer.
 
– « Super, pour le soin c’est que j’avais déjà fait, maintenant vais rajouter les pierres…..!!! merci. »

Le 5 juin 2013 21:22, C.M  a écrit :

Nous sommes les meilleurs…: ai suivi à la lettre tes indications, + quelques vocalises Karuna et  15 mn après le soin l’abcès à lâché, yes!!!!!

Douce nuit étoilée…………


V
– j’ai fais un soin Reiki à D. il est stupéfait du résultat et moi un petit peu tout de même (je débute quoi !) Coup de cœur pour le REIKI.
Dom.J – le Reiki est miraculeux lorsqu’on l’applique de suite sur coups blessures piqûres brûlures stress…ect.
V – mon fils est très content du résultat de ses partiels. Il peut donc demander Eurasmus pour l’an prochain et avoir des chances pour être accepté ! ! Il vole le fiston !! génial !Pour ma part, ok je me sens beaucoup plus protégée, et tout et tout, mais …bizarre, j’ai une baisse de régime depuis mardi. Voir une baisse de tension (en dessous de 10). C’est rare. Il est vrai que je manque un peu de sommeil. Je sens que mon plexus solaire solaire peine depuis une semaine !! Que veux t’il me dire. Je sens qu’il y a des peurs par là !!
D – puisque c’est le Plexus .Solaire, la respiration abdominale s’impose. Relaxe toi, lâche prise, rien de grave. regarde sincèrement s’il y a quelque chose que tu contrôle ? regarde si quelque chose te fait peur ? as tu peur qu’on voit quelque chose de toi ? Ces questions, c’est durant l’auto-traitement qu’il est bon de se les poser, en état méditatif, relaxée. un peu de Yoga, ou de Qi Gong devrait te soulager. Parfois aussi, l’énergie va nous fatiguer ; c’est sa façon de nous inviter à rester TOUTE une journée au lit, à se reposer tendrement et à nous ressourcer, nous explorer gentiment. le monde social juge ça. Pas l’enseignement Reiki !
**********************************************

N – Bonjour Dom ,J’ai deux questions ; depuis Lundi j’ai de nombreux picotement & sensation de brûlure dans les paumes de la main & plus importante coté gauche !!!! Voulais savoir si cela étais normal !!!!

Dom.J – oui c’est normal, il faut accueillir et remercier, laisser couler, c’est le canal coté coeur, sensibilité, affect qui se libère, cela peut durer assez longtemps aussi il ne faut pas « résister ».
N _
hier soir en faisant Mon repas je me suis brûlée (la main gauche)avec de l’ eau bouillante en manipulant mon auto-cuiseur !!!! Jusqu’à lors quand je me brûlais la douleur passait assez rapidement , voir je ne sentais pas forcément le chaud !!!!! Mais hier soir j’ai dégustée c’étais terrible j’ai fait du Reiki sur ma main mais c’étais intenable !!!!! Donc j’ai capitulée !!!! Bon positivement ce matin tout vas mieux ma main & encore très chaude, mais plus douloureuse. Vais faire ma séance quotidienne de Reiki en intégrant ma main espérant que çà ailles !!!!

Dc’est bien ce que je dis plus haut ; coté affect il y a quelque chose qui demande à s’exprimer.

brûlure = colère – ça bout ça chauffe comme la fièvre = le feu de la colère
mains = façons de prendre en main les situations ! 

donc ; une situation qui te fait vivre de la colère brulante, avec peut être une peine ( coté gauche/coeur) pendant le soin, pose la question au reiki « Montre moi la situation qui créé cette réaction (en pensant à la main brulante/brulée) je veux voir, stp montre moi à voir avec les yeux de l’amour, Merci ».
fais le autant de fois qu’il te le faudra jusqu’à obtenir la réponse…bon wend et bon Reiki
V : Oui OUi Oui, c’est exactement cela ! Tout ce que tu m’écris dans ton message traduit la vérité.  Le mal être a duré 4 à 5 jours.Dans ma vie actuelle, ça bouge dans ma tête un peu côté Job.  qq chose me dit de me préparer à passer à autre chose. Et du coup,  je pense que je cherche à contrôler. OUI …  : le changement !! La vie me test sur le laché prise, ?. je compte bien me mettre au yoga. A 100 m de chez moi il y a un cours en associatif ! Des signes me le disent aussi !!

******************************************************************

X – Hier , ma voisine (87 ans ) est tombée dans le hall de l’entrée devant chez moi….émotion….les pompiers….je passe les détails….ma main sur son front l’a peut-être
aidée (je disais CKR en silence ), mais avais-je le « droit » de le faire sans lui demander son  autorisation ?
Dom – dans un cas d’urgence sur le vif c’est ton cœur qui agit et non la raison, donc tu as bien fait et tu as ma bénédiction !
La prochaine fois pose plutôt les mains sur son chakra du cœur, c’est le chakra de l’auto guérison et qui rempli le corps de Reiki par diffusion de l’énergie.
X – Cet évènement m’a troublée .Je viens d’apprendre que cette dame s’est cassé le col du fémur .
D – tu peux la visiter, lui expliquer ce que tu lui a fait et lui en proposer sur son fémur ! Entre voisines !

*************

M –  Je peints des Mandalas. Est-ce que je peux représenter le symbole Ckr dans un Mandala qu’on m’a commandé ?
D – Il faudrait pour cela que le symbole ai du sens pour lui, et il ne peut en avoir vraiment q’en vivant lui-même l’initiation. Sinon, vu sa forme particulière ils pourait être questionné et embrassé par ses proches. Par contre, sur une de tes peintures je vois la spirale – sur le Mandala rose – la spirale seule est universelle, tu peux la représenter, tu sais que c’est la Kundalini, ta force.
M – Je te remercie de ta réponse. Je suis à présent éclairée sur le fait de reproduire ou non le symbole du Reiki. Je trouve très intéressante ta réponse, et cohérente.
En lien, avec ce que tu nous fais savoir : hier matin j’ai dit à un collègue que j’avais fait un stage de Reiki, et du tact au tact il m’a adressé : « c’est du charlatanisme », c’était un peu par provocation, le connaissant, en guise de réponse, je lui ai fait un grand sourire, en lui disant calmement : « pas du tout », et j’ai ensuite mis beaucoup d’amour sur ses paroles et sur lui….Cette anecdote pour te rejoindre, au sujet de l’évocation du Reiki, où il est parfois nécessaire d’y aller avec beaucoup de tact…
D – c’est clair ! Sinon on se vrille pour rien.
tu pratique = tu change. Ainsi les autres sont épatés et t’écoute. Mais avant il vaut mieux se taire, et, à la rigueur « Si un jour tu veux essayer le Reiki ? je t’offre une séance ? Même si tu peur de qqs choses, regarde ; sur moi c’est innofencif , non !! ?… »

**************************************
Bonjour  dom, Continu,  ce que tu fais, c est petit maol, ces newletters, car  franchement lorsque on les  lis,  perso, je bois les paroles, mon ame ce nourri, j apprend,  je compren encore mieux,  mais voila,  c est pas le mental qui se nourri, c est bien plus, et oui,  comme un enfant qui attend, un cadeau importan moi j attend, avec IMPATIENCE, ces textes que tu nous envoie,  a nous tes eleves reiki.

Si je te le di c est ke je pense que tu as ‘toi aussi  besoin de savoir comment on les percoit, ces textes,  et bien voila moi, c est  mon ame mon spurituel, et mon cheminement, dans cette energie, que ca nourri.
Le meeeeeerrrrrci, serra jamais assez gran.
bises.  F.
*************************************

Retour de stage Reiki 2

J’apprend vite… Disons que là ce fut le déclic, le déclic Reiki !!!
.. J’ai compris depuis longtemps, même s’il m’a fallut quelques décennies, qu’être incapable de se venger du mal que l’on m’a fait ou être incapable de le dénoncer n’est pas de la lâcheté.
Que le ressasser engendrait un carburant dévastateur pour mon cœur.
Qu’aimer des personnes médisantes, narcissiques, sadiques, qui ont tendance au mélodrame, n’est pas du masochisme.
D’accepter le jugement des autres, cela est beaucoup plus récent, n’est pas de la soumission, ni même une condamnation de leur part, mais un autre regard et donc, une autre écoute de ma part.
De ne pas répondre aux conflits et aux agressions verbales c’est éviter d’être désagréable (de m’être désagréable de ce fait). De tenter de comprendre tout le mal qui se fait, s’est fait et défait les gens, n’est pas justifier le mal…

Par contre ce que je n’avais ABSOLUMENT pas compris c’est qu’en fait il s’agissait du…PARDON!!!
Non mais moi qui m’insurgeais lorsque l’on me parlait du pardon:  » Non je ne pardonne pas: les gens sont responsables de leurs actes ils ont le choix de le faire ou de ne pas le faire et de pardonner cela revient à dire: » Vas y continue,les autres sont tellement rien que tu peux leur faire tout le mal que tu veux!!… »

Mais là, depuis le 2ème degré Reiki une chose s’est révélée que je ne voyais pas jusque là : mes paroles n’avaient rien à voir avec mon attitude: pour ne plus souffrir j’ai pardonné sans le… SAVOIR!! Tout en continuant à me faire du mal, conditionnée à cela.
ET maintenant, merci Dom, j’ai compris une chose essentielle c’est qu’il ne suffit pas de pardonner, mais il faut se pardonner à soi-même du mal que l’on nous a fait… du coup j’ai un besoin irrépressible de passer du temps avec les personnes que j’aime et de m’excuser du mal que je leur est fait, car le mal engendre le mal, mais cela ne m’excuse absolument pas…. Bien au contraire!!
Merci!!!
Le verbe est là, toujours, partout, mais nous restons aveugles et sourds à notre vérité que nous portons à bras le cœur!!
K


Un joli retour que nous font partager une mère et son fils ; Suites du dernier stage Reiki 1, 1er stage de la nouvelle année !

J’écris pour dire que depuis le stage de Reiki je me sens beaucoup mieux. Je ne pensais pas que cela aurait un effet aussi rapide. Dès le samedi soir je me sentais libérer et zen. J’ai repris les cours depuis lundi et je me sens remplit d’énergie positive. Je fais les choses que j’ai à faire petit à petit, sans trop me surcharger et tout coule comme sur un beau fleuve, je ne me laisse plus submergé par une tonne de chose à faire. Je me sens transformé. Je suis bien. Je sens que je dégage quelque chose d’agréable et de positif. Le matin quand je me réveille je me sens de bonne humeur, j’adore cette sensation. Tout ce que j’entreprend à un impact positif et direct (j’ai réussi à vendre ma mobylette dimanche soir, j’ai trouvé un stage dans le cadre de mes études lundi après-midi). Je ne regrette pas d’avoir découvert le Reiki, j’en suis même ravi. Chaleureusement, B…(étudiant, 18ans)
*******
Et bien me voilà partie avec « ton » enseignement REIKI dans mes mains sur mon chemin de vie. UNE NOUVELLE VIE. UN NOUVEAU VIRAGE . Des changements ? Une sensation de me sentir encore plus protégée dans la vie, encore plus remplie de moi-même, plus de lâchés prise et de confiance en la vie. Je perçois beaucoup plus ce que les gens sont et ont en eux : je perçois leurs énergies je pense. Du coup, les personnes que j’ai pour habitude de voir ou de rencontrer sont comme mises à nues devant moi ! Je pense que je vais faire du tri beaucoup plus facilement et plus rapidement dans mon relationnel. Tu te rends compte, je suis mieux guidée pour être plus efficace pour moi même. Oui j’ai mes ressentis plus développés. Aussi, me voilà ZEN, sereine, confiante, en retrait des gens et des choses tout en étant bien là ! ….En tout cas je compte venir au centre les vendredi soir de partage. ENFIN, Demain je fais mon 1er grand soin complet à une amie (en deuil). Sinon, REIKI sur bibi tous les jours et tout le long de la journée ! Réveil 20 mn plus tôt pour Mr REIKI.  Du coup mes mains sont tjs chaudes !!!!! Mais après les 3 claques ds les mains « CKR » je sens que le chauffage chauffe déjà beaucoup à chaque fois. B.. est transformé lui aussi. Tu le sais, il t’a écrit ce soir également. Il a aussi écrit à J-L pour lui faire part de son émotion et de ses ressentis suite à ses confidences en fin de stage. Quel beau MONDE nous avons là. De L’Amour, que de l’Amour. Ça fait vibrer tout ceci ! J’adore. Bon allez, je vais retrouver mes cours de REIKi afin de m’endormir en paix !!! Chaleureusement. V…
*****************
Intuition Sucrée

Voici une histoire d’intuition que j’ai vécue il y a quelques temps, au cours d’un jeûne hydrique, dans le lot, à Lalbenque, au centre d’accueil « L’Ermitage » chez Daniel Pasquier. Le jeûne hydrique consiste à se nourrir autrement, d’eau fraîche et de l’amour de la nature exceptionnelle que nous sommes.

jeune-et-Reiki-3emedegreLe soir je m’accordais un thé léger, avec un sachet sortit d’une boite Lypton que j’avais trouvé dans le petit buffet de la cuisine de la borie. L’eau chauffait dans la casserole. Je mis un sachet de thé dans la grande tasse en grés quand j’entendis la voix de mon guide « mets en un deuxième ». À un certain degré d’évolution spirituelle Reiki, on commence à vivre avec un guide. Je sais aujourd’hui que cette voix, on l’entend depuis la petite enfance, mais avec cette habitude de croire que tout vient de nous, se refusant de croire que nous sommes « autres ». Après la première connexion avec notre guide, cette voix est la même, mais plus forte, plus claire, de plus en plus audacieuse. Jusqu’à prophétique. Et toujours amicale.
Peut être parce qu’enfin on l’écoute vraiment.
« Mets un deuxième sachet de thé ». Ce à quoi je réponds « non, ça va être trop fort, il n’y a pas de sucre». Je n’avais trouvé dans le buffet qu’une boîte de thé entamée, pas de sucre. « Mets en un deuxième » me re dit la voix. Comme j’avais pris l’habitude de lui obéir et de lui faire confiance, à l’inconnu connu, je dis OK, et je mets dans la tasse un deuxième sachet de ce thé basic, vous savez ; la gaze à pansement et l’étiquette jaune. Puis je n’y pense plus. En attendant que l’eau frémisse je fais les cent pas devant le fourneau et le buffet. Machinalement je jette un œil derrière le buffet. Pourquoi fis-je cela ? Jamais on ne fait ça, regarder derrière un buffet, car il n’y a rien derrière les buffets dans les cuisines de France et d’ailleurs. Ors, surprise totale, là derrière ce buffet en formica blanc, il y avait un Tupperware extra plat, avec dedans devinez quoi…du sucre en morceau. Qui avait eu cette idée de planquer du sucre derrière un buffet. Tant d’acteurs insoupçonnés à nos vies…dans des actes inconscients.

Mon guide lui, savait que j’aime le thé fort et sucré. Il savait qu’il y avait du sucre malgré toutes les apparences auxquelles je m’étais fié.

Mais l’important dans cette histoire n’est elle pas l’écoute et la confiance à l’inconnu sans preuve qu’il ait raison !?!

Les symboles Hszsn et Shk du 2ème degré Reiki sont là pour nous apprendre à nous faire confiance et à faire confiance à l’inconnu, comme lors d’un envoi à distance ou lors de la guérison du passé. Puis la méditation et le symbole du 3ème degré nous permet de rencontrer notre guide, d’apprendre à l’écouter et de vivre avec lui les choses les plus simples de la vie, sans plus jamais être inquiet excessivement.

*******************


Questionnez, je réponds.

N... : Voilà ce qui s’est passé pour moi. Dans la nuit du 2 au 3 Janvier, j’ai vomi et diarrhée . Qu’est ce que tu en pense ?

Dom…: cela signifie que tu « évacue quelque chose sans faire la part des choses », une sorte de fuite, tu « liquide » l’affaire; ne pas bien regarder en face une certaine situation.
diarrhé = évacuer vite, liquide.
vomissement = rejet, sans le digérer. 

N….: LE Samedi 5 Janvier, j’ai fait comme une simili  occlusion intestinale : de 15h à 21h j’ai souffert énormément car je n’arrivais pas à évacuer les excréments. J’avais de très fortes contractions mais le sphincter ne s’ouvrait pas.

D…: là c’est l’inverse ; « tu retiens quelque chose » tu retiens de peur de décevoir ou de déplaire.

N… : J’ai aussi pratiqué le reiki sur mon fils et sa compagne. Mon fils a eu une réaction violente de colère ( reiki le 27 12 et réaction le 5 01) Il a mis sa compagne à la porte. Elle a été très choquée mais après explication ça s’est arrangé et je pense que mon fils a pris conscience qu’il n’était pas bien . Il habite à Reims et encore une fois je te demande conseil Que puis-je faire?

D…: simplement qu’il prenne conscience que des non dits se sont acculés et engendrent inévitablement de la colère. il est temps pour lui de s’autoriser à dire les choses au fur et à mesure au lieu de les retenir. voici le temps des échanges verbaux avec sa compagne. 

N…: Sa compagne ne parle pas beaucoup.

D…: et pareil pour elle, car en « retenant » son homme en fait de même par mimétisme, puis accumulation et colère.  

N…: Que de rebondissements négatifs mais que je considére comme positifs ????

exact !

tu peux leur passer ma réponse à tous les 2 ! 

N…: Tu sais Dom, tu m’as enseigné un outil merveilleux mais très puissant et après ces rebondissements j’hésite un peu et que puis je dire?????  Je pratique sur moi OK  Mais je ne tiens pas à être responsable des scènes de ménage ou autres !!!!!

D… : il suffit simplement de les prévenir en leur disant que l’ombre peut se dissiper et que des choses ignorées peuvent se monter, mais que Je suis toujours là, au cas ou… 

N…: A 11h ce matin une amie m’a demandé de lui faire une séance. Elle se fait suivre par un psychiatre car elle est maniaco-dépressive je crois. elle est hyper active. Alors qu’elle va être sa réaction? ????

D…: Tu fais la prise cosmique un quart d’heure, puis soin complet, l’idéal est de pouvoir répéter ce traitement pendant 4 jours consécutif  en prévenant que les 2 premiers jours il se peut que ça remue, puis l’amélioration devrait se manifester à partir du 3ème jour de soins Reiki.
Commence, et tu verra bien…
.  merci Reiki. 

N…: Es-ce que des soirées partage sont au programme en ce début d’année?

Dom :….oui, ça va venir, patience ma chère !

——————————————-

 

 

Dojo-Reiki

Dojo-Reiki

Je voudrais m’exprimer sur l’article de science et avenir relatant les interdictions du Reiki dans les hôpitaux français, car j’avoue ne pas être étonné. Que faut-il ressentir ? Un sentiment d’injustice ? Se laisser emporter par la colère ? Accuser une communauté d’exclure une autre communauté ? Se taire et laisser dire sans montrer qu’on réagi ou qu’on est frustrés sans l’exprimer ? Ou bien vite s’empresser de trouver un moyen efficace de convaincre les antagonistes de cette histoire que le Reiki n’est pas du tout ce qu’ils en pensent…et comment faire ça ? Comment convaincre les masses dirigeantes, les Appareils idéologiques d’état et les Appareils répressifs d’état ?

Les apparences trompeuses révélatrices.

La France est un pays franchement et férocement conservateur et cet article en est encore une preuve mais, ….ces gens là n’ont-ils pas raison ? Ou plutôt n’ont-ils pas une raison d’agir ainsi, non contre le Reiki, mais contre les gens qui tentent de pratiquer le Reiki dans Leurs Domaines. Et si la vraie raison de réaction violente était inconsciente ? On se doit de se poser la question « Qui est l’autre et d’où vient la voix ? ».

Je vois plusieurs fixités dans le florilège d’articles Science et avenir. La première saute aux yeux ; l’inexpérience du- des journalistes n’ayant aucune connaissance personnelle du Reiki, ni en ayant reçu ni en y étant initié – il en parlerait. En vertu de ce principe il ne peut être crédible pour moi. Ors, foutaise politico-sociale, le fait qu’un individu soit diplômé d’une école reconnue d’état, devient crédible pour l’autorité qui à son tour l’accrédite auprès du peuple. Par les médias. J’ai moi-même fait un parcours à l’école supérieure de journalisme, ainsi qu’un DU en Université de lettres. Un journaliste est un travailleur producteur affairé à produire du chiffre, prêt à écrire sur n’importe quoi sans en faire lui-même l’expérience. Son but, ne l’oublions pas, est de convaincre, et ça s’apprend à l’école de journalisme. Le manuel « Reiki dans les hôpitaux » est une aubaine pour un journaliste.

Une autre fixité, la réaction des responsables des hôpitaux. Nous savons que leur préoccupation première est la sécurité et la rentabilité. Nous sommes gouvernés depuis des siècles par des gens apeurés recherchant à tous prix la sécurité absolue, mettant en œuvre ce qui leur convient pour la conserver, la sécurité une fois établie, souvent par la force et la violence, la menace, l’exclusion, de peur de perdre le pouvoir qu’ils occupent, qui les occupe. A savoir, le pouvoir d’un professeur chef de service ou membre de l’académie de médecine ayant autorité par l’usage de leur savoir – qu’ils perdraient – ne pas partager – en laissant agir d’autres qu’eux, en l’occurrence les praticiens Reiki. Ils préfèrent rester seuls à faire de très graves erreurs dans les hôpitaux, rester associés aux labos de chimie meurtrière – je suis resté 12 ans marié avec une infirmière d’un grand service en région parisienne, 10 ans d’histoires terribles récurrentes dans les différents services, mon Dieu que d’erreurs, souvent mortelles. Et tenues au silence.

Quand aux responsables politiques chacun sait aujourd’hui qu’ils réussissent encore ce tour de force de se faire élire en promettant avant tout la sécurité. Les Français ont tellement peur. Un Maître spéculateur en bource, devenu Maître Reiki a écrit dans on livre – j’ai oublié le le nom et le titre – «Je constate que devenir milliardaire et devenir Maître spirituel revenait au même; La Sécurité absolue». La moindre alerte et accourent les chefs, le SAMU et la police armée, qui savent se faire respecter car ils s’appuient sur la peur d’autrui. On les écoute. Eux sont en sécurité, ils ont le poste idéal, le salaire et les avantages, l’assurance d’une énorme retraite, alors à quoi bon chercher ailleurs s’il n’existerait pas des méthodes plus naturelles de soigner d’apaiser et rassurer.

Mais la « chose » la plus importante qui me saute aux yeux est un certain propos contenu dans le dossier mis en ligne par N.Mokanu « comment entrer dans les hôpitaux pour y pratiquer le Reiki ». J’y vois l’objet représentatif d’un manque de confiance dans le Reiki de la part des praticiens, des Maîtres, et des grands Maîtres Reiki.
Je m’explique. Si j’ai confiance au Reiki et en l’univers je vais me présenter n’ importe où dans la tenue qui me convient à moi et non dans une autre tenue pour plaire, pire ; de peur de déplaire. Pareil avec mon langage ; le Reiki m’a appris à être simple, naturel, à être moi et non à me tenir raide, caché dans la peau d’un représentant de la «Maison Reiki –fondée en 19…. »qui veut passer inaperçu. Si j’ai cette confiance absolue que donne une longue introspection avec les symboles Reiki, déplaire m’est indifférent puisque le Reiki me précède toujours. S’il doit être là ou je voudrais l’introduire, bien entendu, c’est le Reiki le Maitre, pas moi.

Alors pourquoi cette volonté farouche, pourquoi cet acharnement à Vouloir à tous prix introduire le Reiki dans ces haut lieux de l’industrie de la santé ou on ne veut pas de lui ?

Procédé d’une question à poser au Reiki ; par le biais de HCZSN on active SHK puis ; GNOSA pour être en état thêta.

Quand on ne pratique ni le Reiki Usui ni Karuna, la question à poser, universellement connue est : Ou va l’argent ?

Bien sur il ya des milliers de volontaires et je les bénis ici. Mais il n’y a pas qu’eux qui « Visent » les hôpitaux. Forts de leur savoir eux aussi, certaines personnes ayant passé le degré Maîtrise se bombardent Maîtres enseignants Reiki et enseignent un Reiki à leur façon, avec leur propre autorité, leur règles propres, leurs exigences et leurs préférences. Leurs craintes leurs peurs leurs faiblesse leurs croyances. Leurs illusions humaines légitimes et respectables. Changer et quitter l’enfance ne se fait pas en un clin d’œil plus un diplôme de Maîtrise en couleur. Je fais des conférences débats ou j’entends de tout,  je ré-initie des gens déjà initiés, et je lis de tout dans leurs manuels Reiki qu’ils me confient. Souvent 25% de Reiki et 75% de remplissage en techniques d’ailleurs, diverses et assommantes par la quantité proposée d’exercices qu’ils imposent à leurs élèves. Alors c’est facile de comprendre comment se fait-il qu’un praticien Reiki affirme qu’un cancer du sein se résorbe avec le Reiki. Trop de lui dans ce praticien là. Pas assez de «laisser la volonté du Reiki parler». Qui l’a formé ? Qui a formé celui qui a formé le formé ?

Il n’y a pas d’examen, il n’y a pas de mémoire à rendre, il n’y a pas de thèse à construire lorsqu’on veut passer la Maîtrise Reiki, pas d’épreuve ni écrite ni orale. Il suffit de faire un chèque de 1800€, de prendre quelques notes et voilà ; on est Maître, on peut initier et même initier des Maîtres. Idem par téléphone ou par correspondance, n’en déplaise à certains ; ça se vend bien. Ça veut dire qu’il y a une demande de rapidité, légitime et respectable (la demande est légitime ! Pas la façon d’initier à distance).

Et c’est parfait car c’est aussi grâce à ce système de passer une Maîtrise rapidement en quelques temps de 3 ou de 4 stages que le Reiki s’est  répandu  et s’est fait connaître.

Lors des conférences, des rencontres, des ré-initiations, j’entends très souvent des personnes, initiées ou non, dire que des praticiens Reiki qu’ils ont rencontré ou côtoyés leur procuraient un sentiment de répulsion, qu’ils étaient imbus d’eux même, voir arrogants. Ces praticiens là, se protègent mentalement en se servant de l’ego comme cuirasse par manque de formation à laisser le symbole Reiki les protéger énergétiquement. J’en ai rencontré quelques uns comme ça sur des salons de Bien être. Pas assez travaillé sur eux, pas en profondeur. J’ai même rencontré un « Maître » qui fièrement m’a dit qu’il n’enseignait pas les symboles parce qu’il ne les utilise jamais « ils ne servent à rien » m’as t-il fièrement affirmé. Les a t-il essayé sur lui un millier de fois ? Du premier degré à la Maîtrise : 3 fois 365 jours soit 1200 fois au moins à pouvoir tester les symboles chaque jour en chaque situation. Bon, passons, le principal étant qu’il ait des résultats ce « Maître sans symboles »,  mais je n’ai pas pu le vérifier.

Lorsque j’ai passé les 2 niveaux Karuna j’ai constaté ; 2 jours de théories, pas de mise en pratique, un jour de plus pour la Maîtrise avec dictée pour la mise en pratique, un diplôme obtenu en faisant 9 petits dessins enfantins et démerde toi au suivant. Je suis acerbe ? Durant ces 3 jours j’ai eu 3 échanges avec 3 Maîtres Usui et Karuna – redoublants initiés les 3 par le même enseignant – qui m’ont fait chacun un diagnostic !!  On ne fait jamais de diagnostic en pratique Reiki, c’est l’ABC du Reiki. Je les comprends, l’émotionnel n’est pas le domaine facile chez l’humain. Si ces personnes sont responsables d’elles même et de leurs actes, comment devrait elles s’y prendre pour prendre conscience qu’elles ne sont pas « Maître » d’elle ? Simplement avec la connexion verticale il me semble. Savent-elles l’utiliser ? Savent-elles l’enseigner ? On enseigne, on insiste sur les points forts en stage, et puis les gens font ce qu’ils peuvent, et ce qu’ils veulent, chacun en fonction de leurs priorités,  de leurs croyances. Et de leur foi. De leur peur d’entrer vraiment en soi. Leur peur de l’inconu.
La peur de laisser le Divin leur montrer la voie.

A mon avis concernant les enseignants, le Reiki n’est pas suffisamment enseigné en développement personnel, pas assez en profondeur. L’émotionnel est rarement atteint à un niveau profond, la transformation reste assez superficielle (en général ! Et tout dépend du malaise profond, sérieux ou bénin, selon les traumatismes vécus dans l’enfance). D’où un besoin récurent de se protéger et de contrôler au lieu de laisser le Reiki protéger et guider et je reviens au début de mon propos ; le manque de confiance au Reiki et à l’Univers. Alors « ils » croient en leur savoir personnel « le Reiki guéri le cancer du sein ».

Une autre fixité, les fédérations de Reiki. Pas d’entente réelle. Chacun son socle. Pas de logo commun. Il n’ya pas d’entente, manque d’amour pour un vrai partenariat, (Le 2ème chakra est négligé (la communion). Je me suis vu refusé une inscription dans l’annuaire des Maîtres de la FFRT, je me suis fait brutalement  jeter au téléphone et par mail sous prétexte que j’enseigne des symboles qu’eux n’enseignent pas.
Ce mois ci je cherchais un Maître enseignant dans une autre région que la mienne pour l’ami d’un des praticiens de mon groupe, je suis tombé sur le site d’un adhérent à une Fédération Reiki qui expose sur son site des idéaux non authentique, avec tentative de manipulation.

Tout ça, ce n’est pas de l’amour, ce n’est pas du Reiki.
C’est de la peur.
La peur de subordonner sa volonté à la volonté divine.

Voilà à mon avis le message que nous donne l’Univers par le biais de l’article dans science et vie.

Le Reiki le sait. Il n’est pas l’heure pour le Reiki de nous laisser entrer dans les hôpitaux en France ! Les Français sont de mauvaise foi, hargneux, mécontents, honteux, bourrés de culpabilité et de colère, de haine et de jalousie, trop pleins d’orgueil dont ils ignorent la teneur. D’impatience ! Un besoin de méthodes rapides, le syndrome du miracle. Les Français ont été trompés et exploités, et punis, et on continue à leur faire peur en utilisant les médias. La majorité des maladies sont dues à la colère contenue, dues à la peur de choisir (chakra de la gorge), maladies dues au manque de confiance en eux. Les français choisissent l’esthétisme et les apparences par peur d’être eux même, simples. La peur d’être simple. La peur de déplaire. En fonction de leurs états émotionnels ils vont se diriger vers un maître ou vers un autre. Les hôpitaux sont des entités ayant plusieurs cerveaux pour les diriger et leur dire qui admettre ou qui refuser (professeurs, académiciens, ministres..ect).
Ce qu’on sait ; c’est que le Reiki attire les gens entre eux, et non l’inverse. C’est le Reiki qui a le pouvoir et non les Maîtres.

Un jour le Reiki sera enseigné en développement personnel profond, au niveau maîtrise au moins. Un jour les fédérations seront fédérées, une seule fédération nationale. Un seul logo. Une seule lignée, celle de l’amour et du partenariat. Un jour plus personne ne dira du mal, non du Reiki, mais des praticiens et des Maîtres. Nous serons forts. Nous serons Reiki.
Alors ce jour là plus besoin de monter des dossiers craintifs ; les hôpitaux nous supplieront pour y entrer.

Mais non, tout le monde pratiquera le Reiki, et il n’y aura plus d’hôpitaux. Sauf pour les accidents. Hôpitaux  « mécanique et carrosserie ».

Dom. Jeambrun
lundi 17 décembre 2012 

 

 

 

Written on décembre 17th, 2012 , news Tags: , , ,

Article sur le reiki

Centre Médical de Hunterdon

Les bénévoles au Centre Médical de Hunterdon (USA) proposent du Reiki du lundi au vendredi, aux malades hospitalisés dans les ailes 3 Ouest et 5 Nord, ainsi qu’à la Maternité et au Centre des Bébés qui viennent de naître.

Selon « American Hospital Association », il y aurait plus de 40% des Hôpitaux aux USA qui proposent du Reiki en tant que méthode complémentaire aux traitements médicaux pour aider les patients à mieux vivre leur séjour à l’Hôpital.

Une grande partie des patients ressentent un très grand stress pendant leur hospitalisation et leur familles aussi. Grâce au programme Reiki du Centre Médical de Hunterdon, ces personnes ont trouvé un moyen valable de relaxation.

Le Reiki, une méthode énergétique holistique, augmente le confort des patients et réduit les effets secondaires des procédures hospitalières et des médicaments. C’est une technique de relaxation pour le corps, l’esprit et l’âme, ce qui est hautement bénéfique dans le processus de guérison, quel que soit le problème.

Nancy Cable, infirmière à l’Hôpital dit : « grâce au Reiki, les patients sont plus relaxés. Ils dorment mieux et cela aide le processus de guérison. »

Julie Cunha, infirmière à l’aile 5 Nord, dit : « le Reiki a un potentiel de guérison important. Si le patient est relaxé et son esprit est clair, le corps peut se concentrer sur la guérison. Le Reiki ne remplace pas les médicaments. Cependant, grâce à un état de relaxation tellement plus important, les patients ont tendance à demander moins de médicaments. Leurs demandes sont traitées par les médecins, bien évidemment. »

Le programme Reiki proposé entièrement par des bénévoles, a été évalué suite à une étude. La ponctuation a été de 0 à 5 (0 étant le niveau le plus bas, et 5 le plus élevé).

Voici les résultats :

Aspect observéAvant le ReikiAprès le ReikiDifférence
Stress3,451presque 4 fois moins de stress
Anxiété2,450,85presque 3 fois moins d’anxiété
Douleur2,91,55presque 2 fois moins de douleur
Nausée0,650,30plus de 2 fois moins de nausée

Source : http://www.nj.com/hunterdon-county-democrat/index.ssf/2012/10/hunterdon_medical_center_thera.html

******************************************

« C’est dans l’émerveillement que l’on découvre toute la lumière et toute la vérité, parce que c’est dans l’émerveillement que l’amour se nourrit, parce que c’est dans l’émerveillement que l’existence atteint toutes ses dimensions ».  Maurice Zundel

images (2)  S’émerveiller, c’est littéralement être touché par une merveille, un prodige. C’est entrer dans la spirale des éternels recommencements, dans l’étonnement des premières fois. Comme si dans chaque instant nichait quelque chose de neuf, d’inédit et de virtuellement prodigieux. L’émerveillement est une candeur face au monde, et pour cause :  il s’agit d’une attitude venue du fin fond de l’enfance. Seule la pureté du cœur permet de s’étonner sans cesse de ce qui advient, de la richesse des êtres et de la formidable prodigalité de la vie. Le beau qui nous submerge à travers la vitre de nos yeux, nous donne à voir le monde dans toute sa splendeur pourvu que notre regard ne soit pas embué par la distraction, la mélancolie ou le mauvais vouloir. Laissons-nous ravir par Le Merveilleux (dans le double sens de ravisseur et de ravissement), laissons-nous emporter loin de ces piteuses résignations du “tout passe et tout lasse”. Ne laissons pas le doute s’insinuer, ne pensons pas que “c’est trop beau pour être vrai” ou que “c’est trop beau pour y croire”. Pour vivre pleinement les heures de notre existence, émerveillons-nous !

                                                                                    François Garagnon


Le Merveilleux va bien avec le Reiki.
Surtout avec le Merveilleux Reiki Karuna !

Written on décembre 14th, 2012 , news Tags: ,

Une histoire d’orgonite…mais avant ;
l’histoire de la soirée partage et repas Silence.

 

 

Au début de l’année j’ai proposé une soirée silence, le 8 Avril 2016, partage Reiki et repas pris ensemble en silence. Cela fait bien deux ans que ça me trottait dans la tête. Et Hier nous avons vécu cette merveilleuse expérience. Hier soir. Lors du tour de parole à table à la fin du repas, tous ont apprécié de faire du Reiki sans parler et de recevoir du Reiki sans entendre les autres parler. Bien Plus de ressentis énergétiques, dans les mains dans les corps. Certains ont parlé d’un contact plus long et plus profond avec leur guide, d’une présence subtile mais puissante. Nous avons ressenti aussi une notion de temps différentes, une fusion du groupe beaucoup plus proche d’un Reiki spirituel.

 

soirée-repas-silence

soirée-repas-silence

Je n’avais rien préparé. Juste lancé l’idée, posée sur le calendrier et laissé venir. Mes amis Fred et Christelle, tous 2 musiciens Word Music pros,  nous ont fait la surprise d’une improvisation violon violoncelle tambour chamanique et percussions de bols tibétains ; ce fut un ravissement, une présence à la musique très forte. Émouvante. Et comme il n’y a jamais rien de laissé au hasard dans l’univers, je me suis penché sur la valeur numérique et sacrée de la soirée et voici la belle surprise…

Nous étions 25 hier soir, et la valeur sacrée de ce numéro aide à trouver un lieu pour méditer. Lorsqu’une personne est sous l’influence du numéro 25, cette personne aime la paix, la solitude et le silence, et cette personne devient calme. Elle devient douée pour la magie blanche et souhaite du fond du cœur le bien-être d’autrui. Et c’est bien de magie blanche qu’il s’agit, ce n’est pas quelque chose de superficiel, au contraire grâce au numéro 25, grâce à sa vibration quantique, elle acquiert un merveilleux charisme spirituel.
Enfin…il lui est donné cette chance là, faut tout de mm qu’elle s’investisse un tantinet…et comme le Reiki est le Qi Gong des paresseux…je me suis investi en lançant cette soirée, et magie ! 25 !

À l’unanimité du groupe et de l’univers ; je suis encouragé à renouveler. Attendez vous à vivre et revivre des soirées silence, préparées cette fois-ci, bien pensé. Tout comme mes ateliers et mes stages. Et j’ai déjà ma petite idée là-dessus, mais chut… silence….l’Univers addddorrrre nous faire des surprises. Et moi aussi.

silence

silence

Les 1ers retours par mails……je les mettrais Ofuréàmesur’….

« coucou Dom et à tous, je reviens sur la soirée silence pour te dire Dom qu’elle m’a beaucoup plu, (toutes les soirées reiki d’ailleurs), car pour moi donner du reiki est merveilleux. Mais cette soirée silence, accompagnée des musiciens, m’a permis, tout d’abord, d’entrer dans le silence en moi-même, ne plus penser, c’est génial et ensuite, j’ai décidé d’aller rencontrer mon guide, puisque tout était silence, et plus loin encore de monter passer un moment avec les anges. C’était fabuleux, et elle nous a aussi permis, pour moi, d’être connecté avec toutes les personnes présentes, de former une petit univers. Ensuite le repas, j’ai beaucoup aimé aussi car je trouve que nous étions tous connectés dans le silence pour la même chose, le Reiki et ça c’est super. je te remercie Dom, pour cette magnifique soirée de partage et toutes les autres aussi !!! Marie-Pierre ».

« Merci pour l’excellente soirée que nous avons appréciée.

Ce silence nous a amené des plus : de la méditation, de la concentration, une communication silencieuse entre tous. Une découverte musicale. Et nous vous avons quittés en regrettant car le lendemain était chargé de très bonne heure. A refaire ».

«  mon epouse et moi meme avons apprecie la soiree partage de vendredi dans le silence c ‘est la premiere fois que nous venions. nous reviendrons. »
« N’ayant pas assisté au repas je te donne mes impressions uniquement sur la soirée . J’ai énormément apprécié ce partage. Plus que les fois précédentes j’ai ressenti une réelle énergie qui se dégageait du groupe et une sérénité extrêmement apaisante. Tant en donnant les soins qu’en les recevant. Une concentration naturelle et très profonde. Les échanges de regards étaient tout à fait « parlants ». De plus l’accompagnement notamment par les chants de Christelle était une réelle merveille qui a pu être appréciée à sa juste valeur et mise en premier plan grâce au silence. Impression de profiter plus pleinement de tout l’environnement. Je suis repartie en pleine forme et l’esprit reposé. Je ne sais pas combien nous étions mais c’était quasiment Dix-Vingt…Vivement une autre soirée identique ».

 

 

Orgonite

orgonite

Apres avoir douté de moi, sur mon travail, m’être remise en question avec les outils du 2ème degré Reiki, je reprends confiance en moi. Et c’est merveilleux, tellement merveilleux, ce qu’il m’est arrivé, que je te l’envoie Dom pour le partager. Un truc de fou.
Apres être allé rendre visite a  G..l’autre matin, elle me montre son Orgonite – très belle, bravo Mariedo- «Je voudrai bien en avoir une…mais bon voila quoi…..pas de sous ». Je rentre chez moi, bref, n’y pensons plus.

Dans l’après midi, je dois aller à un rendez vous. Et voila la merveille…..sous la flotte – il pleuvait des cordes – je marchais les yeux baissés…..marchant sans penser à quelque chose de particuliers, …..une belle Orgonite par terre.
Personne autour. Posé là, comme si elle m’attendait. Un truc de fou, mais quand je dis de fou, je veux dire que j’ai du mal à y croire. Si il y avait eu un nom, une adresse gravée dessus…..je l’aurai laissée ou envoyée à l’adresse, mais là si je la prends pas elle est a la portée de tout le monde alors vaux mieux en profiter. Non ?
Est ce un signe? Pour moi oui ; maintenant je fais partie du «Monde ! ».
Comme j’ai dis a mon mari, on me raconterait cette histoire, une Orgonite sur le trottoir sous la pluie, je ne le croirai pas. Personne.
A moi qui suis dans le Reiki en entier aujourd’hui, j’y retrouve incluse à la base de l’Orgonite, une belle spirale en cuivre. C pa bo ça ?
Bon Reiki et good look à vous tous !
JMF.

L’Anesthésie chirurgicale compatible avec le Reiki à distance.

Un envoi Reiki à distance, pendant une Anesthésie chirurgicale ; l’avis et l’éthique du Maître Reiki.

Nous avons fait ce mois ci un marathon pour Zaïra, devant se faire opérer d’une tumeur au foie. Difficulté à cause d’une bactérie résistante dans les poumons ; les médecins craignaient qu’elle décède au cours de l’opération, Zaïra était terrorisée. Nous l’avons invité à recevoir un soin lors d’une soirée partage. Je l’ai aidé à dire ce qu’elle retenait (elle, pensant bien faire de se taire), l’ai aidé à reconnaître la colère ( le foie) la peine ( tumeur = boule de peine) et la tristesse. Puis, pour les poumons (chakra du cœur, l’amour inconditionnel infecté) je lui ai fait remarquer que le véritable amour était d’accepter l’autre tel qu’il est au lieu de vouloir qu’il soit différent. Surtout de la part d’une mère concernant un fils. ça peut paraître dur mais c’est la loi de l’amour ; inconditionnellement – et non cette pensée inconsciente : « je t’aime à conditions que… » – Elle a pris conscience de ces choses qu’elle couvait, ruminait, ressassait et l’empoisonnait, ne sachant comment les exprimer et qui avaient provoqué les symptômes. De voir qu’elle avait pris conscience je sus que le danger était écarté et qu’elle pouvait se faire opérer en toute confiance. Merci à mon guide reiki qui était présent. 
Anesthésie chirurgicaleQuelques jours après, F, son amie, me demande d’arrêter le marathon reiki car on lui a dit que le Reiki est dangereux pendant Anesthésie chirurgicale. La parole sans complaisance n’est pas toujours aisée, mais F, est une personne que je forme, elle vient de passer le niveau Reiki 2 et je me devais d’être…Maître, je me devais de Maîtriser. Je me suis centré, connecté grâce au symbole de distance et au symbole de l’esprit Karuna, et voici l’échange avec F, puis les effets du marathon. Et les effets de l’Anesthésie chirurgicale.

– Mail de F : Je voudrais te demander si sa te dérange pas d’écrire aux gens qui envoient le marathon Reiki à Zaïra,  de ne pas intervenir le 13 car elle se fait opérer et on sait que se ne serrai pas bon  pour elle pendant l’anesthésie chirurgicale.  Merci dom je serai plus tranquille de savoir que tu leur écris. Et soigner la vessie.
– Dom : Le 10 nov. 2012, 1:08 AM, « dom jeambrun » <contact@planete-reiki.fr> a écrit :

qui t’as raconté un truc pareil ?

Pourquoi le Reiki qui est l’intelligence universelle divine serait il mauvais un jour d’opération et bon les autres jours ??

– F : Dom je sais bien que l’énergie passe tout le temps et fait que du bien. Mais c’est pour l anesthésie que je parle, car le 13 on connait pas l heur de l anesthésie.

– Dom : et tu crois que si « on » ne connait pas l’heure de l’anesthésie ça veut dire ue l’intelligence universelle ne le connait pas ?
Faut pas confondre le Divin avec le directeur de l’industrie de la santé peut être….

De toute façon, ça fait des années qu’en tant que maître Reiki de lignée directe je canalise des marathons Reiki pour des cas extrêmes et léger et jamais il n’y a eu la moindre complication due au Reiki.

Je ne puis faire autrement que faire confiance absolue à l’amour du ciel et de la terre ; nous envoyons, et nous laissons faire.

Toi, ton rôle consiste aujourd’hui à lâcher prise et a abandonner tes peurs, elles ne servent plus à rien. 

– F : Ok, je sui ok avec toi cette peur je la lâche. je travaille dessus, ok aussi pour tout je comprends.. 
Maintenant je m’excuse. …..mais même dans tes mail j apprends.. 

Suite de l’opération qui s’est déroulée pendant le marathon Reiki à distance :

Le 15 novembre 2012 21:01, <ef.34@gmail.com> a écrit :

Dom j viens d avoir des nouvelles de zaira. Elle est sortie a 19 hoo de l’operation ça n’a duré que 3 h o lieu de 8 à 10 h. Comme j’ai dis à sa fille,  maintenant  en route pour la guérison ! 
Sur le marathon Reiki, dis leur un grand merci a tout le monde car grâce a tout ces gens on est arrivé a lui envoyer l énergie juste qu’elle avait besoin.
Merci Reiki. 
Bonne soirée Dom.
F.

 Et puis….copié/collé, reçu d’un telph.

Zaïra a eu d la fièvre. Antibios, mais sa passai pas,  j ai pu la voir a la réa.  Ckr sur elle et plus de fièvre…..
Elle devait se réveiller aujourd’hui.  Et bien depuis hier elle est réveillée…..!!!
Elle avait  mal a la gorge a cause de l intubation et bien, du Reiki et tout va  mieux.  Ingrid envoi aussi et,  même les docteurs dise que sa ce passe mieux que ce qu’ils pensaient. ….
A que c’est beau tout ça. Merci aux marathoniens et a toi qui nous guide.
Pour les prières, que tu nous a donné avec les symboles, dans mes soins je les envoi, celle de Hczsn, et celle du coeur, elles sont puissantes.
Voila dom. je t’embrasse.
Bonne soirée.
Oui l histoire de la clef !  : c est que dans un hôpital tu peux pas aller ou tu veux surtout la réa, et bien Reiki a mit sur mon chemin les personne qu’il fallait.

 Encore la suite…ce jour novembre 24, 2012 copié/collé, reçu d’un telph.

 Salu dom.
Pour zaira,  j’atendai que les docteur la mette en chambre,
Zaira souffre de ses plaies, c est normal kan on sait q elle a eu cette big operation.
Mais tou se deroule  bien, lundi ils devrait la mettre en chambre. Elle a du mal a remarcher.
Mais bon on s en sort bien.  Elle remerci tous les gens qui on fai le marathon, elle, va aussi prendre le chemin d l initiation avec sa fille.
J sui trop contente, pour cette histoire. Pour moi c est une grande experience……merci dom d ce soutien.
Et maintenen j m ouvre aux  anges,  alors ke j savais k ils existaient, c est q aujourd hui, ke, je que m ouvre avec le reiki au anges……et des signes extraordinaire ce sont produites…….ah oui, c bo tou sa.
Bon dom toujours aussi bavarde…….fo pa m en vouloir, c moi.
J e me langui la news letter, , ,.
bises et bonne journee a toi dom.
F.
********************
DomDepuis cette expérience  d’u
n envoi Reiki à distance, pendant une Anesthésie chirurgicale pour Zaira, je me suis fait moi mm opérrer -chirurgie dentaire – et j’ai demandé à quelques amis maitres reiki de planete reiki un marathon reiki ; c’est à dire un envoi Reiki à distance, pendant une Anesthésie chirurgicale
Le chirurgien et les infirmières n’en revenaient pas, c t la 1ere fois qu’ils avaient eu un patient aussi calme moi mm j’ai vécu les 3 h de chirurgie comme vu et ressenti d’un poste d’observation De plus, les douleurs post opératoire n’ont duré que 2h, et il n’y a eu aucun oeudème.
Merci reiki

Saisir la chance.

Ange-interprétation-reves

Atelier interprétation des rêves

 L’amour, la joie, la foi, et l’acte de pratiquer un Reiki journalier, de prier avec le symbole, c’est la chance habillée de rose et de rosée !!! C’est la chance qu’on provoque soi même. Et pour soi même.

Pas de l’égoïsme, de l’ergotisme – s’occuper de soi. La soie de l’amour.

C’est dans ce sens que j’enseigne le Reiki. Et c’est ce que je souhaite aux gens lorsque je fais un stage Reiki pour eux ; qu’ils entrent à fond dans la joie et l’espoir, qu’ils y croient à la magie de la vie par la magie du Reiki….
Hélas, certains attendent que le miracle se fasse tout seul, qu’il suffit de faire un stage et tout arrive, si ça n’arrive pas on arrête tout. Ce n’est la faute à personne, c’est la conséquence d’une culture du miracle religieux, marcher sur l’eau ou rien, enchaînement d’un culte de la loterie, du loto, du tiercé, le culte du gros lot. Également l’effet de la culture de la passion de l’image. L’image hypnotisante du ciné et de la télé ; une vie par procuration, facile à rêver.

      Rien ne sert de râler quand les choses ne marchent pas comme on le souhaite « je n’arrive pas à vendre ma maison, je ne trouve pas un travail qui me plaît, j’y arrive pas avec mon entourage, c’est toujours pareil, ça changera jamais… ». Si l’on râle trop, si on exige on risque de charger le foie, de troubler l’eau des cellules et d’attendre le cœur serré et le sourire à la vie constipé. En fait voilà ; trop de sérieux.

      Je pense qu’il vaut mieux commencer par s’aimer, s’autoriser à recevoir à mériter le meilleur, persister dans la pratique des diverses techniques apprises en stage (il n’y en a pas qu’une !) , oser demander ce qu’on veut réellement et accepter de le recevoir. Que ce soit une guérison où vendre un bien au prix qui nous convient. En stage on apprend la réciprocité, la demande équitable, alors pourquoi s’en faire ? Demandez, croyez à la puissance de l’amour du Reiki, et laissez faire, laissez venir, laisser le temps au temps.

Recette : branchez vous sur l’égrégore du positif, connectez vous sur la fréquence des millions de praticiens Reiki dans le monde qui y croient et vivent….avec la chance à leur trousse !

Bonne chance à vous.
Dom

Written on octobre 18th, 2012 , news Tags: , ,

Témoignage de l’expérience du Permis de conduire facile grâce au Reiki !

Voici l’histoire d’une stagiaire de Planète Reiki avec son permis.

   

le-permis-de-conduire

le-permis-de-conduire

« j’ai eu mon permis du premier coup !

Le matin de l’examen, j’ai fait un petit rituel Reiki, et j’ai demandé de l’aide aux Anges… et les deux m’ont bien aidée ! Quand je suis arrivée, tout le monde avait un inspecteur… sauf moi! lol…. Ma monitrice a cherché partout quelqu’un assez sympa pour me faire passer l’examen quand même, et comme ça a pris du temps… et bien au lieu de passer le permis en 35 minutes, je l’ai passé en 10 minutes ! Et pendant que j’attendais, il s’est mis à pleuvoir, je me suis abritée sous un petit préau avec d’autres personnes, j’étais collée à une  dame dont le tatouage, à hauteur des mes yeux, représentait un grand ange! Et grâce au Reiki, je n’étais pas trop stressée.

Et aussi… du coup j’ai eu l’argent d’acheter une petite voiture toute chou 10 jours après mon permis. Je suis très contente !!

Et je me suis aussi inscrite à une formation pour devenir hypno-thérapeute. C’est une école reiki de Paris (où je voulais déjà me former quand j’étais en France) qui vient donner une formation en Guadeloupe pour la première fois le mois prochain, pendant 3 semaines.
Du coup en consultation je pourrai travailler avec le Reiki, pour les plus ouverts d’esprits, et avec l’hypnose, pour les plus cartésiens. C’est un outil que je souhaitait vraiment apprendre depuis que j’avais arrêté de fumer par hypnose il y a 4 ans ».
A.

Vos retours de stages reiki ; aussi en bas de page.

PRINTEMPS été Automne 2015

Stage Reiki Karuna

Stage Reiki Karuna

Vos retours de stages Reiki Usui, Karuna, Komyo.

Retours de vos stages Reiki Karuna Juin 2015

Merci à toi pour ces 3 journées Karuna d’amitié, d’AMOUR, de compassion, de Lumière, d’humilité et de nourriture spirituelle………. !
Merci d’être toujours dans le DON et le PARTAGE !!! Bonnes Vacances et sûrement on se verra en octobre !!! ou peut être révision 1er Degré le 19/20 Septembre !! bises, Marie. ps : tes photos sont magnifiques et les fleurs du cactus du Dojo aussi !!!

********************En te rencontrant j’ai franchi la porte d’un autre monde ; celui de la réalité, de la spiritualité et du chemin vers le bonheur.
Merci de tout ce que tu fais pour nous. Bien amicalement. JB

***************************Cher Dom,
Je remercie tous les jours l’univers d’avoir fait croiser nos chemins. La personne que j’étais, qui voulait sauver le monde a fait du chemin depuis à peine 5 ans grâce au Reiki. J’ai en effet compris qu’il fallait me guérir en mm temps que de soigner les autres. Petit à petit les nœuds se sont dénoués, les liens sont devenus plus souples les larmes ont beaucoup coulé et coulent encore…….
Mais quel bonheur de se sentir libérée, de sentir le poids qui m’étouffait se retirer. Je respire enfin !!!!
Comme tu le dis, avec le Karuna les épreuves sont devenues des expériences. Oh combien d’expériences remplissent ma vie !  Toutes aussi merveilleuses !!!
En écrivant ces mots qui coulent tout seuls je me repasse le film de ma vie. Je n’aurai jamais pensé atteindre cet état de paix.
Un jour décembre 2010 …… Sur mon chemin ….. J’ai croisé un merveilleux maître enseignant Reiki Karuna. Il est parfois direct mais surtout il est humble et rempli d’amour.
Merci DOM de m’avoir initiée.
Merci REIKI de m’accompagner.
Merci les ANGES Karuna de veiller sur moi.
J’AIME LA VIE.
Brigitte
*****************************
Retours de vos stages Reiki Usui et Komyo printemps et automne 2015

Cher Dom,
je viens vers toi pour témoigner avec une grande humilité que la formation du Reiki Komyo que tu transmets est une belle aventure car j’ai appris et partagé avec un Maître formidable qui a compris le pardon, l’humilité, le non jugement, la non critique, la simplicité d’être soi et se découvrir de l’intérieur pour être mieux envers l’autre.

Ma mission sur cette terre commence bien avec l’acceptation de mes dons grâce à la découverte de la paix intérieure qui s’est installée suite au stage Komyo, pour pouvoir progresser dans un monde où l’homme se sent si seul tout en étant entouré.

Le Reiki Komyo tel que le transmets ; j’y ai appris des techniques pour découvrir l’auto soin et le soin à distance pour moi et pour les autres. L’enseignement du Komyo m’a apporté des réponses à des questionnements principaux pour mieux vivre en harmonie avec moi mm, et avec les autres.

Je conseille au plus grand nombre d’entre nous de faire cette initiation pour être dans la lumière, rallumer l’ampoule de l’AMOUR car le cœur de l’homme est devenu tellement sec. C’est un bain de jouvence et un partage plein de sincérité.

Alors buvons cette tasse de thé pour être en communion pour faire ensemble le bien et donner de la lumière à soi et aux autres.

Merci au REIKI Komyo pour cette belle rencontre
************

Infiniment MERCI, pour ce que tu nous a, et m’a donné. ma pratique est quotidienne (45 mn environ), je me sens depuis lundi rempli d’energie, et pourtant je me lève à 5h30 du matin pour pouvoir exercer… je n’en reviens pas encore, ça sera avec plaisir de participer aux soirées reiki, donc je te dis au 9 octobre pour la soirée et le repas pratages. J….
**************

Ton attitude sage posé et calme avec un brin d’humour a su (nous), me transmettre le 1er degré de REIKI. En cela MERCI.
***************

Anecdote : il y a quelques mois, j’avais demandé à l’univers avec l’envoie à distance suite au stage 2ème degré de me faire rencontrer un homme gentil, qui a les mèmes valeurs et mèmes envies que moi …alors j’attendais, confiante… et il y a 1 mois, j’ai senti que je devais aller sur le site de rencontre où j’étais inscrite depuis un certain moment, mais où je n’allais plus… et là, un homme me contacte, avec un profil qui ne me correspondait pas du tout…et pourtant, je sens que je dois y aller….et en fait, en très peu de temps, je me suis aperçue que c’était bien lui que j’attendais….. du coup, nous sommes ensemble depuis 1 mois, sans doute, sans peur, d’une fluidité extraordinaire…(à 43 ans,ça ne m’était jamais arrivé) …avant j’avais l’envie, aujourd’hui, je suis prète…tout simplement…et je vis cette histoire, juste pour aujourd’hui, au moment présent….et demain n’existe pas…et c’est magique…. Merci Reiki, merci mon Guide , merci l’Univers !!!!  à très bientôt. gros bizoux. X… (du groupe Planète Reiki 2 « Amazones »)

********************************************

MERCI Dom, pour ton précieux Enseignement…Tout était juste PARFAIT d ans ce stage Reiki 3. Je t’envoie plein de Lumière et chaque jour que l’Univers me donne, tu es dans mes prières. Je t’embrasse bien fort. N….
********************************

plein de choses sont en train de se passer en moi et c’est juste génial…même quand c’est moyennement agréable !!! lol…..mais dans l’ensemble, c’est plutôt des choses sympas.

je travaille à fond et j’ai hâte d’être à samedi pour le 2e degré…..et continuer ce merveilleux chemin avec toi….
*******************
MERCI Dom, pour ton précieux Enseignement…Tout était juste PARFAIT dans ce stage Reiki 3. Je t’envoie plein de Lumière et chaque jour que l’Univers me donne, tu es dans mes prières. Je t’embrasse bien fort. N….

*****************
Je t’écris pour te faire mon retour sur « bambin »

En effet, entre midi et deux, m…, Garcon, 7ans m’a demandé un soin

Allongé sur son dos, Je lui ai fait le « global »; mais j’avoue ne pas être resté 3 minutes sur chaque position de mains. (Une des raison: les pattes sur le feu lol )

Quelle conséquence a cela?

Il s’est relevé HEUREUX m’a til dit, en sentiment de « ca fait du bien » pour reprendre ses mots.

Nous avons mangé…

Puis il a demandé que je lui en refasse un; je lui ai fais celui des chakras.

Idem, Il s’est relevé en disant « ah je me sens grandi »

c’est trop beau je trouve..

Sa petite soeur a alors demandé elle aussi un soin reiki; 

Assise dehors au soleil, je lui ai fais téte ventre ….

Elle était zen, normal …

Lorsque je lui ai chuchoté « voilà ma chérie j’ai fini »

Elle s’est mise a pleurer!

Elle est alors venu dans mes bras me faire un calin

Puis son frère est venu et elle lui a dit je veux un calin de toi aussi.

elle ma dit « maman, je ne sais pas pourquoi je pleurs mais je veux un calin de vous deux »

Elle a serré fort son frere en lui disant « je t’aime beaucoup »

M…., souriant, ma dit « oh maman cest la première fois que j’entends ça d’E…. » 

(d’ordinaire, Ils se font régulièrement des calins, tout comme ils se chamaillent)

J’avoue que ces scènes ont été surprenante…
Encore MERCI.

*************************
Après le stage de Reiki 2, de mercredi et jeudi derniers, je te fais un bilan  des changements qui se sont opérés pour moi.  Vendredi et samedi , tout mon corps ressentait une fatigue impressionnante, à ne pouvoir rien faire physiquement… donc ça a été le repos complet. Après, une fois ma vitalité revenue, mon premier « nouveau soin » a été pour l’une de mes amies , qui m’a surprise ;  » Ouaaahhhh « !!! m’a t-elle dit…..c’est beaucoup plus fort qu’avant !!!. Pendant ce même soin, j’ai eu l’impression que quelqu’un était à ma droite et me transmettait des informations quant aux endroits en problématiques. Je pratique quotidiennement, et avec beaucoup de plaisir, ce que tu nous a enseigné, Je me sens maintenant plus calme, plus sereine, aidée, et ayant des ressentis  plus fort au niveau du cœur. Je tiens à te remercier encore pour ce stage merveilleux , le Reiki que tu enseignes est un véritable cadeau d’Amour….du Bonheur Pur !!!!.

****************************************
A partager ce retour,  c est simplement ce qu’ il y a dans mon cœur,  ce fameux noyau divin, a qui j’avais interdit d exprimer quoique ce soit !
Le Reiki 2 m’a permis enfin de pouvoir vivre toutes ces émotions sans les craindre et de les accepter.

******************

Ce soir je rentre chez moi, jusque là rien d anormale, mon fiston un peu « malade » toussotant piaillant…

Je l’installe sur la table de massage et je télécharge la musique…. Hop nous voila enbaraué dans une séance de Reiki…..

Magique!

Non seulement plus de bobossss car maman était rentré et s’occupait de son garçon mais en plus pendant la séance à la gorge il a sur chauffé.

Après son retour il me prends dans ses bras et me dit il y a plein de chose que je n’arrive pas à te dire même si tu peux tout entendre je les gardais pour t’epargner…..

Et la il me vide son sac…..

Cela ne me concernais pas du tout ni directement ni indirectement mais lui les avait bloqué de peur de me créer du souci…. Le reiki l a libéré de cela ce soir….

Merci….. Le reiki nous a offert encore plus d’amour à partager.
*******

Grand Merci pour cet excellent WE, stage Reiki 1 riche en apprentissages.

Les effets positifs perdurent, le Reiki c’est bénéfiquement « addictif » ! A bientôt

***********************************

***********************************
Mai 2015
Un grand Merci pour ces instants passés ensemble hier soir et qui ont été pour moi source de Bonheur et de Joie. Bonheur car j’y ai vu des hommes et des femmes de bonne volonté œuvrer tous ensemble pour contribuer à soulager la souffrance des autres, en toute simplicité. Joie d’avoir pour un instant retrouvé l’émerveillement de l’enfant qui sommeille toujours en moi. J’ai découvert hier un nouveau chemin dans le ressenti; je pensais en avoir fait le tour et crois moi, j’ai été gâté dans ce domaine par la Vie.

Depuis que mon grand père puis mes oncles m’ont appris à découvrir les sentiers de l’eau dans le ventre de la Terre, que de chemin parcouru, que de rencontres avec celle qui dirige invisiblement le monde; je l’ai retrouvée dans le silence des collines, au fond de la mer, en haut des montagne, dans la solitude sauvage des garrigues et des forêts. Je l’ai ressenti ensuite sous les voutes des églises et des cathédrales. Je me suis lié à elle contre les pierres levées ou couchées que nos ancêtres avaient érigées il y a bien longtemps mais qui continuent généreusement à nous léguer leur héritage, aujourd’hui encore. Puis vinrent les expériences des soins d’ici, puis de ceux des Chinois avec chacune leurs différences dans la palette des ressentis. Le ressenti de chacune de ces rencontres est différent. Et hier soir au Dojo Reiki, ça n’a pas manqué de se reproduire ; Je l’ai ressenti très fort à un endroit que je n’attendait pas…Et je suis resté là, immobile, abreuvé de cette force qui entrait en moi et qui me nourrissait, comme une mère allaite son nourrisson. J’ai remercié, j’ai prié, j’ai communié avec elle…c’était bien celle que je connaissait et qui me dévoilait un autre de ses visages….qui m’a réconforté, qui m’a rassuré, qui m’a soulagé et finalement, apaisé.

Merci aussi d’avoir pris soins de S..….Nous sommes ressortis du Dojo confiants et rassurés; conscients que nous ne sommes plus seuls pour affronter les épreuves du Chemin.

Merci de ces moments d’extases, où la Lumière vous envahit, quand le sentier se dévoile enfin un peu plus, éloigne la peur et l’angoisse, et que les choix sont remplacés par l’Evidence. Merci de nous avoir offert tout celà… et de m’avoir rappelé que, dans le domaine de l’Humain, un et un, ça fait beaucoup plus que deux… Que les Anges continuent à veiller sur toi.
Fraternellement.
**************************

Merci à toi Dom d’être ce que tu es!

Je me disais ce matin ,oups pas de pleurs lors ni pendant ni après la maîtrise!!

Me voilà guérie de mes traumatismes du passé ! Merci à toi. Merci au Reiki !!
*************************

Je te passe l’enregistrement que j’ai fais pendant la formation à la Maîtrise, Il y a tout le début de l’échange, la médit elle même démarre vers la 5eme mn. (c’est génial de pouvoir réentendre, t’es trop fort!) . Merci pour les 2 diplômes!
Je crois que je n’ai pas fini de mesurer l’ampleur des guérisons qu’il y a eu sur ces 3 jours… je l’ai sentit le dernier jour de manière très intense, mais waouh c’est vraiment énorme. Sachant que tu enchaines les stages j’ai pitié de toi et je t’épargne les détails…
Mes sœurs viennent dans 15 jours je vais pouvoir pratiquer à tour de bras, d’ici là sur les objets et les chats…Encore merci, merci, merci pour ton précieux enseignement.
******************************

Merci surtout pour tout ce que tu nous as fait découvrir. J’ai la sensation d’avoir vécu un « moment fort », de découverte et de partage, que je n’oublierai pas. Je ne pensais pas en venant au stage que le Reiki Komyo pourrait à ce point entrer naturellement dans notre vie, et modifier notre façon d’être. J’ai la sensation qu’il y a un « avant  » et un « après ». Tu nous as donnés les outils, le mode d’emploi, et l’envie de s’en servir. J’espère que le temps n’amenuisera pas mon envie de prolonger l’évènement, mais je sais que cela ne tiens qu’à moi. Montpellier est loin pour nous pour participer aux soirées partage, mais nous avons déjà programmé d’en faire avec ma sœur F…, G…, et M….le week end quand ils descendent à Arles.
****************************************
C : Tout d’abord merci pour ces deux journées d’enseignement et de découverte d’un Maître Reiki qui est d’une ouverture et d’une humilité tout cela m’a beaucoup touché.
D : Bonjour C….c’est le Reiki qui coule en moi qui me fait….

C : Je te remercie encore une fois pour la mission que nous avions a faire en commun -m’initier et te faire confiance pour ça – et maintenant je commence a ressentir le début des effets de ton enseignement et le soin a distance.
D : c’est ça le vrai merveilleux de notre planète, sa présence, toujours. La présence de La Terre.
C : Comme tu l’écris si bien sur ton site « le plus grand ennemi de notre personne c’est nous même », travailler son mental est extrêmement dur quand on est seul mais là avec tes symboles et la parole cela va mieux.

D : c’est le chakra le plus dur à travailler ; la gorge ; parole, écoute, accueil du Divin, confiance et audace d’être soi. Mais à terme c’est lui qui nous donne notre force. Au quotidien.

C : Je te donnerai des nouvelles de mes progrès sur mes soins et sur moi et mon acceptation de ce cadeau de médiumnité. Au fait ton ange gardien me parle et me dit que tu aurais un ami à toi qui serait décédé et qu’il est souvent auprès de toi 😉

D : Merci, et dis lui de lui dire qu’il en profite pour faire le ménage ! l’aspirateur est neuf, il devrait se régaler…lol
********************************
Le lendemain du 2eme degré, urgence pour un proche au bord de la crise cardiaque,1h de reiki et sa tension est passé de 16 à 11.
Les 1ers jours, côté Sauveur à été réactivé…ce que la technique Reiki 2 du « traitement mental » m’a apporté de plus c’est d’abord le calme et une sorte de sérénité….jusqu’à bien mieux vivre aujourd’hui mon chagrin d’Amour (ou d’attachement peut-être),quand c’est trop fort prise cosmique…
J’ai lu avec attention ce que tu écris sur la relation Amoureuse, dans ton recueil du 2eme degré, Veux tu dire que ce que l’on voit chez l’autre ou ce qu’on lui reproche est précisément ce que l’on doit transmuter chez nous pour avancer et Gai RIRE!
Ton regard avisé est le bien venu, merci pour ce que tu transmets et la manière dont tu le fais...
************************

Me voici de retour dans mes belles montagnes lyonnaises depuis tout à l’heure.
Je tenais à encore te remercier pour cette magnifique formation, je suis une autre, et ma famille m’a fait remarquer déjà hier, que j’étais transformée.
Hier après-midi j’ai fait un soin d’1h30 à ma belle fille qui a le dos dans un état lamentable la pauvre et ça lui a fait beaucoup de bien(mais il lui faudra beaucoup de séances car elle a la colonne vertébrale toute tordue). Mais ce qui m’a beaucoup émue, c’est lorsqu’un jeune homme qui fait des travaux chez mon fils, lui a dit hier au soir de me remercier car il n’avait plus mal au dos!!!Vers 17h,alors qu’il allait rentrer chez lui, il a dit qu’il souffrait beaucoup de son dos, effectivement cela se voyait dans sa démarche. Je lui ai demandé s’il connaissait le Reiki et dit que je venais tout juste d’être initié; il connaissait ;donc je lui propose d’essayer de le soulager en lui donnant de l’énergie  (je dois dire que j’étais entrain de terminer le soin sur ma belle-fille lorsqu’il a toqué à la porte ),il accepte, donc je mets mes mains à 10cm environ au dessus de l’endroit désigné , 6mn, pas plus, et il est parti en descendant difficilement les escaliers, mais en prétendant que ça lui avait fait du bien. Puis j’ai terminé le soin de S….(ma BF).Voilà, Jusqu’à 20h où  il est passé à la maison et a dit que même pas une demi-heure après ma petite intervention, il n’avait plus mal ! !! Imagine mon émotion ! quel bonheur, quelle belle récompense, si rapidement après mon initiation du 1er degré. Merci, merci, merci…3 fois de suite la aussi …lol ! !!
J’ai commencé la lecture du manuscrit Reiki 1er degré Planete Reiki ; j’ai compris ‘les éreurs gramaticales » ‘dont tu as parlé en nous le remettant. Voilà, cher Dom.Je te souhaite une bonne soirée.

*********************
Un petit mot pour te dire que la  pratique régulière du Reiki m’a apporté beaucoup de bien être et de réalisations. ma vie est en plein changement….et j’ai depuis quelques temps vraiment l’impression de communiquer mentalement avec l’Univers. et d’être entendue. je me sens plus forte tout en étant sereine. je remercie le fait de t’avoir rencontré et que tu m’es transmis l’amour du Reiki.
encore merci.
*******************************

Décembre 2013
Retours de stages :

Je fais partie du groupe Reiki 1er degré  » vent d’automne » de Planète Reiki. Suite à ce stage, je suis partie aux Antilles. Savoir pratiquer le Reiki m’a beaucoup aidé pour ce voyage. Je fais des aller et venus aux Antilles depuis presque 10 ans. ce sont des voyages dû à mon activité professionnelle. A chacun de mes voyages, je rentre complètement vidée. Cette fois ci, très grande surprise, je me sens bien en forme.

Je fais des aller et venus aux Antilles depuis presque 10 ans. ce sont des voyages dû à mon activité professionnelle. A chacun de mes voyages, je rentre complètement vidée. Cette fois ci, très grande surprise, je me sens bien en forme. Avec le décalage horaire, je me réveille tous les matins entre 3 et 4 h du mat. Je profite donc faire mon heure de Reiki. J’ai eu des moments assez difficiles émotionnellement.
Heureusement, que Le REIKI est là. En plus pendant mon séjour, tu nous as envoyé quelques mails de nouvelles Reiki. Qu’est ce que ça m’a fait plaisir ! Je n’ai pas pu t’écrire avant pour te remercier pour ces moments chaleureux, et pour ces moments de partage qui m’aide beaucoup aujourd’hui. Je me sens un peu plus forte, un peu plus rassurée. P.

****************************

Bon Jour Dom, Merci pour ta prompte réponse ! Soyons patients pour Alain … Il semble que cette fin d’année soit pour nous tous, bonheur, amour et Conscience (pour nous en tous cas prises de conscience gigantesque !) c’est cela que j’étais venue chercher ici … Le Reiki vient encore de prendre une autre dimension pour moi : engagement profond et plénitude, confiance … Voilà un beau cadeau de Noël … Merci à toi Dom pour ta présence et ton enseignement. Que les belles choses et les belles personnes que tu viens de vivre lors de ton dernier stage « Reiki de Noël » t’accompagnent jusqu’à la toute fin de 2013.
Demeures heureux tels que nous le vivons.
V
Om shanti
****************************
Tu as raisons ici en Asie les énergies sont extraordinaires ! Cadeau de l’univers hier : j’ai vu des dauphins en toute liberté …Ici tout m’est offert au niveau des énergies, oh combien sont-elles belles ! Mon être tout entier est en pleine phase d’évolution /révolution !
Je t’envoie toutes les lumières et les énergies depuis ce bel endroit de  la planète et un bisou !

Septembre 2013 ; retour du stage Reiki 1 :

…des news, pour moi cela se passe très bien si ce n’est que j’ai du mal à atterrir un peu, j’ai même un entretien d’embauche vendredi et franchement cela ne me perturbe absolument pas !!! C’est quand même incroyable !!!  Sinon j’ai fait mon premier soin hier sur ma petite sœur, elle s’est sentie complètement anesthésiée au point qu’elle n’arrivait même plus à lever un bras  pour évacuer une mouche qu’elle avait sur la main. Elle s’est sentie un peu vaseuse après et 2h après tout allait bien pour elle et pour moi, je trouve cela absolument divin …lol
S.
***********

Merci reiki pour ces moments de paix, de boulersements et de belles rencontres. Une grande porte s’est entrouverte devant moi, je suis en train de la pousser petit à petit, j’ ai hâte de trouver ce qu’il y a derrière !!!…
L.
***********
Je travaille, je travaille le Reiki et le Qi Gong j’ai encore plus d’énergie dans les mains.
A.
***

Merci a toi pour tout ce que tu transmets , répands et fait ressentir. Je m applique dans mes exercices et ai pratiqué un premier soin hier, ça m a fait beaucoup de bien !! La personne était ravie et m a dit que ses idées étaient plus claires , il doit me tenir informer de la suite. Voilà , je suis heureux! Merci Reiki et à bientôt. 
R.
****
Cela se passe bien avec le Reïki 1er degré pour toutes les raisons que tu connais déjà … Je m’ auto- traite régulièrement et vais mieux, mon mari est
enchanté de mes services et le chien commence à en bénéficier aussi… C’est exactement ce que j’espérais …et je te remercie encore de ton enseignement
et de ta transmission … Que l’Amour Reïki t’accompagne toujours.
D.

 

septembre  2012
Dés le deuxième degré Usui nous aprenons à utiliser les cristaux de quartz pour emplifier et prolonger les envois de Reiki à distance, autant pour soi dans le passé le présent et le futur, que pour les soins et les marathon Reiki à Autrui. Bien entendu les cristaux de quartz ne se limitent pas à cette déja si merveilleuse action. En voici une recette d’Elixirs de minéraux !

Préparation d’un élixir Reiki :

Mettre le cristal après l’avoir nettoyer dans un verre d’eau minérale, eau de source…et Couvrez le – verres « Nutella » à couvercle ! – puis donnez lui du Reiki et l’énergie du (des) symboles au moins 3 minutes – En faisant cela pensez ce que vous désirez de l’action de la pierre- , et placez-le au réfrigérateur pendant une nuit.
Le lendemain, faites à nouveau 3minutes de Reiki avec symbole(s) et il peut être bu ou appliquer. En massages, en onction, pour une plante, dans une recette de cuisine…ect.

Attention : Certains cristaux par leur composition ne peuvent être mis dans l’eau ou sont toxiques donc ne doivent pas être ingéré ; renseignez vous !!…


Du 30 Novembre au 3 Décembre 2012, nous serons au salon Bio Harmonies de Montpellier – Stand D40 Hall 9.

Clic  droit  sur l’image , puis : dans la liste qui se déroule : clic sur : Enregister l’image sous.
pour la télécharger

Vous reste plus qu’à  l’imprimer autant de fois que vous le désirez pour vos proches et lointains amis.

en cas de difficulté n’hésitez pas à nous écrire contac@planete-reiki.fr et nous vous l’envoyons par mail avec grand plaisir.

@ Bientôt au salon !

          Mudras de la danse et de l’eau.

Nous avons achevé la saison des stages et des ateliers Reiki par les 2 ateliers « Mudras et Reiki » mi Juillet. Leur pratique m’a donné cet été l’occasion de vivre un moment merveilleusement…intime.
C’était en Août, dans sa splendeur de feu, la recherche de l’ombre, de la fraîcheur. La quête de l’eau, celle de la baignade et des fruits frais. Si possible loin des foules, tout au moins le plus de solitude ou le maximum d’espace autour de soi. Guère possible à la plage.
Les Cévennes. Je campais autour de Saint Jean du Gard à l’occasion de son festival de théâtre de rue auquel je fus invité par une amie rencontrée à Avignon. Nous venions d’y vivre une semaine de Qi Gong Woodang 2 enseigné par le grand Maître …….La pratique du Qi Gong est « obligatoire » quand on pratique la Maîtrise Reiki intensément, afin d’en mieux canaliser sa puissante énergie, et le Woodang est, la forme la plus adéquate à mon humble avis. Gérard nous répétait tout au long de ce stage intensif qu’il fallait « chauffer » les reins, boire chaud, d’éviter les glaces, les boissons fraîches, bref de toujours protéger les reins du froid, même en été. Je n’y ai pas trop cru, confiant dans l’énergie Reiki et celle des symboles le Reiki est un Qi Gong – laissant ces croyances anciennes aux Chinois, et ne prenant à part moi juste la pratique des gestes et des métaphores puissantes et subtiles du Woodang 2.

Midi, chaleur, sueur, et faim. Pique-niquer au bord du Gardon, idée irrésistible. Pas un coin de libre, j’avais envie d’être seul au bord de l’eau, manger et méditer avant de retrouver avec bonheur la foule festivalière. J’entre dans le courant et décide de remonter le torrent à la recherche d’un endroit inabordable par la rive. Le truc sauvage hors du monde au sein de la nature. Chez soi. Je trace d’abord le symbole de distance en l’air, Ckr sur les mains les pieds et le corps et, pour ceux qui connaissent, Iava, et me connecte joyeusement à l’esprit de l’eau en terminant par le Mudra de la dance. Marcher au milieu du Gardon agité, de l’eau tantôt à mi cuisses tantôt mi mollets en roulant sur les gros cailloux moussus devient alors aisé, mains jointes devant Swadhistana,  dans la forme du Mudra de l’eau ; ne lâcher la forme qu’une fois trouvé le coin de rêve.
À l’ombre.
Au bout d’un kilomètre je trouve, termine le Mudra en offrant l’eau divine au torrent et m’installe au milieu du gardon sur un rocher, au sec. Ombre d’un arbre penché. Chant de l’eau qui court à la mer. Joie. Un héron cendré vient se poser à 20 mètres, de façon identique ; sur un rocher au milieu du courant. Jubilation. Merci, moment de grâce. Ouverture du sac à victuailles…et là, tout à coup je sens une douce chaleur bienfaisante dans le bas du dos et je ressens la masse des 2 reins. A l’intérieur. Leur volume, leur poids. Leur présence. Je me retourne pensant au soleil passant au travers du feuillage !?! mais non, « ils » étaient on ne peut plus à l’ombre et baignant dans l’aura fraîche du gardon enveloppante.
Ça chauffe, c’est bon, et ça dure.

Puis je comprends. Les reins sont Yin, l’eau qu’ils filtrent, je venais d’honorer l’eau, j’étais entouré d’eau,  alors mes reins ronronnaient en se présentant à moi comme jamais au cours de mon existence je ne les avais ressentis.
Merci Mudras, merci Qi Gong. Merci Reiki.
Merci la vie le soleil et l’eau pour ces petits instant de bonheur.


Stage Reiki enfants à domicile !

Stage Reiki enfants à domicile !
Suite au marathon que nous avons envoyé à Xavier pendant plusieurs 
mois (

Xavier va très bien dans l’ensemble, il a des hauts et des bas mais surtout des hauts! Il revit et vous y êtes pour bbbbbbbbbbbbbbbbeeeeeeeeeeeeaaaaauuuuuuuucccccccccooooouuuuuuuuupppp!!!!!!
Merci merci Reiki!! Ingrid) 

 ainsi que les soins à distance à 2 de ses filles, puis son initiation – à son domicile vu son immobilité – suite à son mieux être, je vais avoir l’honneur et le plaisir d’initier ses 3 filles – 6,15 et 11 ans – au premier degré Usui.

 

Leur stage en famille,  des fleurs de lumière Reiki dans une nation de chrimères…

 

D’autres enfants inscrits à un 1er degré. Quelle belle rentrée ces enfants se voient offrir !

Un maître Reiki enseignant peut il être malade ?

Bien entendu, et Heureusement. Pourquoi heureusement, parce qu’ainsi il a l’occasion de tester sur lui les effets du Reiki et des symboles. Lui permettant ensuite d’enseigner du vécu ! Convaincu lui-même.
En signant la chartre de l’éthique de Maître enseignant Reiki on s’engage à faire un travail continu sur soi – qui va de plus en plus en profondeur au fil des années d’enseignement. Dans l’intime secret de soi.
Fin Août c’est ce qui m’est arrivé. En repeignant la cuisine, le dos s’est coincé. Je peignais avec le dos ? Oui. Je m’en souviens, ce dimanche après midi j’en avais vraiment plein le dos, plus envie de continuer le travail, envie d’aller à la plage, finir avant d’aller à la plage, dualité, résistances des deux cotés. Crac. Sacrum, puis …Lire la suite…L4 et L5. Putain ça fait mal. Limite des mouvements, des positions, réduite à l’amertume la joie de vivre une fin d’Août très chaud comme je l’aime, une semaine pratiquement au lit. J’ai activé tous les symboles connus, dans des formulations diverses (Usui, Karuna, et Shamballa) fait des autotraitements, du Qi Gong et des demi-torsions Yoga – ce que je pouvais, vu que j’étais tout de travers par compensation… vertébrale.
Rien.
Ou peu de résultats, qui ne tenaient pas. J’en connais la raison. Plutôt que de persister à me soigner, je constatais qu’une part restait dans l’état de souffrance, je préférais comprendre, chercher à voir la forme pensée qui créait le blocage plutôt que de me soigner physiquement. Par expérience, et grâce aux symboles, lorsque dans mon esprit se fait clair la raison de la peur inconsciente que mon corps voulait me communiquer par son langage-non-verbal (vertèbres contractées en l’occurrence) lorsque l’esprit comprend le corps, alors tout se débloque d’un coup. Ça n’est pas pour moi une simple théorie mais un long vécu symptômes-Reiki-Symboles-compréhension-libération/guérison spontanée. Expériences personnelles et celles des praticiens que j’ai aidés.

Si j’avais guéri cette lombalgie en un jour, je n’aurais pu apprendre l’excellente leçon que j’en ai retirée. Quelques fois l’énergie peut nous entraîner à stagner dans une situation pour en trouver l’élément déclencheur. C’est de l’amour, la rose avec les épines. Mais la rose tout de même.
L’antalgique enlève les épines. Alors la chose pointue reste en dedans, n’est pas exprimée, pas libérée.

Je passais ma semaine du lit au hamac à scanner l’imaginaire, détecter dans la mémoire les pensées incorrectes liées aux vertèbres en question et j’en oubliais – paresseusement – de me soigner physiquement – enfin, un peu quand même. Rien d’étonnant à ce que j’en ai eu marre de souffrir et j’ai lâché ; j’ai lancé l’appel par mail d’un marathon Reiki à distance. Pour moi. J’ai osé. J’ai écouté la voix de mon guide Reiki.

C’est la 1ère fois que je faisais ça, demander à mes stagiaires-élèves-praticiens de m’envoyer du Reiki. Je ne le faisais jamais, non pas par fierté ni orgueil mais par croyance.  Celle de croire que l’enseignant, le « Maître », doit toujours montrer à ceux à qui il enseigne une image invincible. J’ai compris que c’était faux, en partie. Du moins pour le « toujours.
Et c’est drôlement bien vu de la part du message du Reiki et des symboles, car ce « oser demander » fait partie des causes à effet du problème sacrum – exprimer les sentiments, exprimer les peurs et les souffrances – les garder comme j’avais l’habitude de le faire c’était retenir « en bas » l’énergie qui doit s’élever. J’ai compris ; le sacré c’est en bas ! J’ai compris et changé bien des choses depuis cette semaine d’Août. Voilà encore un « plus » à retransmettre lors de mes futur stages et ateliers.

J’ai vu aussi la compassion dans les actes et actions de mes chers initiés–ées, leurs élans spontanés vers moi, et même certaines personnes qui m’ont remercié car grâce à ma demande elles se sont mieux appliquées et en ont tiré profit, m’ont-elles écrit.

Moralité ; il y a autant d’honneur à demander et recevoir qu’à donner.
Merci  Reiki, merci à Tous Symboles pour ces belles leçons de vie.

Et merci à vous pour ce marathon d’été !
Dom.J

Moralité ; il y a autant d’honneur à demander et recevoir qu’à donner.
Merci  Reiki, merci aux Symboles pour ces belles leçons de vie.

Encore merci à vous pour ce marathon d’été !
Dom.J


Rébellion par la pensée positive. 

L’impertinence du monde exaspère. Est elle est bonne l’exaspération face aux inconvenances du monde ? Pour certains, elle pousse à produire de l’indulgence sous contrainte. Confrontés aux problèmes sociaux, éducatifs, nutritifs, et devant l’avatar qu’est devenue l’horrible industrie de la santé, le monde affiche une telle irréflexion, tient pour nul compte les milliers d’années de sagesse et de connaissances – la démystification de ce qui pourrait être la vraie vie – accumulée dans ses spacieuses bibliothèques…lire la suite.., pour ce monde en souffrance cela ne servirait à rien. Pour d’autre, à l’inverse, depuis leur plus rude enfance ils n’ont cessé d’y voir une injure à l’intelligence humaine. C’est cette injure, empirique, récurrente, qui en exaspère plus d’un. Exaspérés et révoltés, ils astiquent résolument chaque jour un peu plus une arme redoutable en vue d’une ultime révolution ; la bienveillance. Grâce à cette divine haine qui bouillonne dans leur ventre depuis un quart de siècle, en dehors de tout dogme et de toutes religions, ils firent l’effort de se rapprocher de Dieu – le jeune, celui sans barbe, sans visage défini, le joyeux, le présent, le don – et, contraints d’impuissance à changer l’ancien monde, il lui ont demandé de leur apprendre la clémence.

Les omissions des masses dominantes politiquement irrespectueuses, ils ne les prennent pas à la légère, ils ne commettent pas cette insouciante imprudence, seulement, plus les dirigeants vont vers la précipitation désastreuse et honteuse, grossière, plus ils se glissent dans la peau d’un ours magnanime. Sans cette exaspération pondérée d’impuissance à changer les idées des décideurs arbitraires ils seraient restés dépourvus de bonté. L’incurie des ministres, leur désinvolture insolente à négliger la connaissance des sages du Monde entier, percute leur impatience d’un monde meilleur. Cela leur plaît, absolument. Seuls avec leur colère et leur impatience, ils doivent se résoudre à détruire leurs emportements afin de laisser infuser  en eux l’amour du Monde que le lait de leur mère avait versé dans leur cœur d’enfants. Cette irresponsabilité qu’ont les hommes et les femmes pressés de devenir riches et obstinés à le rester inconsidérément au prix du malheur des autres, leur inattention à la voix unanime des poètes les rend furieux. Ils en font, de ce fumier, le plus sûr des engrais ; ils se transforment, s’épanouissent. Sèment sur le monde la même lumière qui les éclaire en dedans. Jusqu’à ce que se dissipent les brumes obscures de ces esprits moisis d’humides chancres, ils feront cela, ils aimeront leur sainte colère.

 

Reiki-2-deuxieme-degréMerci Dom pour cette belle élévation à la maîtrise ! Merci pour la qualité de ton enseignement et de ton relationnel. Ce stage fait désormais partie des moments marquants de ma vie. Je sens que ma pratique du Reiki va se modifier profondément. J’ai pris conscience aujourd’hui d’une « sphère » de chaleur permanente et intense dans la paume des mains. J’adore ces manifestations sensibles !

Je vais m’inscrire à ta newsletter et initier mes cristaux ensuite !  

Bonne soirée et à bientôt, JL….et ; joyeuse bulle de lumière Reiki !

*************

Bonjour Dom, Je viens de prendre connaissance de ton mail, et viens d’imprimer, tes documents, c’est précieux. Je te remercie encore pour ce très beau week-end qui restera gravé, tout au long, de ma vie, dans la pratique du REIKI 4 !
Tu es un sage, un être de lumière, j’ai beaucoup aimé faire ce stage de Maîtrise avec toi.
Je remercie l’énergie Reiki, et par ma foi le Seigneur, de me trouver sur ton chemin.
J’ai aimé le groupe, l’ambiance, la synergie, et le lieu.

************************

J’ai encore la tête à Cabrières et le coeur dans DKM Tibétain du Reiki 4…

Un petit miracle de douceur, de paix et de lumière….

Merci encore pour ta patience…. de maître.

************************************************

Merci pour les coordonnées du groupe! 😉

J’en profite pour te remercier encore une fois de cette belle initiation, j’avoue que ça brasse pas mal de choses encore une fois surtout sur un niveau émotionnel, je pense que sksk que je n’avais pas reçu et que tu m’as transmis y est pour beaucoup! 😉 même si ça fait mal, c’est libérateur, alors j’accueille !
Je calerai ma prochaine venue à Montpellier pour participer à une soirée d’échange, se sera un grand plaisir d’y participer 😉

Alors merci merci merci!!!!!

Très belle journée ensoleillée,

À bientôt, P.

**************************************

Depuis  mon initiation a la maîtrise reiki Usui Tbet, je suis envahie d’une sérénité et d’une paix incroyable. Au bout de quatre jours d »auto-traitement , pour la première fois….. j’aime et  je deal avec mes entités….le tout géré et canalisé par moi…….  Merci DOM…..merveilleux  weekend-

Bise

**********
Merci mille fois pour ces 4 jours de stage reiki Karuna ! depuis je ne vois plus la vie du tout de la même façon, je suis très émue et c’est un régal du matin au soir
merci merci merci !!!
***************

Le Karuna j’aurais du dire à ma mère de le mettre dans mon biberon, non ! dans son sein, c’est un nectar.
**********

surprise de découvrir la liberté et la douceur de cette énergie Karuna. Aujourd’hui après ce fabuleux stage je comprend pourquoi j’ai du faire le Usui 3 avant, merci de tes conseils avisés Dom.
****************

super génial ce stage de reiki Karuna ! en rentrant j’avais une patate d’enfer ! je chantais à tue tête dans la voiture, et ça fait 3 jours que ça dure.
moi qui avait peur de chanter avant , merci Dom pour ta patience et ta force que tu m’a transmise.
je ne l’oublierais pas.
**********************

Encore merci pour cet apprentissage de la technique du pardon.  Je la pratique de temps en temps et commence à ressentir cette paix intérieure mais je sais que la route est encore longue.

___________

Bonjour Dom!

Tout d’abord à nouveau un grand merci pour ces deux jours formidables et cette fabuleuse transmission! Quel beau moment! Je suis très heureuse que le Reiki t’ai placé sur mon chemin!

Mes anges m’avaient envoyé le message suivant: « nous vous enverrons de l’aide sur Terre sous formes de maîtres et lectures afin que vous puissiez développer vos dons… »

Je les en remercie: te voilà;-)

La route n’est pas finie…j’ai encore du boulot… Et j’espère que tu accepteras de m’accompagner dans mon apprentissage!

…et pour finir, merci pour les contacts;-)

A très bientôt!
_____

merci à toi P. pour ton e.mail,et un grand merci à tous ,pour ce que chacun à apporté au groupe lors de ces deux journées du stage, joie d’echange et de partage d’emotion et d’energie du Cœur !

…..J’ai moi aussi commence à pratiquer et j’ai eut la chance d’avoir vécu coup sur coup ,dans les 2 jours qui ont suivis, plusieurs experiences  formidables,que l’on pourras echanger j’espere sur Skype ou lors de nos prochaines rencontres à la planete reiki,!!!

…..ces experiences don’t je vous parle, m’ont amenées à m’inscrire des à present au stage reiki 2 des 14 et 15 juin prochain.

….comme ont c’etait promis de s’en tenir informés, çà c ‘est fait.

…au plaisir de vous revoir les uns et les autres ,soit sur Skype ,soit ailleurs….à la planéte reiki ,par exemple,lol

Nous avons la chance d’avoir un Maitre  du Coeur en la personne de Dom, et çà c’est une Bénédiction!!!.(.merci Dom pour l’ecoute, ton enseignement et ton Coeur)

bonne soirée et bon w.end à tous!…..bien amicalement

*******************************

il est tard , mais je viens de vivre des instants emotionnels tres forts en l’espace d’une heure!!..houa!!…..

merci pour la force et la foi avec laquelle tu nous a souligné l’importance du : ICI ET MAINTENANT, l’instant present, ……et de l’ Amour avec un grand A ,don’t tu as commence à nous imprégner!…..voilà, çà c’ est dis.

Pour les emotions, je te les expliquerais de vive voix, ce seras plus facile que sur l, ordi.

A TRES BIENTOT……………merci…pour ton accueil chaleureux,et ta disponibilitée envers chacun d’entre nous. C
**************************
juste un petit mot pour vous remercier encore pour ce super week end d’initiation au REIKI2 !!

Au de la de votre enseignement , c’est pour votre disponibilitée et toute cette Energie d’Amour et de Positivitée que vous dégagez tous les deux et qui est contagieuse que je vous dis un GRAND MERCI !….

****************

Merci a vous deux pour ce merveilleux week end riche en émotions

***********************

Merçi encore à toi et Isa de ce beau stage, encore une belle étape sur le chemin du Reiki
A très bientôt
Avec coeur

*********************

________________________________

 Suite Stage échanges Mails entre l’enseignant et une stagiaire.

Le 10 octobre 2012 22:25, L. a écrit :Bonsoir Dom !Dimanche soir après ce fabuleux week-end d’initiation, je me suis sentie comme si un rouleau compresseur m’était passé dessus. La même sensation que lorsque je ressors de chez l’ostéopathe mais en beaucoup plus intense. ça bouge à l’intérieur, ça se transforme !Je viens te demander un conseil. F. m’a dit qu’elle se faisait comme une bulle d’énergie le matin en arrivant à son travail. Peux-tu m’expliquer cela ? Comme F. mon travail m’amène à beaucoup me déplacer dans les différents bâtiments de l’établissement dans lequel je travaille. Comment créer une petite bulle qui me suive partout toute la journée ?Encore un merci pour ton accueil de ce week-end. Bonne nuit !

L.

**********************
From: dom jeambrun <contact@planete-reiki.fr>;
To: L.fr>;
Subject: Re: demande de conseil
Sent: Thu, Oct 11, 2012 3:17:22 AM

Plus tu vas tracer Ckr sur les chakras à chaque rituel de préparation plus ton système énergétique va se manifester et créer une bulle protectrice. Comme F., tu vas interagir en « T’Imaginant » que tu es entourée d’une bulle de lumière Reiki ( ce qui est parfaitement vrai – aura éthérique) mais le fait de l’imaginer créé une réalité plus dense. Donc dans le travail, tu t’isole 2mn, tu fais le rituel de préparation, et tu trace le symbole sur chaque chakras avec l’intention qu’ils (le symbole et les chakras) te protègent des autres et qu’ils  protègent les autres de toi, en créant une bulle d’amour autour de toi durant tout le service.

Je te souhaite de.
Dom
************************
Le 11 octobre 2012 22:24, L.fr> a écrit :

merci pour ce précieux conseil. 
j’ai lu ton mail ce matin ; j’ai donc pu me créer une bulle de lumière pour la journée. À un moment un peu compliqué : hop ! j’ai refait discrètement le signe sur mes mains et tous mes chakras, l’air de rien en pleine réunion. Ça m’a amusé de faire ça discrétos à l’insu des personnes autour de moi et surtout ça m’a permis de voir à nouveau cette lumière dorée qui m’a redonné confiance en moi.
Je dis voir la lumière parce que je l’ai imaginée tellement fort que je l’ai vue  ! !Encore une fois merci. bises. L.
Envoyé par …truc Mail (sur Android)

 


 

Une autre histoire d’eau…

Une histoire d’échange de mails suite à un courrier de réservation de stage Reiki 4.

********************************

Le 19 septembre 2012 23:02, C.fr> a écrit :

Bonjour,

Avez-vous reçu mon chèque et mon inscription pour le R4 du 19/20/21 octobre ?

C.

**********

20 Sept . dom jeambrun contact@planete-reiki.fr

à C.

bonsoir…,

non, je ne l’ai pas reçu, aujourd’hui mercredi 19/09….

vous l’avez expédié quand?

***************

Le 25 septembre 2012 19:55, C.fr> a écrit :

Bonjour,

Avez-vous reçu mon chèque ? Il est parti le 16/09

C.

*******

dom jeambrun contact@planete-reiki.fr

25 sept.

à C.

non, rien. vous devriez faire opposition, s’il le faut je peux vous donner un justificatif de non réception.

Dom.J

********

dom jeambrun contact@planete-reiki.fr

29 sept.

à C.

bonsoir

je vous ai laissé un message sur le répondeur.

le chèque est arrivé.

tout va bien

bon wend !

Dom.J

j’y ajouterais… »Normalement je devais dormir à Nîmes ou j’animais un stage Reiki 2, mais une batterie solaire à claquée avec l’orage continuel samedi, et lorsque je me suis réveillé après la sieste after-animation-intense, il n’y avait plus de lumière dans la yourte ni dans les cuisines, Yam, notre hôte était au théâtre, je ne pouvais pas rester dans le noir donc je décidais de rentrer à Montpellier, sous l’orage – très beau j’adore rouler dans ces conditions/nuit/éclairs/pluie-dense – et me voilà devant la boîte aux lettres que le facteur avait laissée ouverte au soleil du matin…et à l’orage du soir ! Tout le courrier trempé de chez trempé, avec, vous vous en doutez, votre lettre de réservation, chèque à l’eau, encre délavée. »

La boite aux histoires.

Dom

*********
Le 01 Octobre 2012 19:55, C.fr> a écrit :

Bonjour,

Je ne suis pas étonnée que le chèque soit arrivé samedi, j’ai traité la situation samedi matin avec HCZN le symbole de distance. Pourquoi je ne l’ai pas fait plus tôt ?

Surement trop de situations à traiter en ce moment… Mais ce qui m’étonne toujours avec le reiki c’est la rapidité et la synchronicité avec laquelle ça répond de quelque manière que ce soit.

Je me dis que les « petits lutins » doivent bien rigoler en ce moment, parce que j’ai des travaux pratiques tous les jours bien concrets. Cela me fait penser aux apprentissages des derviches tourneurs, où l’initié est roulé dans la farine, éprouvé dans ses différentes peurs, raillé jusqu’à ce que l’ego laisse place à sa véritable nature.

Je navigue avec confiance et peur. Ces deux là pourraient bien être sœurs.

17 jours… 21 auraient été plus parlant ! J’ai l’image de la boîte aux lettres restée ouverte battante sous la pluie, de la lettre arrosée et du facteur qui lui laisse encore la possibilité de s’échapper. Mais non, elle est restée. Je me demande si le facteur l’avait pas dans sa poche, attendant le signal pour la déposer !

Un simple voyage postal peut se transformer en épopée. Tout ça pour un chèque de réservation de maîtrise reiki.

Cela ressemble à mon voyage intérieur.

Bien à vous.

C.

******

________________________________________

De : dom jeambrun <contact@planete-reiki.fr>

À : C.fr>

Envoyé le : Mercredi 3 octobre 2012 13h31

Objet : Re: Reçu

Merci de ce partage ; j’adore ce genre d’histoires intérieur-extérieur-univers, celles des autres autant que celles qui m’arrivent.

En plus vous avez une belle plume.

ça vous dirais que je la publie lors de la prochaine newletter Reiki ? Anonyme.

**********

C.fr) :

OK pour la newletter et le rajout !

C’est drôle de découvrir l’autre côté de l’histoire, vécu par vous l’autre personnage. Il était temps d’arriver….

Il manque le point de vue du facteur, ça me donne envie de l’interroger.

Merci pour le compliment. Moi j’adore votre site, j’aime l’écriture, le ton sur lequel vous parlez du Reiki.

Bonne soirée.

C.

 

 

 

 

 

Ha ! L’eau ! C’est Marasu Emoto qui a prouvé, par de nombreuses observations et expériences – photos à l’appui -, que l’eau mémorisait toutes sortes d’informations : nos émotions, nos pensées, nos paroles, nos sentiments, et même la musique. Elle est donc sensible à l’énergie. (Les paroles, les pensées sont des énergies).
    L’eau, c’est 70% du corps. Il suffit de bien lui parler, à notre eau, pour que le corps aille bien. Et quand le corps va, la vie va.
Mais Marasu Emoto, à aussi remarqué que l’eau se déprogrammait relativement vite des bonnes intentions qu’il lui avait donné, et qu’il lui fallait répéter souvent ces bonnes intentions afin qu’elle reste…docilement belle.     On comprendra donc ceci ; il en va de même pour le corps avec les soins Reiki.

     Bien entendu un soin Reiki de temps en temps ça ne fait pas de mal, bien au contraire. Surtout reçu de plusieurs mains comme lors des soirées partage. Mais rien n’est aussi remarquable que lorsqu’on se donne ou qu’on reçoit du Reiki au quotidien. Je compare cet effet de bien être avec les travaux d’Emoto car le Reiki pénètre chaque cellule du corps et purifie, éveille, réveille, rénove, secoue et rajeunie l’eau des cellules. J’invente ces adjectifs sans savoir si ce sont bien les mots justes mais pour donner une idée de ce travail merveilleux qui opère en nous grâce à l’amour du Reiki, et tenter d’en donner une explication matérielle.Je me réfère pour cela à mon séjour au Canada auprès du professeur Jean Rocan lorsque, tout en jeûnant à l’eau pure uniquement, j’écoutais inlassablement les 70 cassettes enregistrées lors de ses cours en Facs sur, justement, les cellules du corps humain.

J’écoutais dans ce même temps le travail de mes propres cellules dans mon corps, ces cellules qui bossent lorsqu’on jeûne et qui rénovent, purifient, éveillent, réveillent, secouent et rajeunissent l’eau que nous sommes.
Aquatiquement vôtre, Dom.J

Soirée partage Vendredi 23 Mai au Dojo Reiki Usui Karuna ; Marido exposera son travail créatif ; de belles Orgonites. Il n’y en aura pas beaucoup, elle les fait une à une, avec amour et tout son savoir faire de praticienne Reiki 2.
Cela fait plusieurs années que je me sers des Orgonites dans mes stages Reiki pour les initiations, pour les soins et au cours des soirées partage. Parfois je dors avec une d’elles à mes cotés. L’orgonite agit sur le chakra du coeur.
Dans les années 1980, le scientifique Karl Hans Welz, découvrit que l’association résine ( chaines de polymères de carbonne )/ métal, transformait les perturbations négatives accumulées par l’Orgone en énergie positive. L’interaction dynamique de ces deux substances devenait la base de l’invention de l’Orgonite.
Un autre chercheur, Don Croft, améliora ensuite le procédé : il ajouta dans l’orgonite du cristal de roche qui de part ses nombreuses qualités permet entre autre de réorganiser l’orgone mais aussi d’être  » un réservoir d’information « .L’orgonite devint une matrice capable de capter l’énergie négative, de la filtrer et de la transmuter en énergie positive.

Written on octobre 17th, 2012 , news Tags: , ,

Recette d’élixir de minéraux et d’énergie Reiki !

Dés le deuxième degré de Reiki Usui nous apprenons à utiliser les cristaux de quartz pour amplifier et prolonger les envois de Reiki à distance, autant pour soi dans le passé le présent et le futur, que pour les soins et les marathon Reiki à Autrui. Bien entendu les cristaux de quartz ne se limitent pas à cette déjà si merveilleuse action. En voici une recette d’Élixirs de minéraux !

Préparation d’un élixir Reiki :

Mettre le cristal de quartz, cristal de roche – après l’avoir nettoyer – dans un verre d’eau minérale, eau de source…et Couvrez le – exple : verres « Nutella » à couvercle ! – puis donnez lui du Reiki et l’énergie du ou des symboles au moins 3 minutes – En faisant cela pensez à ce que vous désirez de l’action de la pierre- , et placez-le au réfrigérateur pendant une nuit.
Le lendemain, faites à nouveau 3 minutes de Reiki avec le symbole(s) et il peut être bu ou appliqué.
Appliqué en massages, en onction, pour une plante, dans une recette de cuisine, sur une plaie…ect.

Attention : Certains cristaux par leur composition ne peuvent être mis dans l’eau ou sont toxiques donc ne doivent pas être ingéré ; renseignez vous !!…

PLANETE REIKI is proudly powered by WordPress and the Theme Adventure by Eric Schwarz
Entries (RSS) and Comments (RSS).

%d blogueurs aiment cette page :